A Pilot Study Investigating the Role of Gender in the Intergenerational Relationships between Gene Expression, Chronic Pain, and Adverse Childhood Experiences in a Clinical Sample of Youth with Chronic Pain
Abstract
1. Introduction
2. Results
Relationship between Gene Expression, Chronic Pain, and ACEs
3. Discussion
4. Materials and Methods
4.1. Participants
4.2. Procedure
4.3. Self-Report Measures
4.4. mRNA Analysis
4.5. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Treede, R.D.; Rief, W.; Barke, A.; Aziz, Q.; Bennett, M.I.; Benoliel, R.; Cohen, M.; Evers, S.; Finnerup, N.B.; First, M.B.; et al. A classification of chronic pain for ICD. Pain 2015, 156, 1003–1007. [Google Scholar] [CrossRef] [Scilit]
- Stone, A.L.; Wilson, A.C. Transmission of risk from parents with chronic pain to offspring: An integrative conceptual model. Pain 2016, 157, 2628–2639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Institute of Medicine. Relieving Pain in America: A Blueprint for Transforming Prevention, Care, Education, and Research; Institute of Medicine of the National Academies: Washington, DC, USA, 2011. [Google Scholar]
- Groenewald, C.B.; Essner, B.S.; Wright, D.; Fesinmeyer, M.D.; Palermo, T.M. The Economic Costs of Chronic Pain among a Cohort of Treatment-Seeking Adolescents in the United States. J. Pain 2014, 15, 925–933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vinall, J.; Pavlova, M.; Asmundson, G.J.G.; Rasic, N.; Noel, M. Mental Health Comorbidities in Pediatric Chronic Pain: A Narrative Review of Epidemiology, Models, Neurobiological Mechanisms and Treatment. Children 2016, 3, 40. [Google Scholar] [CrossRef] [Scilit]
- King, S.; Chambers, C.T.; Huguet, A.; MacNevin, R.C.; McGrath, P.J.; Parker, L.; Macdonald, A.J. The epidemiology of chronic pain in children and adolescents revisited: A systematic review. Pain 2011, 152, 2729–2738. [Google Scholar] [CrossRef] [Scilit]
- Noel, M.; Groenewald, C.B.; Beals-Erickson, S.; Gebert, J.; Palermo, T. Chronic pain in adolescence and internalizing mental health disorders: A nationally representative study. Pain 2016, 157, 1333–1338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herpertz-Dahlmann, B.; Bühren, K.; Remschmidt, H. Growing up is hard: Mental disorders in adolescence. Dtsch. Ärz-Teblatt Int. 2013, 110, 432–440. [Google Scholar]
- Nelson, S.M.; Cunningham, N.R.; Kashikar-Zuck, S. A conceptual framework for understanding the role of adverse child-hood experiences in pediatric chronic pain. Clin. J. Pain 2017, 33, 264–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kerker, B.D.; Zhang, J.; Nadeem, E.; Stein, R.E.; Hurlburt, M.S.; Heneghan, A.; Landsverk, J.; Horwitz, S.M. Adverse Childhood Experiences and Mental Health, Chronic Medical Conditions, and Development in Young Children. Acad. Pediatr. 2015, 15, 510–517. [Google Scholar] [CrossRef] [Scilit]
- Tietjen, G.E.; Khubchandani, J.; Herial, N.A.; Shah, K. Adverse Childhood Experiences Are Associated With Migraine and Vascular Biomarkers. Headache J. Head Face Pain 2012, 52, 920–929. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Felitti, V.J.; Anda, R.F.; Nordenberg, D.; Williamson, D.F.; Spitz, A.M.; Edwards, V.; Koss, M.P.; Marks, J.S. REPRINT OF: Relationship of Childhood Abuse and Household Dysfunction to Many of the Leading Causes of Death in Adults: The Adverse Childhood Experiences (ACE) Study. Am. J. Prev. Med. 2019, 56, 774–786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nelson, S.; Simons, L.E.; Logan, D. The Incidence of Adverse Childhood Experiences (ACEs) and Their Association With Pain-related and Psychosocial Impairment in Youth with Chronic Pain. Clin. J. Pain 2018, 34, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Anda, R.; Tietjen, G.; Schulman, E.; Felitti, V.; Croft, J. Adverse Childhood Experiences and Frequent Headaches in Adults. Headache J. Head Face Pain 2010, 50, 1473–1481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalmakis, K.A.; Chandler, G.E. Health consequences of adverse childhood experiences: A systematic review. J. Am. Assoc. Nurse Pr. 2015, 27, 457–465. [Google Scholar] [CrossRef] [Scilit]
- Beal, S.J.; Kashikar-Zuck, S.; King, C.; Black, W.; Barnes, J.; Noll, J.G. Heightened risk of pain in young adult women with a history of childhood maltreatment: A prospective longitudinal study. Pain 2020, 161, 156–165. [Google Scholar] [CrossRef] [Scilit]
- Atzl, V.M.; Narayan, A.J.; Rivera, L.M.; Lieberman, A.F. Adverse childhood experiences and prenatal mental health: Type of ACEs and age of maltreatment onset. J. Fam. Psychol. 2019, 33, 304–314. [Google Scholar] [CrossRef] [Scilit]
