Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania
by
,
Geanina Magdalena Iacob
1, 
Cristina Craioveanu
1,
Vladimír Hula
2,
Virgiliu Marius Aurelian
1,
Monica Beldean
1,3 and
Cristian Sitar
4,5,* 1
Sociobiology and Insect Ecology Lab, Department of Taxonomy and Ecology, Babes-Bolyai University, Clinicilor 5, 400006 Cluj-Napoca, Romania
2
Department of Forest Ecology, Faculty of Forestry and Wood Technology, Mendel University in Brno, 613 00 Brno, Czech Republic
3
Asociația Pentru Natura și Oameni, 407240 Cojocna, Romania
4
Zoological Museum, Babeș Bolyai University, Clinicilor 5, 400006 Cluj-Napoca, Romania
5
Romanian Institute of Science and Technology, Saturn 24-26, 400504 Cluj-Napoca, Romania
*
Author to whom correspondence should be addressed.
Insects 2021, 12(12), 1087; https://doi.org/10.3390/insects12121087
Submission received: 8 October 2021
/
Revised: 22 November 2021
/
Accepted: 30 November 2021
/
Published: 3 December 2021
(This article belongs to the Section Insect Ecology, Diversity and Conservation)
Abstract
:Simple Summary
NATURA 2000 species, Paracossulus thrips is one of the locally distributed, least studied moth species and is currently considered an endangered species in several European countries, even though the risk factors and its biology and ecology are not well known. In our study, conducted in Transylvania, Romania, we confirm the host plant as Phlomis tuberosa and describe the habitat type of P. thrips; we also present four new populations and the first DNA barcoding sequences for the species. Our study provides baseline knowledge on the biology and ecology of P.thrips, relevant for conservation, and for establishing management measures.
Abstract
Paracossulus thrips (Lepidoptera, Cossidae) is one of the locally distributed and endangered species. In Europe, it is also one of the few protected moth species, through Annexes II and IV of the Council Directive 92/43/EEC, Annex II of the Bern Convention. To date, little is known about the biology and ecology of this species. Our study was conducted in Transylvania, Romania. Romania hosts some of the strongest populations of the species in the European region. As part of the study, we conducted field observations, vegetation analyses, and genetic analyses. In our paper, we show the habitat types where we encounter P. thrips in Transylvania and confirm Phlomis tuberosa as a host plant. Furthermore, a piece of important information for habitat conservation is given. In this paper, we present the eggs and larvae of P. thrips, the first DNA barcoding sequences, and four new populations of P. thrips in Romania. Our study provides baseline knowledge about the biology and ecology of P. thrips, which is important for conservation and establishing management measures.
1. Introduction
Paracossulus thrips (Hübner, 1818) (Lepidoptera, Cossidae) is a locally distributed, poorly studied moth species. It is currently considered an endangered species in several European countries, although the risk factors are not well known. In Europe, it is also one of the few protected moth species, through Annexes II and IV of the Council Directive 92/43/EEC [1,2], Annex II of the Bern Convention and, not evaluated species in IUCN Red List. In the Romanian Red List of Lepidoptera, it is marked as vulnerable (VU) [3]. In the Bulgarian Red List it is critically endangered (CR) [2].
However, very little is known about the biology and ecology of P. thrips. Most studies are limited to reporting the presence of the species and providing a general description of the habitat.
P. thrips occurs in habitats with steppe-like xerophilous vegetation on loamy, loamy-sandy, or loess soils [3]. The species has been reported in natural habitats as well as in semi-natural and anthropogenic habitats such as meadows, pastures, and roadsides [4].
Regarding the food plant of the larvae, P. thrips is one of the few European Cossidae and Natura 2000 Lepidoptera species for which the host plant is not known with certainty. According to most studies [1,5,6,7,8,9,10], the larvae feed on Artemisia roots. From the observations of [4], it appears that P. thrips prefers Phlomis tuberosa.
Without knowing its host plant, it is not possible to determine the ecological preferences of the species and thus, determine adequate management. Therefore, knowledge of the host plant and the habitat of the species is critical to its conservation.
P. thrips is a western sub-boreal Palaearctic species distributed from eastern Europe to southwestern Siberia [6,11]. In the European part of its distributional range, it has been reported from southern Poland, Hungary [4,12,13,14], Serbia [10], Bulgaria [2,6,10,15,16], Romania [1,7], Ukraine [17] in the central and south of the European part of the Russian Federation [9,18,19,20,21,22,23], Caucasus [11,23,24,25,26,27,28] and from the south of Urals. In Asia it has been reported from Turkey, Iran [29], Transcaucasia in Armenia and Georgia [11,30,31,32,33], in Kazakhstan [34,35], Turkmenistan, in the south of Western Siberia [5,9,22,23,25,36,37,38,39,40,41] (locally in the Omsk Region, Altai Territory, and Khakas).
The species has been reported in southern Poland (near Przemysl) [42,43], but in the absence of recent reports, the presence of the species remains uncertain. In Hungary, populations are present in the NE (Tisza Valley) and the SE (Hortobágy area) parts of the country, although populations near Budapest are probably extinct [4]. In Serbia, it has been reported from Vidlič, Stara Planina, Suva Planina and Šljivovički Vis [10]. In Bulgaria, it has been reported from Silven, Plovdiv, Burgas, Resselets, Balchik-Topola [21,28,44,45,46,47]. In the Balchik region, it was collected in the early and mid-1990s [48]. It is now extinct in all known areas of Bulgaria, being rediscovered near Sofia in 2020 [10]. From Ukraine, there are reports from the Odesa and Crimea regions, as well as from the northern part of the country near Kyiv [49].
The first reports of the species on the present territory of Romania date from the beginning of the 20th century, from Transylvania, Szt Gothard [50,51]. More recent reports from Transylvania are from Jucu de Sus [7], Fanatele Clujului (La Copârșaie) [52], Viișoara (Coast of the Moon) [53], Suatu and Căian, Dumbrăveni, La săratura, Rșscruci, Roșia Montană, Sighișoara, Tarnava Mare [7]. From Moldova, it has been reported from Iași [54], Podu Iloaiei [55], Lețcani, Valea Lupului, Valea lui David [56], Valea Ilenei [57,58]. From Dobrogea it has been reported from Visterna [59], Izvoarele, Hagieni-Limanu, Dealurile Beștepe [8,60,61], Urluia, Vedereasa [7] (Figure 1). Nevertheless, its distribution in Romania remains poorly characterized.
In the European part of its range, most populations are found in Romania, followed by the populations in Ukraine [4]. Although P. thrips is widespread, the known populations are relatively isolated from one another and no other populational data is known.
The species of interest was described in 1818 by Hübner as Bombyces thrips, it is synonymous with Cossus fuchsianus Eversmann, 1831; Cossus kindermanni Freyer, 1836; Hypopta trips, Kjrby, 1892 [9], and was included in the genus Catopta Staudinger, 1899 [42,62].
The species thrips was attributed to the genus Paracossulus by [43], considering its placement in the genus Catopta to be incorrect. The arguments leading to the placement of thrips in the genus Paracossulus were morphological aspects such as the rami of the antenna and the structural features of the thorax sclerites [43]. Later, important details were shown in the structure of the male genital apparatus [41].
Morphologically, P. thrips is closer to the genera Parahypopta and Cossulus than Catopta [43]. However, a comprehensive phylogenetic study of the Cossidae family is needed for a better understanding of the taxonomic placement of the P. thrips. The European populations of the P. thrips were attributed to ssp. polonica [62] which was later synonymized with the nominotypical form [31].
In this article, we attempt to fill some of these informational gaps by reporting four new populations in Romania, confirming the host plant for the larvae in the investigated areas, and performing DNA barcoding analyses to establish the taxonomic position of the species from a molecular perspective for the first time.
2. Materials and Methods
2.1. Field Survey
For observations on the biology and ecology of the species, field studies were conducted, in 2021, in Jucu de Sus, in Natura 2000 ROSCI0295 Dealurile Clujului Est (Cluj County), 26 km from Cluj Napoca, where P. thrips has a stable and vigorous population. To identify new populations, we conducted observations in habitats with steppe vegetation in Natura 2000 Protected areas: ROSCI0238 Suatu–Cojocna–Crairât; ROSCI0210 Râpa Lechința and ROSCI0272 Vulcanii Noroioi of Pâclele Mari and Pâclele Mici.