- Higgins, K.S.; Birnie, K.A.; Chambers, C.T.; Wilson, A.C.; Caes, L.; Clark, A.J.; Lynch, M.; Stinson, J.; Campbell-Yeo, M. Offspring of parents with chronic pain: A systematic review and meta-analysis of pain, health, psychological, and family outcomes. Pain 2015, 156, 2256. [Google Scholar] [CrossRef] [Scilit]
- Beveridge, J.K.; Dobson, K.S.; Madigan, S.; Yeates, K.O.; Stone, A.L.; Wilson, A.C.; Salberg, S.; Mychasiuk, R.; Noel, M. Adverse childhood experiences in parents of youth with chronic pain: Prevalence and comparison with a community-based sample. Pain Rep. 2020, 5, e866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lê-Scherban, F.; Wang, X.; Boyle-Steed, K.H.; Pachter, L.M. Intergenerational associations of parent adverse childhood ex-periences and child health outcomes. Pediatrics 2018, 141, e20174274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madigan, S.; Wade, M.; Plamondon, A.; Maguire, J.L.; Jenkins, J.M. Maternal Adverse Childhood Experience and Infant Health: Biomedical and Psychosocial Risks as Intermediary Mechanisms. J. Pediatr. 2017, 187, 282–289.e1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McDonnell, C.G.; Valentino, K. Intergenerational effects of childhood trauma: Evaluating pathways among maternal ACEs, perinatal depressive symptoms, and infant outcomes. Child. Maltreat. 2016, 21, 317–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plant, D.T.; Pawlby, S.; Pariante, C.M.; Jones, F.W. When one childhood meets another—maternal childhood trauma and offspring child psychopathology: A systematic review. Clin. Child. Psychol. Psychiatry 2018, 23, 483–500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Racine, N.M.; Madigan, S.L.; Plamondon, A.R.; McDonald, S.W.; Tough, S.C. Differential Associations of Adverse Childhood Experience on Maternal Health. Am. J. Prev. Med. 2018, 54, 368–375. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.; Patel, F.; Rose-Jacobs, R.; Frank, D.A.; Black, M.M.; Chilton, M. Mothers’ adverse childhood experiences and their young children’s development. Am. J. Prev. Med. 2017, 53, 882–891. [Google Scholar] [CrossRef] [Scilit]
- Treat, A.E.; Sheffield-Morris, A.; Williamson, A.C.; Hays-Grudo, J. Adverse childhood experiences and young children’s social and emotional development: The role of maternal depression, self-efficacy, and social support. Early Child. Dev. Care 2020, 190, 2422–2436. [Google Scholar] [CrossRef] [Scilit]
- Dennis, C.H.; Clohessy, D.S.; Stone, A.L.; Darnall, B.D.; Wilson, A.C. Adverse Childhood Experiences in Mothers With Chronic Pain and Intergenerational Impact on Children. J. Pain 2019, 20, 1209–1217. [Google Scholar] [CrossRef] [Scilit]
- Donnelly, T.J.; Palermo, T.M.; Newton-John, T.R. Parent cognitive, behavioural, and affective factors and their relation to child pain and functioning in pediatric chronic pain: A systematic review and meta-analysis. Pain 2020, 161, 1401–1419. [Google Scholar] [CrossRef] [Scilit]
- Noel, M.; Wilson, A.C.; Holley, A.L.; Durkin, L.; Patton, M.; Palermo, T.M. Post-traumatic stress disorder symptoms in youth with versus without chronic pain. Pain 2016, 157, 2277–2284. [Google Scholar] [CrossRef] [Scilit]
- Beveridge, J.K.; Neville, A.; Wilson, A.C.; Noel, M. Intergenerational examination of pain and posttraumatic stress disorder symptoms among youth with chronic pain and their parents. Pain Rep. 2018, 3, e667. [Google Scholar] [CrossRef] [Scilit]
- Diatchenko, L.; Slade, G.D.; Nackley, A.G.; Bhalang, K.; Sigurdsson, A.; Belfer, I.; Goldman, D.; Xu, K.; Shabalina, S.A.; Shagin, D.; et al. Genetic basis for individual variations in pain perception and the development of a chronic pain condition. Hum. Mol. Genet. 2004, 14, 135–143. [Google Scholar] [CrossRef] [Scilit]
- Broekman, B.; Olff, M.; Boer, F. The genetic background to PTSD. Neurosci. Biobehav. Rev. 2007, 31, 348–362. [Google Scholar] [CrossRef] [Scilit]
- Asmundson, G.J.G.; Coons, M.J.; Taylor, S.; Katz, J. PTSD and the Experience of Pain: Research and Clinical Implications of Shared Vulnerability and Mutual Maintenance Models. Can. J. Psychiatry 2002, 47, 930–937. [Google Scholar] [CrossRef] [Scilit]