2.2. The Identification of the Larval Host Plant
To establish the host plant species with certainty, we used larvae obtained from the eggs of a female captured in Jucu de Sus. We used a sample of 300 eggs/larvae. After hatching, the larvae received fresh roots of Artemisa absinthium, A. maritima, A. vulgaris (Asteraceae) and tubers and root of Phlomis tuberosa, Nepeta nuda, and Salvia verticillata (Lamiaceae). Plants were harvested from steppe habitats where the presence of P. thrips is certain. The rhizomes, tubers and roots were cut into slices and placed in the container with the newly emerged larvae so that the larvae could have access to each of the plant species mentioned above.
2.3. The Study of Adult Moths
For studying the adult moths, the specimens were lured using light traps. The light source was a fluorescent Hg vapor lamp of 2 × 160 W, a UV blacklight lamp of 2 × 18 W and 3 Led UV light traps 30 LEDs, 5W. The lured specimens were photographed and released. All light traps worked between 20:30 and 02:00. For each studied location, one to five individuals were collected and stored in the Zoological Museum of the Babes-Bolyai University, Cluj Napoca (Table 1 and Table 2). Freshly emerged specimens were collected from Jucu de Sus and kept alive to determine the lifespan and behavior of the adults and to obtain eggs.
2.4. Vegetation Analysis
The relevés were realized by using a stratified sampling procedure according to the Braun–Blanquet method. The abundance-dominance notes specific to the phytosociological relevé [63] were replaced by the percentage cover of species, estimated as the horizontal projection of each species on the soil surface. The sampling areas were 25 m2 (5 × 5 m). To complete the habitat-level plant species inventory, the relevé method was combined with the linear transect method [64]. The habitats were established according to the literature [65].
The analysis of ecological categories of the investigated phytocoenoses was carried out to indirectly highlight the stationary conditions of each site. Thus, the percentage of species belonging to each ecological category was calculated at the site level. The identified phytotaxa were ecologically characterized according to the literature [66].
2.5. Molecular Analysis
2.5.1. Sampling and Collection of Data
Four sequences of P. thrips were obtained for this study. The samples were collected from 2 localities (Table 2). Legs were stored in tubes with 96% ethanol. The moths are stored in the Zoological Museum of the Babeș-Bolyai University as vouchers. The sequences were obtained at the Biodiversity Institute of Ontario, Canada. DNA isolation, PCR amplification, and DNA sequencing followed standard protocols [67,68].
2.5.2. Sequence Analysis
For comparison with the cladogram of [43], we mined sequences of the Palearctic Cossidae from BOLD and NCBI. The full information regarding them is found in Appendix A, Table A1.
Sequence alignment and calculation of genetic distances were done in MEGA X software. Bootstrap analysis (1000 replicates) and the neighbor-joining tree of the COI sequences (the Kimura-two-parameter was used) were also built in MEGA X. We used as the out-group a sequence of Noctua fimbriata (Lepidoptera: Noctuidae).
3. Results
3.1. Biology
During the field observations conducted in the Natura 2000 Protected area ROSCI0295 Dealurile Clujului Est (Jucu de Sus), and laboratory survey, we obtained information on adults, eggs, larval behavior, and food plant preferences which represent baseline data on the biology and ecology of the species.
The adult flight period is about four weeks, depending on weather conditions. The flight period may begin from mid-July to mid-late-August. In warm years, the first adults appear as early as late June. Adults are on the wing between 9:30 and 11:30 pm.
According to our observations, adults have low dispersal ability due to heavy flight and short activity/night time. The lifespan of adults held in captivity was 4–5 days; they do not feed (Figure 2A–C). The female lays eggs using the 1.5–2 cm long ovipositor. The eggs are oval, with a larger circumference in the basal third, and are covered with a sticky layer that makes them adhere very well to the substrate (Figure 2D). The available female from Jucu de Sus laid 324 eggs; thereby we assume that a female lays more than 300 eggs.
The larvae fed exclusively on the tubers of Phlomis tuberosa (Figure 3A–E and Figure 4A–D), although fresh Artemisia, Nepeta nuda and Salvia verticillata roots were also available. On the field, we found that the newly hatched caterpillars entered the P. tuberosa stem in the crown area at the base of the leaves that forms the basal rosette of the plant (Figure 3E).
3.2. Vegetation Description
Natura 2000 protected area ROSCI0295 Dealurile Clujului Est (Jucu de Sus) exhibits a slightly rugged relief, churned up by landslides. The dominant vegetation consists of meadow species interspersed with strips of Eleagnus angustifolia planted to stabilize the soil, alongside shrubs of Prunus spinosa, Crataegus monogyna and Rosa canina. P. tuberosa grows in the immediate vicinity of shrubs and has a high density, over 1000 stems. The meadow is used as sheep pasture all year round [69] (Figure 5A,B).
Depending on the humidity preferences, dominant species are xero-mesophytes (58.53%), followed by mesophytes (19.51%) and xerophytes (17.07%) species. Regarding the temperature factor, most species are micro-mesotherms (65.85%), followed by moderate thermophilous (12.19%) and eurytherms (12.19%) species and according to the soil reaction, dominant species are weakly acidophiles-to-neutrophiles (46.34%), followed by amphytolerant (24.39%) species (Figure 6).
The Natura 2000 protected area ROSCI0238 Suatu–Cojocna–Crairât consists of a series of fragments of mesoxerophilous and xerophilous steppe meadows arranged on hills with steep slopes, southern aspect, and carbonate soils. Most of these meadows are used as pastures [70] (Figure 5C,D).
In the study area, a part of the meadow area is annually mown and the other part is set on fire. The vegetation structure includes steppe and forest-steppe species, with Stipa lessingiana, Stipa pulcherrima, Stipa tirsa and Stipa capillata dominating. The population of Phlomis tuberosa is located at the base of the slope in an area shaded by a Robinia pseudoacacia plantation and, the meadow is covered by ecotone species characteristic of the former xerothermic forests in the Transylvanian Basin. About 200 stems of P. tuberosa were observed in this area. Analyzing the vegetation, we assume that the surface occupied by P. tuberosa was much larger, but was restricted due to the invasion of Robinia pseudoacacia.
According to the humidity preferences, dominant species are xero-mesophytes (56.66%), followed by xerophytes (25%) and mesophytes (16.66%) species. Regarding the temperature factor, most species are micro-mesotherms (53.33%), followed by moderate thermophilous (40%) species and according to the soil reaction, dominant species are weakly acidophiles-to-neutrophiles (65%), followed by amphytolerant (26.66%) species (Figure 7).
The identified habitats in ROSCI0295 Dealurile Clujului Est (Jucu de Sus) are 6210 Semi-natural dry grasslands and 557 Scrubland facies on calcareous substrates (Festuco-Brometea). In ROSCI0238 Suatu–Cojocna–Crairat–Cojocna, the identified habitat is 6240 * Sub-558 pannonian steppe grasslands. The vegetation structure for both study areas is presented in Appendix A, Table A2.
For the next two sites, we had the existing information in the standard site forms or management plans:
The Natura 2000 protected site ROSCI0210 Râpa Lechința is located on the eastern bank of the river Mureș, near Lechința, and preserves a mosaic of steppe meadows formed on clay-rich and slightly saline soils. The site has an area of 283 hectares and is famous for some rare Lepidoptera species such as Cucullia mixta lorica, Hadula dianthi hungarica and Conisania poelli ostrogovichi. The habitat is 6240* Sub-pannonian steppe grasslands [71,72] (Figure 5E,F).
The Natura 2000 protected area ROSCI0272 Vulcanii Noroioși of Pâclele Mari and Pâclele Mici is located in SE Romania, in the outer part of the Eastern Carpathians [73]. The nature reserve covers an area of 4 ha and is an area of geological and floristic interest, where several protected plant species can be found: Crambe tataria, Iris aphylla ssp. hungarica, Artemisia santonicum, Atriplex tatarica, Ephedra distachya, etc. The habitat is 1530* Pannonic salt-steppes and salt-marshes [74,75] (Figure 5G,H).
3.3. New Populations Identified in Romania
Following the field survey, we discovered four new populations of P. thrips in Romania:
- Protected area ROSCI0238 Suatu–Cojocna–Crairât. Near Ploscoș (Valea Florilor) on Dealul Gorgan, four males of P. thrips were observed in 7 July 2015 by Sitar C. and Crișan A.