- Descalzi, G.; Ikegami, D.; Ushijima, T.; Nestler, E.J.; Zachariou, V.; Narita, M. Epigenetic mechanisms of chronic pain. Trends Neurosci. 2015, 38, 237–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nelson, E.D.; Monteggia, L.M. Epigenetics in the mature mammalian brain: Effects on behavior and synaptic transmission. Neurobiol. Learn. Mem. 2011, 96, 53–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berger, S.L. The complex language of chromatin regulation during transcription. Nat. Cell Biol. 2007, 447, 407–412. [Google Scholar] [CrossRef] [Scilit]
- Fraga, M.F.; Ballestar, E.; Paz, M.F.; Ropero, S.; Setien, F.; Ballestar, M.L.; Heine-Suñer, D.; Cigudosa, J.C.; Urioste, M.; Benitez, J.; et al. From The Cover: Epigenetic differences arise during the lifetime of monozygotic twins. Proc. Natl. Acad. Sci. USA 2005, 102, 10604–10609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imai, S.; Ikegami, D.; Yamashita, A.; Shimizu, T.; Narita, M.; Niikura, K.; Furuya, M.; Kobayashi, Y.; Miyashita, K.; Okutsu, D.; et al. Epigenetic transcriptional activation of monocyte chemotactic protein 3 contributes to long-lasting neuropathic pain. Brain 2013, 136, 828–843. [Google Scholar] [CrossRef] [Scilit]
- Imai, S.; Saeki, M.; Yanase, M.; Horiuchi, H.; Abe, M.; Narita, M.; Kuzumaki, N.; Suzuki, T.; Narita, M. Change in MicroRNAs Associated with Neuronal Adaptive Responses in the Nucleus Accumbens under Neuropathic Pain. J. Neurosci. 2011, 31, 15294–15299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Cai, Y.-Q.; Zou, F.; Bie, B.; Pan, Z.Z. Epigenetic suppression of GAD65 expression mediates persistent pain. Nat. Med. 2011, 17, 1448–1455. [Google Scholar] [CrossRef] [Scilit]
- Kress, M.; Hüttenhofer, A.; Landry, M.; Kuner, R.; Favereaux, A.; Greenberg, D.S.; Bednarik, J.; Heppenstall, P.; Kronenberg, F.; Malcangio, M.; et al. microRNAs in nociceptive circuits as predictors of future clinical applications. Front. Mol. Neurosci. 2013, 6. [Google Scholar] [CrossRef] [Scilit]
- Salberg, S.; Noel, M.; Burke, N.N.; Vinall, J.; Mychasiuk, R. Utilization of a rodent model to examine the neurological effects of early life adversity on adolescent pain sensitivity. Dev. Psychobiol. 2020, 62, 386–399. [Google Scholar] [CrossRef] [Scilit]
- Zhu, X.; Peng, S.; Zhang, S.; Zhang, X. Stress-induced depressive behaviors are correlated with Par-4 and DRD2 expression in rat striatum. Behav. Brain Res. 2011, 223, 329–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blackburn-Munro, G.; Blackburn-Munro, R.E. Chronic Pain, Chronic Stress and Depression: Coincidence or Consequence? J. Neuroendocr. 2001, 13, 1009–1023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wankerl, M.; Miller, R.; Kirschbaum, C.; Hennig, J.; Stalder, T.; Alexander, N. Effects of genetic and early environmental risk factors for depression on serotonin transporter expression and methylation profiles. Transl. Psychiatry 2014, 4, e402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huguet, A.; Miró, J. The Severity of Chronic Pediatric Pain: An Epidemiological Study. J. Pain 2008, 9, 226–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walker, L.S.; Sherman, A.L.; Bruehl, S.; Garber, J.; Smith, C.A. Functional abdominal pain patient subtypes in childhood predict functional gastrointestinal disorders with chronic pain and psychiatric comorbidities in adolescence and adulthood. Pain 2012, 153, 1798–1806. [Google Scholar] [CrossRef] [Scilit]
- Chitkara, D.K.; Rawat, D.J.; Talley, N.J. The Epidemiology of Childhood Recurrent Abdominal Pain in Western Countries: A Systematic Review. Am. J. Gastroenterol. 2005, 100, 1868–1875. [Google Scholar] [CrossRef] [Scilit]
- Sperotto, F.; Brachi, S.; Vittadello, F.; Zulian, F. Musculoskeletal pain in schoolchildren across puberty: A 3-year follow-up study. Pediatric Rheumatol. 2015, 13, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Carlsson, J. Prevalence of headache in schoolchildren: Relation to family and school factors. Acta Paediatr. 1996, 85, 692–696. [Google Scholar] [CrossRef] [Scilit]
- Pavlova, M.; Ference, J.; Hancock, M.; Noel, M. Disentangling the sleep-pain relationship in pediatric chronic pain: The me-diating role of internalizing mental health symptoms. Pain Res. Manag. 2017. [Google Scholar] [CrossRef] [Scilit]
- Gunnar, M.; Quevedo, K. The Neurobiology of Stress and Development. Annu. Rev. Psychol. 2007, 58, 145–173. [Google Scholar] [CrossRef] [Scilit]
- Hollis, F.; Isgor, C.; Kabbaj, M. The consequences of adolescent chronic unpredictable stress exposure on brain and behavior. Neuroscience 2013, 249, 232–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McEwen, B.S. Neurobiological and Systemic Effects of Chronic Stress. Chronic Stress 2017, 1, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serafini, R.A.; Pryce, K.D.; Zachariou, V. The Mesolimbic Dopamine System in Chronic Pain and Associated Affective Comorbidities. Biol. Psychiatry 2020, 87, 64–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ledermann, K.; Jenewein, J.; Sprott, H.; Hasler, G.; Schnyder, U.; Warnock, G.; Johayem, A.; Kollias, S.; Buck, A.; Martin-Soelch, C.; et al. Relation of dopamine receptor 2 binding to pain perception in female fibromyalgia patients with and without depression—A [11 C] raclopride PET-study. Eur. Neuropsychopharmacol. 2016, 26, 320–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martikainen, I.K.; Nuechterlein, E.B.; Peciña, M.; Love, T.M.; Cummiford, C.M.; Green, C.R.; Stohler, C.S.; Zubieta, J.-K. Chronic Back Pain Is Associated with Alterations in Dopamine Neurotransmission in the Ventral Striatum. J. Neurosci. 2015, 35, 9957–9965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Breslau, N. The Epidemiology of Trauma, PTSD, and Other Posttrauma Disorders. Trauma Violence Abus. 2009, 10, 198–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altemus, M. Sex differences in depression and anxiety disorders: Potential biological determinants. Horm. Behav. 2006, 50, 534–538. [Google Scholar] [CrossRef] [Scilit]
- Leadbeater, B.J.; Kuperminc, G.P.; Blatt, S.J.; Hertzog, C. A multivariate model of gender differences in adolescents’ inter-nalizing and externalizing problems. Dev. Psychol. 1999, 35, 1268–1282. [Google Scholar] [CrossRef]
- Noble, R.E. Depression in women. Metabolism 2005, 54, 49–52. [Google Scholar] [CrossRef] [Scilit]
- Piccinelli, M.; Wilkinson, G. Gender differences in depression: Critical review. Brit. J. Psychiatry 2000, 177, 486–492. [Google Scholar] [CrossRef] [Scilit]
- Zubieta, J.K.; Heitzeg, M.M.; Smith, Y.R.; Bueller, J.A.; Xu, K.; Xu, Y.; Koeppe, R.A.; Stohler, C.S.; Goldman, D. COMT val158met genotype affects µ-opioid neurotransmitter responses to a pain stressor. Science 2003, 299, 1240–1243. [Google Scholar] [CrossRef] [Scilit]
- McKittrick, C.; Magarinos, A.; Blanchard, D.C.; Blanchard, R.J.; McEwen, B.; Sakai, R. Chronic social stress reduces dendritic arbors in CA3 of hippocampus and decreases binding to serotonin transporter sites. Synapse 2000, 36, 85–94. [Google Scholar] [CrossRef]
- Houwing, D.J.; Buwalda, B.; Van Der Zee, E.A.; De Boer, S.F.; Olivier, J.D.A. The Serotonin Transporter and Early Life Stress: Translational Perspectives. Front. Cell. Neurosci. 2017, 11. [Google Scholar] [CrossRef] [Scilit]
- Meaney, M.J.; Diorio, J.; Francis, D.; Widdowson, J.; LaPlante, P.; Caldji, C.; Sharma, S.; Seckl, J.R.; Plotsky, P.M. Early en-vironmental regulation of forebrain glucocorticoid receptor gene expression: Implications for adrenocortical response to stress. Dev. Neurosci. 1996, 18, 61–72. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.; Diorio, J.; Tannenbaum, B.; Caldji, C.; Francis, D.; Freedman, A.; Sharma, S.; Pearson, D.; Plotsky, P.M.; Meaney, M.J. Maternal Care, Hippocampal Glucocorticoid Receptors, and Hypothalamic-Pituitary-Adrenal Responses to Stress. Science 1997, 277, 1659–1662. [Google Scholar] [CrossRef] [Scilit]
- Takasaki, I.; Kurihara, T.; Hironao, S.; Zong, S.; Tanabe, T. Effects of glucocorticoid receptor antagonists on allodynia and hyperlgesia in a mouse model of neuropathic pain. Eur. J. Pharm. 2005, 524, 80–83. [Google Scholar] [CrossRef] [Scilit]
- Olivieri, P.; Solitar, B.; Dubois, M. Childhood risk factors for developing fibromyalgia. Open Access Rheumatol. Res. Rev. 2012, 4, 109–114. [Google Scholar] [CrossRef] [Scilit]
- Park, S.H.; Videlock, E.J.; Shih, W.; Presson, A.P.; Mayer, E.A.; Chang, L. Adverse childhood experiences are associated with irritable bowel syndrome and gastrointestinal symptom severity. Neurogastroenterol. Motil. 2016, 28, 1252–1260. [Google Scholar] [CrossRef] [Scilit]
- Sachs-Ericsson, N.J.; Sheffler, J.L.; Stanley, I.H.; Piazza, J.R.; Preacher, K.J. When Emotional Pain Becomes Physical: Adverse Childhood Experiences, Pain, and the Role of Mood and Anxiety Disorders. J. Clin. Psychol. 