- Protected area ROSCI0238 Suatu–Cojocna–Crairât. In Cojocna, the larvae were present in the stems of P. tuberosa in the cemetery near the village on 18 September 2021. There is a high density of Phlomis plants at the edge of the cemetery. (Iacob G., Sitar C., Beldean M.) (Figure 5C,D).
- Protected area ROSCI0210 Râpa Lechința, near Lechința (Mureș County). On 14 August 2021, a light trap deployed by Iacob G. and Sitar C attracted a female P. thrips (Figure 5E,F).
- Protected area ROSCI0272 Vulcanii Noroioși of Pâclele Mari and Pâclele Mici. On 5 August 2015 a light trap deployed by Aurelian V.M. attracted a male P. thrips (Figure 5G,H).
3.4. Sequence Analysis
The four sequences of P. thrips were submitted to GenBank; they are the first published sequences of this species (accession numbers OK314991, OK314992, OK314993, OK314994). The sequences belong to individuals from two populations: three from Jucu de Sus (Cluj County) and one from Pădurea Babadag (Tulcea County) (Table 2). The two populations are 450 km apart and are geographically isolated by a natural barrier (Carpathian mountains) (Figure 1). The genetic distance between individuals is 0 and 0.002 (Table 3). The values of genetic distance between the sequences of P. thrips and the out-group are 0.6857 and 0.6846, respectively (Table 3). Full sequences of P. thrips are available in the Appendix A, Table A3.
In the molecular analysis, we examined 21 Palearctic species of Cossidae. Our dataset consisted of 191 sequences mined from BOLD and NCBI (see the electronic Supplementary Materials, Annex S1). The neighbor-joining (NJ) tree was made based on 113 of the sequences (Figure 8) for comparison with the cladogram of [43]. The lowest values of the recorded genetic distances are 0.0041 and 0.0166 between species Yakudza vicarius and Eogystia hippophaecolus, respectively, 0.0622 between Streltzoviella insularis and Kerzhnerocossus tannuolus (see the electronic Supplementary Materials, Annex S2). The nearest species to P. thrips is Eogystia sibirica (0.1036) (Figure 9). The matrix with the genetic distances between P. thrips and the species from the same clade is presented in Table 3. Catopta griseotincta is the most distant species from P. thrips (0.1862), after the out-group (Figure 9). All genetic distances between specimens of P. trips and specimens of the genus Catopta are presented in (Table 4). The average genetic distance of the entire analyzed group is 0.1231 (without out-group) and 0.1328 (with out-group). Genetic distances for all sequences are available in the electronic Supplementary Material, Annex S2.
Our results show that DNA barcoding worked well in discriminating P. thrips sequences. Our results also show that DNA barcoding worked well in discriminating the 21 species considered in the analysis.
4. Discussion
P. thrips is susceptible to extinction as a result of the geographical isolation of extant populations. There is also a lack of information on larval host plants, types of habitats, or population densities and dynamics. As such, this species is given protected status in Europe. In the first part of the study, we attempted to establish with certainty the larval host plant. To date, most authors consider Artemisia sp. to be the larval host plant [1,5,6,7,8,9,10]. Ref. [4] states that the host plant is P. tuberosa, but there are no published studies to confirm this so far. Our studies confirm that P. tuberosa is the larval host plant for P. thrips in Romania
The limited mobility and short flight time of adults also limit the colonization of new habitats. Thus, any pressure exerted on the remaining habitat by external factors will also affect the populations of P. thrips. For this reason, we consider the knowledge of the ecological preferences of P. tuberosa and population dynamics to be extremely important in order to better formulate any future management and protection implications.
Phlomis tuberosa is a continental Eurasian species. In Romania, it has been reported mainly in stands with woody vegetation, such as forests, bushes, vineyards, but also in hay meadows. It is often found in forest-steppe regions [76]. It occurs in stands with slight or no human impact, being considered oligohemerobic to mesohemerobic [77]. From an ecological point of view, the species is associated with xerothermic oak and deciduous forests, which are conditioned azonally by the orographic and edaphic particularities (Quercetalia pubescentis Br.–Bl 1931 em.), as well as with xeric grassland communities, established on cleared slopes in the oak area [66].
Thorough knowledge of habitat preferences can provide the data needed to identify potential habitats, including the identification of any new populations of P. thrips. Although most of the moth populations in the European part of the range are on the territory of Romania, the distribution of the species in this country is not yet fully characterized. For example, the presence of the nearby Hungarian populations from Hortobágy and Gyula [4] possibly indicates the existence of a population of P. thrips in the western part of Romania.
Although the light traps worked for almost 6 h, between 20:30 and 02:00, all individuals were observed between 09:30 and 10:30. The short flight interval, the isolated populations, and the direct observations made on the field indicate a low dispersal capacity of the individuals. Another limiting factor that contributes to the reduced dispersion is the short life span of adults. This aspect is also characteristic of other species of Cossidae [78] due to the atrophied buccal apparatus of adults that do not feed.
The second part of our study attempted to confirm the current taxonomic placement of P. thrips. Until recently, P. thrips was classified as Catopta [62], but in 1990 the species was included by [43] in the distinct genus Paracosulus. Ref. [43] presents a cladogram (based on the external morphology of the adults) that places the species P. thrips closer to the genera Dyspessacossus, Parahypopta, and Dyspessa. Furthermore, the genus Catopta is assigned to the subfamily Catoptinae [79] that was described based on the apomorphic features of the genitals of both sexes [79].
This framing is also supported by our DNA barcoding analysis. The sequences of P. thrips are grouped in the same cluster and form a clade with the species Eogystia sibirica, Parahypopta caestrum, Mormogystia proleuca, and Holcocerus gloriosus. All of them are grouped into a larger clade with the genus Dyspessa represented by three species: D. ulula, D. Psychidion, and D. salicicola. Thus our preliminary genetic data confirms the morphological studies of [43] and they argue the use of the genus Paracossulus instead of the genus Catopta. This is supported both by the position of the two genera in the phylogenetic tree and by the genetic distance between Paracossulus and Catopta which is on average 0.1832 (Table 4). A comparison of P. thrips with species of the genera Dyspesacossus and Cossulus was not possible due to the lack of available sequences.
Despite the geographical isolation, there are no significant differences between the sequences of P. thrips from the specimens from Jucu de Sus and the specimen from Babadag Forest (Figure 1) (Table 3). This lack of genetic diversity between the various isolated populations requires further studies with different methods.
P. thrips and its habitat are directly threatened by overgrazing (especially by sheep and/or goats) at most or all sites, by mowing of meadows or by other land mismanagement practices which lead to rapid habitat degradation. As such, conservation measures for P. thrips are acutely needed to prevent these threats and management practices must be substantiated based on available data. There was a fine mosaic of over-exploited to abandoned places. All meadows as habitat were grazed and mown for hay and part of the steppe-like meadows were commonly burned. Habitat changes similar to those happening in the rest of Europe are present here too. Namely, meadows are changing to more homogenous ones, without the fine mosaic of micro-habitats. It seems that for a species such as P. thrips traditional burning (in spring, with cold nights) is not problematic. Food plants are robust enough to protect larvae inside of the roots and burning provides free space for new seedlings of P. tuberosa. Otherwise without burning the populations survive only on old plants of P. tuberosa and it should be very problematic in the future.
Studies on the dispersal capacity of the species and estimates of populations are needed in the nearest future.
Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/insects12121087/s1, Annex S1: All sequences mined from BOLD & NCBI; Annex S2: MEGA- Genetic distances.
Author Contributions
Conceptualization C.S. and C.C.; methodology, C.S., V.H., M.B. and G.M.I.; software, G.M.I.; writing—original draft preparation, G.M.I.; writing—review and editing, C.S., V.H., V.M.A. and C.C.; field work, C.S., G.M.I., V.M.A. and M.B. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by a grant of the Ministry of Research and Innovation, CNCS—UEFISCDI, project number PN-III-P4-ID-PCCF-2016-0016 (DARKFOOD), within PNCDI III, Babeș-Bolyai University through the Special research scholarship, contract number 35726/09.12.2020 and Milvus Group Association’s Scholarship Grant, contract number 8/12.04.2021. The both scholarships awarded to Geanina Magdalena Iacob.
Institutional Review Board Statement
The study was conducted with the approval of ANANP (National Agency for Protected Areas—Romania), registration number 357/STCJ/13.08.2021.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Acknowledgments
The authors are grateful to Sanda Roșca for the help with Figure 1 and Adriana Radulovici for performing the sequencing of samples.
Conflicts of Interest
The authors declare no conflict of interest.
Appendix A
Table A1.
The full information for the sequences mined from GenBank.
| BOLD_ID | NCBI_ID | Species | Country | Reference Title | Authors | Collection Date |
|---|---|---|---|---|---|---|
| LON5690-17 | \ | Acossus terebra | Norway | iBOL Data Release | iBOL | 20 July 2010 |
| LEFIF227-10 | HM874920 | Acossus terebra | Finland | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | \ |
| GBMNC49256-20 | MF052579 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
| GBMNC49263-20 | MF051783 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
| GBMNC49258-20 | MF051921 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
| GBMNC49259-20 | MF051897 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
| GBMNC49260-20 | MF051847 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
| GBMNC49261-20 | MF051833 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
| GBMNC49262-20 | MF051788 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
| QUNOE344-12 | KC860946 | Catopta griseotincta | China | A brief review of genus Catopta Staudinger, 1899 (Lepidoptera: Cossidae) with description of a new species from China | Yakovlev, R.V. et al., 2013 | 30 July 2011 |
| QUNOE345-12 | KC860945 | Catopta griseotincta | China | A brief review of genus Catopta Staudinger, 1899 (Lepidoptera: Cossidae) with description of a new species from China | Yakovlev, R.V. et al., 2013 | 30 July 2011 |
| KC860946 | QUNOE344 | Catopta griseotincta | China | A brief review of genus Catopta Staudinger, 1899 (Lepidoptera: Cossidae) with description of a new species from China | Yakovlev, R.V. et al., 2013 | 30 July 2011 |
| FBLMX240-11 | KX040722 | Cossus cossus | Germany | iBOL Data Release | iBOL | 14 July 2010 |
| GWORZ171-10 | HM914074 | Cossus cossus | Italy | iBOL Data Release | iBOL | 20 July 1996 |
| LON5692-17 | \ | Cossus cossus | Norway | iBOL Data Release | iBOL | 15 June 2013 |
| PHLAH054-12 | KX045460 | Cossus cossus | Romania | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 26 July 1999 |
| PHLAH357-12 | \ | Cossus cossus | Spain | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 1 September 2005 |
| GBMNA30579-19 | MK440671 | Cossus cossus | Azerbaijan | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 July 2008 |
| GBMNA30580-19 | MK440678 | Cossus cossus | Azerbaijan | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 July 2008 |
| GBMNA30582-19 | MK440673 | Cossus cossus | Russia | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 3 June 2006 |
| GBMNA30583-19 | MK440674 | Cossus cossus | Russia | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 3 June 2006 |
| GBMNA30587-19 | MK440667 | Cossus cossus | Lebanon | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 May 2006 |
| GBMNA30588-19 | MK440668 | Cossus cossus | Turkey | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 June 2002 |
| GBMNA30589-19 | MK440669 | Cossus cossus | Turkey | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 June 2002 |
| GBMNA30595-19 | MK440679 | Cossus cossus | Turkey | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 3 August 2005 |
| LEATD168-13 | \ | Cossus cossus | Austria | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)—Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 7 June 2013 |
| PHLAI332-13 | \ | Cossus cossus | Austria | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)—Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 2 June 2012 |
| PHLAI333-13 | \ | Cossus cossus | Austria | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)—Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 19 June 2012 |
| PHLAC470-10 | JF860045 | Cossus cossus | Italy | DNA-barcoding von schmetterlingen (Lepidoptera) in Waldstandorten Südtirols (IT01 ritten und IT02 montiggl) | Huemer, P. & Hebert, P.D.N., 2012 | 4 June 2010 |
| GBGL13644-14 | KC791441 | Cossus cossus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
| GBGL13645-14 | KC791442 | Cossus cossus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
| GWOR4165-09 | KX070766 | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 23 June 2008 |
| ODOPE724-11 | KX040920 | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 June 2005 |
| ODOPE725-11 | KX040085 | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 28 June 2008 |
| PHLAG857-12 | \ | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 7 June 1991 |
| PHLAG861-12 | \ | Cossus cossus | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 22 August 1993 |
| PHLAG862-12 | \ | Cossus cossus | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 10 July 1994 |
| PHLAG864-12 | \ | Cossus cossus | Austria | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 24 June 1994 |
| PHLAG865-12 | \ | Cossus cossus | Austria | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 14 March 2002 |
| PHLAG866-12 | \ | Cossus cossus | Austria | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 5 July 1989 |
| LEFIB066-10 | HM870975 | Cossus cossus | Finlad | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | / |
| PHLAG872-12 | KM572562 | Cossus cossus | Austria | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | 28 June 2011 |
| LEFID742-10 | HM873499 | Cossus cossus | Finland | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | 14 July 2007 |
| GBMNA30593-19 | MK440665 | Cossus cossus albescens | Spain | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 29 June 1990 |
| GBMNA30594-19 | MK440666 | Cossus cossus albescens | Spain | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 16 June 2007 |
| GBGL26652-19 | MG279391 | Dervishiya cadambae | India | First report of occurrence of Dervishiya cadambae (Moore, 1865) on grapes, Vitis vinifera L. in India Unpublished | Yadav, D.S. et al. | \ |
| PHLAE163-11 | JN307399 | Dyspessa psychidion | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 19 May 2009 |
| PHLAE164-11 | JN307400 | Dyspessa psychidion | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 19 May 2009 |
| PHLAG166-12 | \ | Dyspessa psychidion | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 May 2009 |
| GBMND20662-21 | MW170375 | Dyspessa salicicola | Armenia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
| GBMND20663-21 | MW170376 | Dyspessa salicicola | Armenia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
| GBMND20665-21 | MW170379 | Dyspessa salicicola | Kazakhstan | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
| GBMND20666-21 | MW170380 | Dyspessa salicicola | Russia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