2017, 73, 1403–1428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalmakis, K.A.; Chiodo, L.M.; Kent, N.; Meyer, J.S. Adverse childhood experiences, post-traumatic stress disorder symptoms, and self-reported stress among traditional and nontraditional college students. J. Am. Coll. Health 2019, 68, 411–418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scott, K.M.; Von Korff, M.; Angermeyer, M.C.; Benjet, C.; Bruffaerts, R.; De Girolamo, G.; Haro, J.M.; Lepine, J.P.; Ormel, J.; Posada-Villa, J.; et al. Association of childhood adversities and early-onset mental disorders with adult-onset chronic physical conditions. Arch. Gen. Psychiatry 2011, 68, 838–844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deighton, S.; Neville, A.; Pusch, D.; Dobson, K. Biomarkers of adverse childhood experiences: A scoping review. Psychiatry Res. 2018, 269, 719–732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herzog, J.I.; Schmahl, C. Adverse Childhood Experiences and the Consequences on Neurobiological, Psychosocial, and Somatic Conditions across the Lifespan. Front. Psychiatry 2018, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evans, S.; Keenan, T.R.; Shipton, E.A. Psychosocial adjustment and physical health of children living with maternal chronic pain. J. Paediatr. Child. Health 2007, 43, 262–270. [Google Scholar] [CrossRef] [Scilit]
- Goodman, S.H. Intergenerational transmisison of depression. Annu. Rev. Clin. Psychol. 2020, 16, 213–238. [Google Scholar] [CrossRef] [Scilit]
- Beveridge, J.K.; Yeates, K.O.; Madigan, S.; Stone, A.; Wilson, A.; Sumpton, J.E.; Salberg, S.; Mychasiuk, R.; Noel, M. Examining parent adverse childhood experiences as a distal risk factor in pediatric chronic pain. Beveridge 2020. Under Review. [Google Scholar]
- Campo, J.V. Functional abdominal pain in childhood: Lifetime and familial associations with irritable bowel syndrome and psychiatric disorders. Prim. Psychiatry 2007, 14, 64–68. [Google Scholar]
- Tran, S.T.; Koven, M.L.; Castro, A.S.; Arce, A.B.G.; Carter, J.S. Sociodemographic and Environmental Factors are Associated with Adolescents’ Pain and Longitudinal Health Outcomes. J. Pain 2020, 21, 170–181. [Google Scholar] [CrossRef] [Scilit]
- Green, C.R.; Anderson, K.O.; Baker, T.A.; Campbell, L.C.; Decker, S.; Fillingim, R.B.; Kaloukalani, D.A.; Lasch, K.E.; Myers, C.; Tait, R.C.; et al. The Unequal Burden of Pain: Confronting Racial and Ethnic Disparities in Pain. Pain Med. 2003, 4, 277–294. [Google Scholar] [CrossRef] [Scilit]
- Green, C.; Todd, K.H.; Lebovits, A.; Francis, M. Disparities in Pain: Ethical Issues. Pain Med. 2006, 7, 530–533. [Google Scholar] [CrossRef] [Scilit]
- Neville, A.; Griep, Y.; Palermo, T.M.; Vervoort, T.; Schulte, F.; Yeates, K.O.; Sumpton, J.E.; Mychasiuk, R.; Noel, M. A “dyadic dance”: Pain catastrophizing moderates the daily relationships between parent mood and protective responses and child chronic pain. Pain 2020, 161, 1072–1082. [Google Scholar] [CrossRef] [Scilit]
- Neville, A.; Jordan, A.; Beveridge, J.K.; Pincus, T.; Noel, M. Diagnostic Uncertainty in Youth with Chronic Pain and Their Parents. J. Pain 2019, 20, 1080–1090. [Google Scholar] [CrossRef] [Scilit]
- Neville, A.; Jordan, A.; Pincus, T.; Nania, C.; Schulte, F.; Yeates, K.O.; Noel, M. Diagnostic uncertainty in pediatric chronic pain: Nature, prevalence, and consequences. Pain Rep. 2020, 5, e871. [Google Scholar] [CrossRef] [Scilit]
- Neville, A.; Kopala-Sibley, D.C.; Soltani, S.; Asmundson, G.J.; Jordan, A.; Carleton, R.N.; Yeates, K.O.; Schulte, F.; Noel, M. A longitudinal examination of the interpersonal fear avoidance model of pain: The role of intolerance of uncertainty. Pain 2021, 162, 152–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pavlova, M.; Kopala-Sibley, D.C.; Nania, C.; Mychasiuk, R.; Christensen, J.; McPeak, A.; Tomfohr-Madsen, L.; Katz, J.; Palermo, T.M.; Noel, M. Sleep disturbance underlies the co-occurrence of trauma and pediatric chronic pain: A longitudinal examination. Pain 2020, 161, 821–830. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soltani, S.; van Ryckeghem, D.M.L.; Vervoort, T.; Heathcote, L.C.; Yeates, K.; Sears, C.; Noel, M. Attentional biases in pe-diatric chronic pain: An eye-tracking study assessing the nature of the bias and its relation to attentional control. Pain 2020, 161, 2263–2273. [Google Scholar] [CrossRef] [Scilit]
- Harris, P.A.; Taylor, R.; Minor, B.L.; Elliott, V.; Fernandez, M.; O’Neal, L.; McLeod, L.; Delacqua, G.; Delacqua, F.; Kirby, J.; et al. The REDCap consortium: Building an international community of software platform partners. J. Biomed. Inf. 2019, 95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harris, P.A.; Taylor, R.; Thielke, R.; Payne, J.; Gonzalez, N.; Conde, J.G. Research electronic data capture (REDCap)—A metadata-driven methodology and workflow process for providing translational research informatics support. J. Biomed. Inf. 2009, 42, 377–381. [Google Scholar] [CrossRef] [Scilit]