| GBMND20667-21 | MW170381 | Dyspessa salicicola | Russia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
| GBMND20668-21 | MW170377 | Dyspessa salicicola | Azerbaijan | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
| GBGL26653-19 | MF596152 | Dyspessa salicicola | Azerbaijan | The taxonomic status of Cossus cossus afghanistanus (Lepidoptera, Cossidae) from Afghanistan: insights from molecular and morphological data. | Shapoval, N.A. et al., 2017 | 1 July 2008 |
| LON7224-18 | \ | Dyspessa ulula | Croatia | \ | \ | 1 June 2018 |
| GBMND20671-21 | MW170384 | Dyspessa ulula | Croatia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
| LEATH739-14 | \ | Dyspessa ulula | Italy | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)–Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 6 June 2014 |
| LEATJ785-15 | \ | Dyspessa ulula | Italy | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)–Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 18 June 2015 |
| PHLAA450-09 | HM425963 | Dyspessa ulula | France | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 6 June 2009 |
| PHLAE165-11 | JN307401 | Dyspessa ulula | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 May 2009 |
| PHLAF586-11 | \ | Dyspessa ulula | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 11 June 2009 |
| PHLAG165-12 | \ | Dyspessa ulula | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 15 July 2009 |
| PHLAG174-12 | \ | Dyspessa ulula | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 July 2010 |
| PHLAG175-12 | \ | Dyspessa ulula | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 July 2010 |
| PHLSA419-11 | \ | Dyspessa ulula | Croatia | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 25 May 1995 |
| PHLSA420-11 | \ | Dyspessa ulula | Croatia | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 25 May 1995 |
| PHLSA755-11 | \ | Dyspessa ulula | France | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 20 May 2010 |
| PHLSA756-11 | \ | Dyspessa ulula | France | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 20 May 2010 |
| GBGL13650-14 | KC791450 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
| GBGL13651-14 | KC791451 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
| GBGL13658-14 | KC791458 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL13659-14 | KC791459 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL13661-14 | KC791482 | Eogystia sibirica | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL13662-14 | KC791483 | Eogystia sibirica | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL13663-14 | KC791484 | Eogystia sibirica | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL13664-14 | KC791443 | Holcocerus artemisiae | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 8 August 2012 |
| GBGL13665-14 | KC791444 | Holcocerus artemisiae | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 8 August 2012 |
| GBGL13666-14 | KC791445 | Holcocerus artemisiae | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 8 August 2012 |
| MAMOT1708-12 | KX860954 | Holcocerus gloriosus | Pakistan | Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan | Muhammad A. et al., 2017 | 9 May 2012 |
| MAMOT1709-12 | KX863339 | Holcocerus gloriosus | Pakistan | Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan | Muhammad A. et al., 2017 | 10 May 2012 |
| MAMOT1710-12 | KX862572 | Holcocerus gloriosus | Pakistan | Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan | Muhammad A. et al., 2017 | 8 May 2012 |
| GBGL26655-19 | MF071456 | Kerzhnerocossus tannuolus | Russia | Review of the genus Kerzhnerocossus Yakovlev, 2011 (Lepidoptera: Cossidae) with descriptions of two new species from Russia and Mongolia | Saldaitis, A., 2011 | \ |
| GBGL26656-19 | MF071457 | Kerzhnerocossus tannuolus | Russia | Review of the genus Kerzhnerocossus Yakovlev, 2011 (Lepidoptera: Cossidae) with descriptions of two new species from Russia and Mongolia | Saldaitis, A., 2011 | \ |
| GBGL31256-19 | KT713822 | Meharia semilactea | \ | Elusive ditrysian phylogeny: an account of combining systematized morphology with molecular data (Lepidoptera) | Heikkilae, M. et al., 2015 | \ |
| LEFIJ14982-20 | \ | Meharia sp. | Morocco | \ | \ | 13 May 2010 |
| GBGL31258-19 | KT713823 | Meharia sp. | \ | Elusive ditrysian phylogeny: an account of combining systematized morphology with molecular data (Lepidoptera) | Heikkilae, M. et al., 2015 | \ |
| BCMI261-11 | Mormogystia proleuca | Israel | iBOL Data Release | iBOL | 27 May 2009 | |
| BCMI266-11 | Mormogystia proleuca | Israel | iBOL Data Release | iBOL | 31 May 2009 | |
| GWORZ172-10 | Parahypopta caestrum | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 23 June 1998 | |
| PHLAB331-10 | HQ968493 | Phragmataecia castaneae | Leichtenstein | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 June 2009 |
| CGUKA294-09 | KX043172 | Phragmataecia castaneae | UnitedKingdom | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 July 2007 |
| GWOR4145-09 | KX071724 | Phragmataecia castaneae | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 8 June 2008 |
| LEFIF226-10 | HM874919 | Phragmataecia castaneae | Finland | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | 10 June 2002 |
| GBGL13668-14 | KC791461 | Streltzoviella insularis | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2011 |
| GBGL13669-14 | KC791462 | Streltzoviella insularis | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL13670-14 | KC791463 | Streltzoviella insularis | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL10959-12 | JN673375 | Streltzoviella insularis | Japan | RIKEN Plant Science Center, Advance NMR Metabomics Research Team | Vergara, F. et al. | \ |
| GBMNC49243-20 | MT785457 | Yakudza vicarius | China | \ | \ | \ |
| GBGL13671-14 | KC791464 | Yakudza vicarius | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBGL13676-14 | KC791469 | Yakudza vicarius | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
| GBMNC49252-20 | MF052057 | Yakudza vicarius | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study | Hao, M.D. et al., 2020 | \ |
| FBLMT329-09 | HQ955163 | Zeuzera pyrina | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 24 July 1993 |
| LEFIL178-10 | JF854515.1 | Zeuzera pyrina | Hungary | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 June 2007 |
| CGUKD508-09 | KX043062.1 | Zeuzera pyrina | United Kingdom | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 18 July 2008 |
| LON266-08 | KX047718.1 | Zeuzera pyrina | Norway | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 26 July 2007 |
| GU663065.1 | Noctua fimbriata | France | iBOL Data Release | iBOL | 13 July 1993 |
Table A2.
Vegetation structure in ROSCI0295 Dealurile Clujului Est—Jucu de Sus (releves 1–4) and ROSCI0238 Suatu–Cojocna–Crairat–Cojocna (releve 5–6). Natura 2000 habitat: releve 1–4—6210 Semi-natural dry grasslands and scrubland facies on calcareous substrates (Festuco-Brometea); releves 5–6—6240* Sub-pannonan steppe grasslands.
Table A2.
Vegetation structure in ROSCI0295 Dealurile Clujului Est—Jucu de Sus (releves 1–4) and ROSCI0238 Suatu–Cojocna–Crairat–Cojocna (releve 5–6). Natura 2000 habitat: releve 1–4—6210 Semi-natural dry grasslands and scrubland facies on calcareous substrates (Festuco-Brometea); releves 5–6—6240* Sub-pannonan steppe grasslands.
| No. of Releve | 1 | 2 | 3 | 4 | 5 | 6 | |||
| Exposition | W | W | W | W | S | S | |||
| Total Area (sq. m.) | 25 | 25 | 25 | 25 | 25 | 25 | |||
| Total Cover (%) | 99 | 98 | 99 | 99 | 98 | 80 | |||
| U | T | R | Species | ||||||
| 1.5 | 4 | 4 | Festuca rupicola Heuffel | 20 | 35 | 20 | 10 | 10 | 5 |
| 1.5 | 3.5 | 4 | Bromus japonicus Thunb. | 15 | 0.5 | 25 | 0.5 | ||
| 15 | 10 | ||||||||
| 3 | 0 | 0 | Achillea milleifolium L. | 10 | 2 | 10 | 2 | 2 | |
| 1.5 | 3 | 3 | Xeranthemum cylindraceum Sibth. et Sm. | 10 | 0.5 | 15 | |||
| 2 | 4.5 | 4 | Elymus hispidus (Opiz) Melderis ssp. hispidus | 5 | 20 | 15 | |||
| 2 | 4 | 3 | Fragaria viridis Weston | 5 | 2 | 2 | 1 | ||
| 3 | 2 | 2 | Cruciata glabra (L.) Ehrend. | 5 | 0.5 | 0.5 | |||
| 2.5 | 2.5 | 0 | Galium verum L. | 3 | 3 | 3 | 0.5 | 2 | 2 |
| 3 | 3 | 0 | Glechoma hederacea L. | 3 | |||||
| 1.5 | 3.5 | 4 | Thymus pannonicus All. | 2 | 0.5 | 0.5 | 2 | ||
| 2.5 | 3 | 4 | Agrimonia eupatoria L. | 2 | 0.5 | 3 | 2 | 0.5 | |
| 3 | 3 | 0 | Inula britanica L. | 2 | 0.5 | 0.5 | |||
| 2 | 3 | 5 | Medicago falcata L. | 1 | 0.5 | 0.5 | 0.5 | 1 | |
| 1 | 0.5 | 0.5 | 0.5 | ||||||
| 2.5 | 3 | 3 | Clinopodium vulgare L. | 1 | 0.5 | 0.5 | 0.5 | 1 | |
| Torilis japonica (Hoott.) DC. | 1 | 0.5 | 0.5 | ||||||
| 2.5 | 4 | 4 | Brachypodium pinnatum (L.) Beauv. | 0.5 | 5 | 15 | 0.5 | 2 | 2 |
| 2 | 3 | 4 | Euphorbia cyparissias L. | 0.5 | 5 | 5 | 0.5 | 0.5 | 3 |
| 2.5 | 3.5 | 3 | Crataegus monogyna Jacq. | 0.5 | 0.5 | 0.5 | 0.5 | ||
| 3 | 3 | 0 | Odontites vernus (Bellardi) Dumort. | 0.5 | 0.5 | 0.5 | 0.5 | ||
| 3 | 3 | 0 | Hypericum perforatum L. | 0.5 | 0.5 | 0.5 | 0.1 | ||
| 2 | 3 | 4 | Artemisia absinthium L. | 0.5 | 2 | 0.5 | |||
| 1 | 5 | 4 | Eryngium campestre L. | 0.5 | 0.5 | 1 | |||
| Daucus carota L. ssp. carota | 0.5 | 0.5 | 1 | 1 | |||||
| 1.5 | 3 | 4 | Picris hieracioides L. | 0.5 | 0.5 | ||||
| 2.5 | 2.5 | 0 | Pimpinella saxifraga L. | 0.5 | 0.5 | 0.5 | 0.5 | ||
| 1.5 | 3.5 | 4 | Potentilla recta L. | 0.5 | 0.5 | ||||
| 4.5 | 3 | 4 | Mentha longifolia (L.) Hudson | 0.5 | |||||
| 2 | 4 | 3.5 | Stipa tirsa Steven | 5 | 10 | 3 | |||
| 1 | 5 | 4 | Stipa capillata L. | 15 | 5 | ||||
| 1 | 4.5 | 4.5 | Stipa lessingiana Trin. et Rupr. | 15 | 5 | ||||
| 1 | 5 | 5 | Salvia nutans L. | 10 | 1 | ||||
| 0 | 0 | 0 | Elymus repens (L.) Gould. | 5 | 2 | ||||
| 2 | 4 | 4 | Teucrium chamaedrys L. | 0.5 | 5 | 1 | |||
| 2.5 | 3 | 4.5 | Filipendula vulgaris Moench | 5 | 5 | 3 | 1 | ||
| 2 | 5 | 4 | Dorycnium pentaphyllum Scop. ssp. herbaceum (Vill.) Bonnier et Layens | 15 | 3 | ||||
| 3 | 3 | 0 | Carex tomentosa L. | 3 | 3 | ||||
| 2 | 3 | 4 | Phleum phleoides (L.) Karsten | 3 | |||||
| 1.5 | 3.5 | 4 | Inula ensifolia L. | 2 | |||||
| 2 | 4 | 4 | Thesium linophyllon L. | 0.5 | 2 | ||||
| 2 | 3.5 | 4 | Adonis vernalis L. | 3 | 0.5 | 0.5 | 1 | 1 | |
| 1.5 | 4 | 4.5 | Cephalaria uralensis (Murray) Roemer et Schultes | 1 | |||||
| 1 | 4 | 5 | Teucrium montanum L. | 1 | |||||
| 3 | 0 | 4 | Dactylis glomerata L. | 7 | 0.5 | 0.5 | 5 | ||
| 2 | 3.5 | 4 | Bupleurum falcatum L. | 0.5 | 0.5 | 0.5 | 1 | ||
| 2 | 3 | 4 | Coronilla varia L. | 0.5 | 0.5 | 0.5 | 1 | ||
| 0.5 | 0.5 | 0.5 | |||||||
| 2 | 3 | 3 | Prunus spinosa L. | 0.5 | 0.5 | 0.5 | 0.5 | ||
| 1.5 | 3.5 | 4 | Linum hirsutum L. | 0.5 | |||||
| 2 | 3.5 | 4.5 | Centaurea stoebe L. | 0.5 | |||||
| 0.5 | |||||||||
| 1 | 5 | 4 | Ajuga laxmannii (L.) Bentham | 0.5 | 0.5 | ||||
| 2 | 4 | 4 | Odontites luteus (L.) Clairv. | 0.5 | |||||
| 2 | 4 | 4.5 | Onobrychis viciifolia Scop. | 0.5 | 1 | ||||
| 2 | 4 | 4 | Echium maculatum L. | 0.5 | 1 | ||||
| 1.5 | 5 | 3 | Dichanthium ischaemum (L.) Roberty | 5 | 0.5 | 1 | |||
| 2 | 4 | 4 | Thalictrum minus L. | 1 | 0.5 | ||||
| 2.5 | 0 | 4.5 | Plantago media L. | 0.5 | 1 | ||||
| 2 | 4 | 4 | Galium glaucum L. | 0.5 | 1 | ||||
| 1.5 | 4 | 4 | Astragalus monspessulanus L. | 0.5 | |||||
| 2 | 4 | 5 | Koeleria macrantha (Ledeb.) Schultes ssp. macrantha | 0.5 | |||||
| 2 | 3.5 | 4.5 | Potentilla arenaria Borkh. | 0.5 | |||||
| 2.5 | 3 | 5 | Salvia pratensis L. | 0.5 | |||||
| 2 | 4 | 4.5 | Crambe tatarica Sebeok | 0.5 | 1 | ||||
| 2 | 3 | 5 | Asperula cynanchica L. | 0.5 | 0.5 | 0.5 | 0.1 | 1 | |
| 3 | 4 | 4 | Juglans regia L. | 0.1 | |||||
| 1.5 | 4.5 | 4 | Plantago argentea Chaix | 0.1 | |||||
| 2.5 | 3.5 | 0 | Tragopogon dubius Scop. | 0.1 | |||||
| 1 | 4 | 4 | Veronica spicata L. ssp. spicata | 0.5 | 0.1 | 1 | |||
| 3.5 | 0 | 0 | Trifolium repens L. | - | 2 | ||||
| 2 | 3 | 0 | Poa angustifolia L. | 3 | 2 | 1 | |||
| 2.5 | 3.5 | 4 | Phlomis tuberosa L. | 2 | 0.5 | 15 | |||
| 2 | 3 | 3 | Origanum vulgare L. | 2 | |||||
| 2.5 | 4 | 3 | Salvia nemorosa L. | 2 | 0.5 | 10 | |||
| 4.5 | 3.5 | 4.5 | Iris sibirica L. | 0.5 | |||||
| 2 | 5 | 5 | Stachys recta L. | 0.5 | 0.5 | 0.1 | 3 | ||
| 2.5 | 3 | 3 | Inula salicina L. | 0.5 | 0.5 | ||||
| 1.5 | 4 | 4 | Stipa pennata L. | 10 | |||||
| 2 | 4 | 4 | Rosa gallica L. | 3 | |||||
| 3 | 3 | 4.5 | Prunella grandiflora (L.) Scholler | 0.5 | |||||
| 2 | 3.5 | 4 | Jurinea mollis (L.) Reichenb. ssp. transsylvanica (Sprengel) Hayek | 1 | |||||
| 3 | 3 | 0 | Lolium perenne L. | 1 | |||||
| 3 | 0 | 0 | Sonchus oleraceus L. | 1 | |||||
| 1 | |||||||||
| 2 | 3 | 4.5 | Polygala major Jacq. | 0.5 | |||||
| 2 | 3.5 | 4 | Bromus pannonicus Kummer et Sendtner | 1 | |||||
| 2 | 3 | 4 | Carex michelii Host | 2 | |||||
| 3 | 3 | 0 | Cerinthe minor L. | 1 | |||||
| 2.5 | 3.5 | 3.5 | Convolvulus arvensis L. | 2 | |||||
| 2.5 | 0 | 0 | Lotus corniculatus L. | 0.5 | 1 | ||||
| 3 | 0 | 0 | Plantago lanceolata L. | 0.5 | |||||
| 2.5 | 4 | 0 | Robinia pseudoacacia L. | 1 | |||||
| 2 | 3.5 | 4 | Salvia austriaca Jacq. | 0.5 | 1 | ||||
| 2 | 4 | 0 | Salvia verticillata L. | 5 | |||||
| 2 | 3 | 3 | Seseli annuum L. | 0.5 | |||||
| 2.5 | 4 | 0 | Setaria pumila (Poiret) Schultes | 1 | |||||
| 3 | 0 | 0 | Taraxacum officinale Weber | 1 | |||||
| 3 | 2 | 3 | Tragopogon pratensis L. ssp. pratensis | 2 | |||||
Table A3.
The four CO1 sequences of Paracossulus thrips.