- Bernstein, D.P.; Stein, J.A.; Newcomb, M.D.; Walker, E.; Pogge, D.; Ahluvalia, T.; Stokes, J.; Handelsman, L.; Medrano, M.; Desmond, D.; et al. Development and validation of a brief screening version of the Childhood Trauma Questionnaire. Child. Abus. Negl. 2003, 27, 169–190. [Google Scholar] [CrossRef] [Scilit]
- Straus, M.A. Measuring Intrafamily Conflict and Violence: The Conflict Tactics (CT) Scales. Phys. Violence Am. Fam. 2017, 41, 29–48. [Google Scholar] [CrossRef] [Scilit]
- Wyatt, G.E. The sexual abuse of Afro-American and White-American women in childhood. Child. Abus. Negl. 1985, 9, 507–519. [Google Scholar] [CrossRef] [Scilit]
- Dube, S.R.; Williamson, D.F.; Thompson, T.; Felitti, V.J.; Anda, R.F. Assessing the reliability of retrospective reports of adverse childhood experiences among adult HMO members attending a primary care clinic. Child. Abus. Negl. 2004, 28, 729–737. [Google Scholar] [CrossRef] [Scilit]
- Ford, D.C.; Merrick, M.T.; Parks, S.E.; Breiding, M.J.; Gilbert, L.K.; Edwards, V.J.; Dhingra, S.S.; Barile, J.P.; Thompson, W.W. Examination of the factorial structure of adverse childhood experiences and recommendations for three subscale scores. Psychol. Violence 2014, 4, 432–444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frampton, N.M.; Poole, J.C.; Dobson, K.S.; Pusch, D. The effects of adult depression on the recollection of adverse childhood experiences. Child. Abus. Negl. 2018, 86, 45–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mersky, J.P.; Janczewski, C.E.; Topitzes, J. Rethinking the measurement of adversity: Moving toward second-generation research on adverse childhood experiences. Child. Maltreat. 2017, 22, 58–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Birnie, K.A.; Heathcote, L.C.; Bhandari, R.P.; Feinstein, A.; Yoon, I.A.; Simons, L.E. Parent physical and mental health contributions to interpersonal fear avoidance processes in pediatric chronic pain. Pain 2020, 161, 1202–1211. [Google Scholar] [CrossRef] [Scilit]
- Weathers, F.W.; Litz, B.T.; Keane, T.M.; Palmieri, P.A.; Marx, B.P.; Schnurr, P.P. The PTSD Checklist for DSM-5 with Life Events Checklist for DSM-5 and Criterion. In A Measurement Instrument; National Center for PTSD: Baltimore, MD, USA, 2013. [Google Scholar]
- Blevins, C.A.; Weathers, F.W.; Davis, M.T.; Witte, T.K.; Domino, J.L. The Posttraumatic Stress Disorder Checklist for DSM-5 (PCL-5): Development and Initial Psychometric Evaluation. J. Trauma. Stress 2015, 28, 489–498. [Google Scholar] [CrossRef] [Scilit]
- Palermo, T.M.; Witherspoon, D.; Valenzuela, D.; Drotar, D.D. Development and validation of the Child Activity Limitations Interview: A measure of pain-related functional impairment in school-age children and adolescents. Pain 2004, 109, 461–470. [Google Scholar] [CrossRef]
- Von Baeyer, C.L.; Spagrud, L.J.; McCormick, J.C.; Choo, E.; Neville, K.; Connelly, M.A. Three new datasets supporting use of the Numerical Rating Scale (NRS-11) for children’s self-reports of pain intensity. Pain 2009, 143, 223–227. [Google Scholar] [CrossRef] [Scilit]
- Neville, A.; Soltani, S.; Pavlova, M.; Noel, M. Unravelling the Relationship between Parent and Child PTSD and Pediatric Chronic Pain: The Mediating Role of Pain Catastrophizing. J. Pain 2018, 19, 196–206. [Google Scholar] [CrossRef] [Scilit]
- Kashikar-Zuck, S.; Carle, A.; Barnett, K.; Goldschneider, K.R.; Sherry, D.D.; Mara, C.A.; Cunningham, N.; Farrell, J.; Tress, J.; DeWitt, E.M. Longitudinal evaluation of Patient Reported Outcomes Measurement Information Systems (PROMIS) measures in pediatric chronic pain. Pain 2016, 157, 339–347. [Google Scholar] [CrossRef] [Scilit]
- Foa, E.B.; Asnaani, A.; Zang, Y.; Capaldi, S.; Yeh, R. Psychometrics of the Child PTSD Symptom Scale for DSM-5 for trau-ma-exposed children and adolescents. J. Clin. Child. Adolesc. Psychol. 2018, 47, 38–46. [Google Scholar] [CrossRef] [Scilit]
- Dieffenbach, C.W.; Lowe, T.M.; Dveksler, G.S. General concepts for PCR primer design. Genome Res. 1993, 3, S30–S37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paszti-Gere, E.; Csibrik-Nemeth, E.; Szeker, K.; Csizinszky, R.; Jakab, C.; Galfi, P. Acute Oxidative Stress Affects IL-8 and TNF-α Expression in IPEC-J2 Porcine Epithelial Cells. Inflammation 2011, 35, 994–1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- VanGuilder, H.D.; Vrana, K.E.; Freeman, W.M. Twenty-five years of quantitative PCR for gene expression analysis. Biotechniques 2008, 44, 619–626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panahi, Y.; Moghaddam, F.S.; Ghasemi, Z.; Jafari, M.H.; Badv, R.S.; Eskandari, M.R.; Pedram, M. Selection of Suitable Reference Genes for Analysis of Salivary Transcriptome in Non-Syndromic Autistic Male Children. Int. J. Mol. Sci. 2016, 17, 1711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, S.B.; Reenilä, I.; Männistö, P.T.; Slade, G.D.; Maixner, W.; Diatchenko, L.; Nackley, A.G. Epistasis between polymorphisms in COMT, ESR1, and GCH1 influences COMT enzyme activity and pain. Pain 2014, 155, 2390–2399. [Google Scholar] [CrossRef] [Scilit]
- Andersen, S.; Skorpen, F. Variation in the COMT gene: Implications for pain perception and pain treatment. Pharmacogenomics 2009, 10, 669–684. [Google Scholar] [CrossRef] [Scilit]
- Tammimäki, A.; Männistö, P.T. Catechol-O-methyltransferase gene polymorphism and chronic human pain: A systematic review and meta-analysis. Pharm. Genom. 2012, 22, 673–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baumbauer, K.M.; Ramesh, D.; Perry, M.; Carney, K.B.; Julian, T.; Glidden, N.; Dorsey, S.G.; Starkweather, A.R.; Young, E.E. Contribution of COMT and BDNF Genotype and Expression to the Risk of Transition From Acute to Chronic Low Back Pain. Clin. J. Pain 2020, 36, 430–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martínez-Jauand, M.; Sitges, C.; Rodriguez, V.; Picornell, A.; Ramon, M.; Buskila, D.; Montoya, P. Pain sensitivity in fibrom-yalgia is associated with catechol-O-methyltransferase (COMT) gene. Eur. J. Pain 2013, 17, 16–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Little, R.J. A test of missing completely at random for multivariate data with missing values. J. Am. Stat. Assoc. 1988, 83, 1198–1202. [Google Scholar] [CrossRef]
| Parent Sample (n = 41) | n | % or M (SD) |
| Age, years | - | 45.29 (5.90) |
| Gender | ||
| Female | 38 | 92.7 |
| Male | 3 | 7.3 |
| Race/ethnicity | ||
| White/Caucasian | 35 | 85.4 |
| Biracial/multiracial | 6 | 14.6 |
| Marital status | ||
| Married or common-law | 33 | 80.5 |
| Separated or divorced | 7 | 17.1 |
| Single | 1 | 2.4 |
| Education | ||
| High school or less | 5 | 12.2 |
| Vocational school or some college (no degree) | 14 | 34.1 |
| College or Bachelor’s degree | 19 | 46.3 |
| Graduate/Professional school (Master’s degree, PhD) | 3 | 7.3 |
| Employment status | ||
| Full-time | 19 | 46.3 |
| Part-time | 13 | 31.7 |
| Not working | 8 | 19.5 |
| Did not answer | 1 | 2.4 |
| Annual household income, CAD | ||
| 0–29,999 | 4 | 9.8 |
| 30,000–59,999 | 5 | 12.2 |
| 60,000–89,999 | 9 | 22.0 |
| >90,000 | 17 | 41.5 |
| Did not answer | 6 | 14.6 |
| Child Sample (n = 86) | n | % or M (SD) |
| Age, years | - | 14.07 (2.27) |
| Gender | ||
| Female | 64 | 74.4 |
| Male | 22 | 25.6 |
| Race/ethnicity | ||
| White/Caucasian | 70 | 81.4 |
| Biracial/multiracial | 6 | 7.0 |
| Black | 2 | 2.3 |
| South Asian | 2 | 2.3 |
| Aboriginal/Indigenous | 1 | 1.2 |
| Arab/West Asian | 1 | 1.2 |
| Latin American | 1 | 1.2 |
| Other | 3 | 3.5 |
| Pain duration, years | - | 3.50 (3.21) |
| Pain locations | ||
| Muscle and joints | 31 | 36.0 |
| Head | 30 | 34.9 |
| Legs | 11 | 12.8 |
| Stomach | 6 | 7.0 |
| Chest | 3 | 3.5 |
| Other | 26 | 30.2 |
| Two or more locations | 37 | 43.0 |
| Pain frequency | ||
| Not at all | 15 | 17.4 |
| Once per week | 21 | 24.4 |
| 2 to 3 times per week | 22 | 25.6 |
| 4 to 6 times per week | 9 | 10.5 |
| Daily | 18 | 20.9 |
| Did not answer | 1 | 1.2 |
| Pain intensity, out of 10 | - | 5.55 (1.81) |
| Variable | M (SD) | Range | n |
|---|---|---|---|
| Parent Total ACEs | 2.34 (2.71) | 0–10 | 41 |
| Parent Total Maltreatment | 1.07 (1.52) | 0–5 | 41 |
| Parent Total Household Dysfunction | 1.27 (1.43) | 0–5 | 41 |
| Parent Chronic Pain Status | - | yes/no | 41 |
| Parent PTSD Symptoms | 9.40 (9.45) | 0–80 | 38 |
| Youth Pain Interference | 55.03 (9.34) | 36.7–74 | 83 |
| Youth PTSD Symptoms | 16.24 (18.58) | 0–80 | 80 |
| Parental ACE Measure | Epigenetic Target | r | p |
|---|---|---|---|
| Total ACEs | Parent COMT Parent DRD2 Parent GR Parent SERT | −0.069 −0.091 −0.209 −0.151 | 0.728 0.644 0.287 0.443 |
| Youth COMT Youth DRD2 Youth GR Youth SERT | 0.045 −0.264 −0.088 −0.189 | 0.725 0.037 0.495 0.138 | |
| Total Maltreatment | Parent COMT Parent DRD2 Parent GR Parent SERT | −0.170 −0.120 −0.217 −0.127 | 0.388 0.543 0.267 0.520 |
| Youth COMT Youth DRD2 Youth GR Youth SERT | 0.029 −0.272 −0.077 −0.113 | 0.823 0.031 0.548 0.378 | |
| Total Household Dysfunction | Parent COMT Parent DRD2 Parent GR Parent SERT | 0.051 −0.046 −0.165 −0.152 | 0.798 0.817 0.401 0.440 |