| >RONOC164-18 Paracossulus thrips AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTGGGTACTTCATTAAGTCTTTTAATCCGAGCTGAATTAGGAAACCCCGGATCATTAATTGGAAATGATCAAATCTATAACACTATCGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCCATTATAATTGGGGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCCCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTCCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCTGGCACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCATACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT |
| >RONOC165-18 Paracossulus thrips AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTGGGTACTTCATTAAGTCTTTTAATCCGAGCTGAATTAGGAAACCCCGGATCATTAATTGGAAATGATCAAATCTATAACACTATCGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCCCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTCCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCTGGCACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCATACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT |
| >RONOC166-18 Paracossulus thrips AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTGGGTACTTCATTAAGTCTTTTAATCCGAGCTGAATTAGGAAACCCCGGATCATTAATTGGAAATGATCAAATCTATAACACTATCGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCCCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTCCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCTGGCACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCATACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT |
| >RONOC167-18 Paracossulus thrips AGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCNATTATAATTGGAGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCNCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTNCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCNGGCACAGGATGAACAGTTTATCCCCCATTATCNTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTNGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCNTACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATANCAACATTTATTT |
References
- Iorgu, I.Ș.; Surugiu, V.; Gheoca, V.; Popa, O.P. Ghid Sintetic Pentru Monitorizarea Speciilor de Nevertebrate de Interes Comunitar din România; Asocierea SC Compania de Consultanță și Asistență Tehnică SRL și SC Integra Trading SRL: Bucuresti, Romania, 2015; p. 63. ISSN 9786069246238. [Google Scholar]
- Hristova, H.; Beshkov, S. Checklist of the Superfamilies Cossoidea, Thyridoidea, Drepanoidea, Lasiocampoidea, Bombycoidea and Noctuoidea: Notodontidae (Insecta: Lepidoptera) of Bulgaria, with Application of the IUCN Red List Criteria at the National Level. Acta Zool. Bulg. 2016, 68, 569–576. [Google Scholar]
- Rákosy, L.; Corduneanu, C.; Crișan, A.; Dincă, V.; Kovács, S.; Stănescu, M.; Székely, L. Lista Roșie a Fluturilor din România/Romanian Red List of Lepidoptera; Presa Universitară Clujeană: Cluj-Napoca, Romania, 2021. [Google Scholar]
- Sum, S. Gerinctelenek. In Natura 2000 Fajok és ÉLŐHELYEK Magyarországon; Haraszthy, L., Ed.; Pro Vértes Közalapítvány: Csákvár, Hungary, 2014; p. 145. [Google Scholar]
- Polumordvinov, O.A.; Monakhov, E.M. Rare and demanding of protection Lepidoptera (Insecta) of Penzenskaya Oblast’. Part 1 (Macrolepidoptera). Fauna Ecol. Anim. 2002, 3, 29–48. [Google Scholar]
- Leraut, P. Papillons de Nuit d’Europe: Bombyx, Sphinx, Ecailles; NAP EDITIONS: Paris, France, 2006; Volume 1, ISBN 9782913688063. [Google Scholar]
- Székely, L. Moths of Romania 1. Fluturi de Noapte din Romania. 1. Hepialidae, Limacodidae, Cossidae, Thyrididae, Lasiocampidae, Endromidae, Saturniidae, Lemoniidae, Sphingidae, Drepanidae, Thaumetopoeidae, Notodontidae, Pantheidae, Lymantriidae, Arctiidae; Disz Tipo: Sacele-Brasov, Romania, 2010; Volume 1, pp. 66–67. [Google Scholar]
- Székely, L. The Macrolepidoptera (Insecta) of The Razelm-Sinoe Lagoon Complex (Dobrogea, Romania). J. Wetl. Biodivers. 2018, 8, 113–148. [Google Scholar]
- Yakovlev, R.V. Catalogue of the family Cossidae of the Old World (Lepidoptera). Neue Entomol. Nachr. 2011, 66, 1–130. [Google Scholar]
- Beshkov, S.; Nahirnić-Beshkova, A. Paracossulus thrips (Hübner, 1818) (Lep. Cossidae) Re-discovered in Bulgaria with notes of some other surprising findings in the Dragoman Natura 2000 Protected Area. Entomol. Rec. J. Var. 2021, 133, 22–30. [Google Scholar]
- Didmanidze, E.A.; Yakovlev, R.V. Cossidae (Lepidoptera) of Georgia. Entomofauna 2007, 28, 1–16. [Google Scholar]
- Fazekas, I. Somogy megye molylepke faunája (Lepidoptera, Microlepidoptera). Nat. Som. 2001, 1, 303–327. [Google Scholar] [CrossRef]
- Fazekas, I. Systematisches und synonymisches Verzeichnis der Microlepidopteren Ungarns (Lepidoptera, Microlepidoptera). Folia Hist. Nat. Mus. Matra. 2002, 26, 289–327. [Google Scholar]
- Fazekas, I. Microlepidoptera Pannoniae meridionalis, IV. Baranya megye Microlepidoptera faunájának katalógusa (Lepidoptera). Folia Comloensis 2002, 11, 5–76. [Google Scholar]
- Buresch, I.; Tuleschkow, K. Schmetterlingsfauna Bulgariens. Die horizontale Verbreitung der Schmetterlinge (Lepidoptera) in Bulgarien; Macrolepidoptera: Sofia, Bulgaria, 1932; Volume 1–4, pp. 152–157. [Google Scholar]
- Ganev, J. Catalogue of the Bulgarian Bombyces and Sphinges (Lepidoptera: Notodontidae, Dilobidae, Thaumetopoeidae, Ctenuchidae, Saturniidae, Endromidae, Lasiocampidae, Sphingidae, Hepialidae, Cossidae, Thyrididae, Limacodidae, Drepa- nidae, Thyatiridae, Lymantriidae, Arctiidae, Nolidae). Entomofauna 1984, 5, 391–419. [Google Scholar]
- Bidzilya, A.V.; Budashkin, J.L.; Zhakov, A.V. New records of Lepidoptera (Insecta) in Ukraine. Kharkov Entomol. Soc. Gaz. 2003, 10, 59–73. (In Russian) [Google Scholar]
- Staudinger, O. Catalog der Lepidopteren des Europaeischen Faunengebiets. I. Lepidoptera; Staudinger, O., Ed.; Dresden University Press: Dresden, Germany, 1871; pp. 61–63. [Google Scholar]
- Uvarov, B.P. To the Fauna of Lepidoptera of Transural kirgiz steppe. Rus. Ent. Obozr. 1910, 10, 161–169. [Google Scholar]
- De Freina, J.J.; Witt, T.J. Die Bombyces und Sphinges der Westpalaearktis; Edition Forschung & Wissenschaft: München, Germany, 1990; ISBN 13-978-3926285027. [Google Scholar]
- Anikin, V.V.; Sachkov, S.A.; Zolotuhin, V.V. “Fauna lepidopterologica Volgo-Uralensis” 150 years later: Changes and additions. Part 2. Bombyces and Sphinges (Insecta, Lepidoptera). Atalanta 2000, 31, 265–292. [Google Scholar]
- Knyazev, S.A. Catalogue of Lepidoptera of Omsk Oblast (Russia). Macrolepidoptera. Families: Hepialidae, Brachodidae, Cossidae, Sesiidae, Limacodidae, Zygaenidae, Thyrididae, Drepanidae, Uraniidae, Geometridae, Lasiocampidae, Lemoniidae, Endromididae, Saturniidae, Sphingidae, Notodontidae, Lymantriidae, Arctiidae, Syntomidae, Erebidae, Nolidae, Noctuidae, Hesperiidae, Papilionidae, Pieridae, Lycaenidae, Nymphalidae, Satyridae. Acta Biol. Sib. 2020, 6, 139–226. [Google Scholar] [CrossRef]
- Anikin, V.V.; Baryshnikova, S.V.; Belyaev, E.A.; Budashkin, Y.I.; Nieukerken, E.J.V.; Gorbunov, O.G.; Dubatolov, V.V.; Efetov, K.A.; Zolotuhin, V.V.; Knyazev, S.A.; et al. Catalogue of the Lepidoptera of Russia, 2nd ed.; Sinev, S.Y., Ed.; Zoological Institute RAS: St. Petersburg, Russia, 2019; 448p, ISBN 978-5-98092-068-5. [Google Scholar]
- Eversmann, E. Fauna lepidopterologica Volgo-Uralensis. Exhibens. Lepidopterorum Species Quar per Quinque Annos in Provinciis Volgam Fluvium Inter et Montes Uralenses Sitis Observavit et Descripsit; Typis Universitatis: Cracovie, Poland, 1844; p. 633. [Google Scholar]