| Youth COMT Youth DRD2 Youth GR Youth SERT | 0.054 −0.202 −0.081 −0.232 | 0.677 0.113 0.528 0.067 |
| Parental ACE Measure | Epigenetic Target | r | p |
|---|---|---|---|
| Total ACEs | Parent COMT Parent DRD2 Parent GR Parent SERT | −0.681 −0.521 −0.354 −0.240 | 0.030 0.122 0.316 0.504 |
| Youth COMT Youth DRD2 Youth GR Youth SERT | 0.052 0.125 0.059 −0.094 | 0.824 0.589 0.798 0.686 | |
| Total Maltreatment | Parent COMT Parent DRD2 Parent GR Parent SERT | −0.463 −0.570 −0.555 −0.512 | 0.177 0.085 0.096 0.131 |
| Youth COMT Youth DRD2 Youth GR Youth SERT | 0.138 −0.100 −0.099 −0.111 | 0.552 0.666 0.668 0.633 | |
| Total Household Dysfunction | Parent COMT Parent DRD2 Parent GR Parent SERT | −0.737 −0.308 −0.010 0.154 | 0.015 0.386 0.979 0.671 |
| Youth COMT Youth DRD2 Youth GR Youth SERT | −0.063 0.133 0.000 −0.327 | 0.786 0.565 0.998 0.148 |
| Parental ACE Measure | Pain/Psychological Measures | r | p |
|---|---|---|---|
| Total ACEs | Parent PTSD Symptoms Parent Chronic Pain Status | 0.076 0.192 | 0.418 0.032 |
| Youth Pain Interference Youth PTSD Symptoms | 0.026 0.023 | 0.774 0.806 | |
| Total Maltreatment | Parent PTSD Symptoms Parent Chronic Pain Status | 0.097 0.218 | 0.300 0.015 |
| Youth Pain Interference Youth PTSD Symptoms | −0.009 0.001 | 0.918 0.996 | |
| Total Household Dysfunction | Parent PTSD Symptoms Parent Chronic Pain Status | 0.037 0.121 | 0.694 0.182 |
| Youth Pain Interference Youth PTSD Symptoms | 0.057 0.042 | 0.532 0.657 |
| Parental ACE Measure | Pain/Psychological Measures | r | p |
|---|---|---|---|
| Total ACEs | Parent PTSD Symptoms Parent Chronic Pain Status | 0.338 0.110 | 0.031 0.478 |
| Youth Pain Interference Youth PTSD Symptoms | 0.153 0.123 | 0.327 0.450 | |
| Total Maltreatment | Parent PTSD Symptoms Parent Chronic Pain Status | 0.343 0.118 | 0.028 0.447 |
| Youth Pain Interference Youth PTSD Symptoms | 0.101 0.029 | 0.521 0.860 | |
| Total Household Dysfunction | Parent PTSD Symptoms Parent Chronic Pain Status | 0.262 0.080 | 0.097 0.608 |
| Youth Pain Interference Youth PTSD Symptoms | 0.175 0.200 | 0.262 0.216 |
| Gene Symbol & ID | Gene Name | Primer Sequence | Tm (°C) | PCR Efficiency | Cycling Parameters |
|---|---|---|---|---|---|
| Comt (1312) | Catechol-O-Methyltransferase | (+)attcacacctttctgaccaagc (−)ggggacagctctaggtgtagg | 58.0 | 93.60 | 1 cycle 95 °C 3 min; 40 cycles 95 °C 15 s 40 cycles Tm 30 s +Melt Curve |
| Drd2 (1813) | Dopamine Receptor D2 | (+)gcaatgtatcccttctcacagc (−)aggccaggaatagaaaagg | 55.0 | 94.65 | |
| GR (2908) | Glucocorticoid Receptor | (+)tgtatgtgttatctggccatcc (−)tcccatagttttaggcatttgg | 54.0 | 102.63 | |
| Sert (6532) | Serotonin Transporter | (+)ttttcaaagggattggttatgc (−)ttgtcctcggagaagtaattgg | 52.0 | 109.48 | |
| CycA * (5478) | Cyclophilin A | (+)agcactggggagaaaggatt (−)agccactcagtcttggcagt | 58.0 | 102.20 | |
| Ywhaz * (7534) | Tyrosine 3-monooxygenase/tryptophan, 5-monooxygenase activation protein, zeta | (+)ttgagcagaagacggaaggt (−)gaagcattggggatcaagaa | 56.1 | 105.34 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Christensen, J.; Beveridge, J.K.; Wang, M.; Orr, S.L.; Noel, M.; Mychasiuk, R. A Pilot Study Investigating the Role of Gender in the Intergenerational Relationships between Gene Expression, Chronic Pain, and Adverse Childhood Experiences in a Clinical Sample of Youth with Chronic Pain. Epigenomes 2021, 5, 9. https://doi.org/10.3390/epigenomes5020009
Christensen J, Beveridge JK, Wang M, Orr SL, Noel M, Mychasiuk R. A Pilot Study Investigating the Role of Gender in the Intergenerational Relationships between Gene Expression, Chronic Pain, and Adverse Childhood Experiences in a Clinical Sample of Youth with Chronic Pain. Epigenomes. 2021; 5(2):9. https://doi.org/10.3390/epigenomes5020009
Chicago/Turabian StyleChristensen, Jennaya, Jaimie K. Beveridge, Melinda Wang, Serena L. Orr, Melanie Noel, and Richelle Mychasiuk. 2021. "A Pilot Study Investigating the Role of Gender in the Intergenerational Relationships between Gene Expression, Chronic Pain, and Adverse Childhood Experiences in a Clinical Sample of Youth with Chronic Pain" Epigenomes 5, no. 2: 9. https://doi.org/10.3390/epigenomes5020009
APA StyleChristensen, J., Beveridge, J. K., Wang, M., Orr, S. L., Noel, M., & Mychasiuk, R. (2021). A Pilot Study Investigating the Role of Gender in the Intergenerational Relationships between Gene Expression, Chronic Pain, and Adverse Childhood Experiences in a Clinical Sample of Youth with Chronic Pain. Epigenomes, 5(2), 9. https://doi.org/10.3390/epigenomes5020009