- Erschoff, N.; Fild, A. Catalogue of Lepidoptera of Russian. Horae Soc. Entomol. Ross. 1870, 4, 130–204. [Google Scholar]
- Alphéraky, S. Lepidoptera Caucasi septentrionalis. Horae Soc. Entomol. Ross. 1877, 10, 3–34. (In Russian) [Google Scholar]
- Romanoff, N.M. Les Lépidoptères de la Transcaucasie. Mém. Lépid. Rom. 1885, 2, 1–6. [Google Scholar]
- Yakovlev, R.V.; Poltavsky, A.N.; Ilyina, E.V.; Shchurov, V.I.; Witt, T. Cossidae (Lepidoptera) of the Russian Caucasus with the description of a new species. Zootaxa 2015, 4044, 270–288. [Google Scholar] [CrossRef] [Green Version]
- De Freina, J.J. 4. Beitrag zur systematischen Erfassung der Bombyces- und Sphinges-Fauna Kleinasiens. Neue Kenntnisse über Artenspektrum, Systematik und Nomeklatur sowie Beschreibungen neuer Taxa. Mitt. Münch. Ent. Ges. 1983, 72, 57–127. [Google Scholar]
- Didmanidze, E.A. New species of Lepidoptera for fauna of Georgia from Vashlovanskii State Reserve. Bull. Acad. Sci. Georgian SSR 1976, 84, 717–719. (In Russian) [Google Scholar]
- Didmanidze, E.A. Lepidoptera of Arid Landscapes of Georgia (Heterocera); Metzniereba: Tbilisi, Georgia, 1978. (In Russian) [Google Scholar]
- Didmanidze, E.A. Materials on fauna of Macrolepidoptera of Tusheti. Vestn. Gos. Museya Gruz. 1980, 30, 126–166. [Google Scholar]
- Didmanidze, E.A.; Zurashvili, T.M. Materials on study of Macrolepidoptera of Vashlovanskii Reserve. Zapov. Gruz. 1981, 5, 76–118. (In Russian) [Google Scholar]
- Kirby, W.F. Catalogue of Lepidoptera Heterocera (Moths) 1 (Sphinges and Bombyces); Gurney & Jackson: London, UK, 1892; Volume 1, pp. 860–878, 938. [Google Scholar]
- Zhuravlev, S.M. Materials on the fauna Lepidoptera Uralsk Sity and different places of Ural’skaya oblast’. Horae Soc. Entomol. Russ. 1910, 50, 463. (In Russian) [Google Scholar]
- Dubatolov, V.V.; Vasilenko, S.V. Some new and little known Lepidoptera (Macrolepidoptera) of Yakutia. Nasek. Lugovo-taezhnyh Biozenozov 1988, 60–61. (In Russian) [Google Scholar]
- Lastuhin, A.A.; Ivanov, A.Y.; Losmanov, Y.P. On the fauna and fenology of Moths (Lepidoptera, Bombyces et Sphinges) of Chuvashskaya Republik. Entomol. Investig. Chuvashiya 1998, 71–77. (In Russian) [Google Scholar]
- Yakovlev, R.V. Carpenter-moths (Lepidoptera, Cossidae) of Siberia. Euroasian Entomol. J. 2004, 3, 155–163. (In Russian) [Google Scholar]
- Yakovlev, R.V. Carpenter-moths (Lepidoptera: Cossidae) of Russia. Eversmannia 2007, 9, 11–33. (In Russian) [Google Scholar]
- Didmanidze, E.A.; Yakovlev, R.V. New distribution records of Isoceras huberi Eitschberger & Ströhle, 1987 and Semagystia cuhensis de Freina, 1994 (Lepidoptera, Cossidae). Atalanta 2005, 36, 575–576. [Google Scholar]
- Yakovlev, R.V. System and Zoogeography of Carpenter-Moths (Lepidoptera: Cossidae) of Old World; Altai State University Publishing: Barnaul, Russia, 2014; p. 394. (In Russian) [Google Scholar]
- Daniel, F. Monographie der palaearktischen Cossidae. V. Die Genera Parahypopta g.n., Sinicossus Clench und Catopta Stgr. Mitt. Münch. Entomol. Ges. 1961, 51, 160–212. [Google Scholar]
- Schrool, J.W. A phylogenetic study on Cossidae (Lepidoptera: Ditrysia) based on external adult morphology. Zool. Verh. 1990, 263, 1–295. [Google Scholar]
- Rebel, H. Beitrag zur Lepidopterenfauna Bulgariens. versammlung der Sektion fur Lepidopterologie. Verhandlungen der k.k. Zool.-Bot. Ges. Wien 1916, LXVI, 36–46. [Google Scholar]
- Tschorbadjiev, P. Beitrag zur Schmetterlingsfauna der Stadt Sliven und ihrer Umgebung. Z. Bulg. Acad. Wiss. 1919, 17, 175–214. [Google Scholar]
- Beshkov, S.A. contribution to the knowledge of the Bulgarian Lepidoptera fauna (Lepidoptera: Macrolepidoptera). Phegea 1995, 23, 201–218. [Google Scholar]
- Abadjiev, S.; Beshkov, S. Prime Butterfly Areas in Bulgaria; Pensoft: Sofia, Bulgaria, 2007; Volume 69, p. 222. ISBN 9789546423047. [Google Scholar]
- Beshkov, S. An Identification Guide for Natura 2000 Species in Bulgaria. 1. Lepidoptera (Butterflies and Moths); Library, Directorate of the Natural Park “Vitosha”: Sofia, Bulgaria, 2011; 151p. [Google Scholar]
- Sheshurak, P.N.; Voblenko, A.S.; Kavurka, V.V.; Nazarov, N.V. Finds of insects included in the annexes of the Convention on the Protection of Wild Fauna and Flora and Natural Habitats in Europe (Berne Convention), on the territory of Ukraine. Zustrichi species recorded before the Chervona Book of Ukraine and international lands/Series: “Conservation Biology in Ukraine”. Vip 2020, 19, 613–626. [Google Scholar]
- Abafi-Aigner, L. Zur Lepidopteren-fauna Rumäniens. Bull. Soc. Sci. Impr. l’Etat Bucureşti 1901, 9, 1–21. [Google Scholar]
- Czekelius, D. Beiträge zur Schmetterlingsfauna Siebenbürgens. Verhandlungen und Mitteilungen des Siebenbürgischen Vereins für Naturwissenschaften zu Hermannstadt. Fortgesetzt Mitt. Arb. Gem. 1917, 67, 1–56. [Google Scholar]
- Rákosy, L.; Laszlóffy, Z. Fauna de macrolepidoptere de la Fânaţele Clujului (Lepidoptera) (Cluj, România). Bul. Inf. Entomol. 1997, 8, 165–186. [Google Scholar]
- Kovacs, S.; Rakosy, L.; Kovacs, Z.; Craioveanu, C.; Goia, M. Lepidoptere din Rezervația Naturală “Dealul cu fluturi” de la Viișoara (jud. Cluj). Bul. Inf. Soc. Lepid. Rom. 2001, 12, 47–85. [Google Scholar]
- Alexinschi, A.; Peiu, M. Contribuţii la cunoaşterea faunei lepidopterelor regiunii Iaşi. (III). Stud. şi cerc şt., Acad. R.P.R. fil. Iaşi 1955, 6, 245–259. [Google Scholar]
- Nemeş, I.; Dănilă, I. Catalogul colecţiei de lepidoptere “Alexei Alexinschi” de la Muzeul Judeţean Suceava. Partea I-a. Fam. Micropterigidae—Fam. Zygaenidae. Muz. Jud. Suceava. Stud. Com. Şt. Nat 1970, 131–265. [Google Scholar]
- Corduneanu, C.; Balan, C.D.; Popovici, O.A.; Surugiu, I. New records or rare species of Lepidoptera (Insecta: Lepidoptera) from the NorthEast part of Romania (poster presentation). In Proceedigns of the Annual Zoological Congress of “Grigore Antipa” Museum, Bucharest, Romania, 20–23 November 2013; Murariu, D., Adam, C., Chisamera, G., Iorgu, E., Popa, L.O., Popa, O.P., Eds.; Medialux: Bucharest, Romania, 2013; p. 147. [Google Scholar]
- Corduneanu, C.; Balan, C.D.; Popovici, O.A.; Moglan, I. Preliminary faunistical considerations regarding Lepidoptera (Insecta: Lepidoptera) from protected area: “Sărăturile din Valea Ilenei” (Iaşi, Romania) (poster presentation). In Proceedngs of the Annual Zoological Congress of “Grigore Antipa” Museum, Bucharest, Romania, 23–25 November 2012; Murariu, D., Adam, C., Chisamera, G., Iorgu, E., Popa, L.O., Popa, O.P., Eds.; Medialux: Bucharest, Romania, 2012; p. 207. [Google Scholar]
- Manci, C.O.; Sitar, C.; Corduneanu, C.; Balan, C. First contribution to the study of lepidopteran fauna (Insecta: Lepidoptera) from Stânca, Iași, Moldova region (Romania). Mnemosyne 2015, 6, 31–47. [Google Scholar]
- Ruşti, D. Noutăţi faunistice din Dobrogea (Insecta: Lepidoptera). Bul. Inf. Soc. Lepid. Rom. 1993, 4, 17–18. [Google Scholar]
- Székely, L. Noutăţi în fauna Macrolepidopterelor României. Mnemosyne 2013, 4, 61–67. [Google Scholar]
- Székely, L. New and rare macrolepidoptera (Insecta) from Romanian Dobrogea (south-east Romania). Trav. Mus. Natl. Hist. Nat. Grigore Antipa 2016, 5, 195–230. [Google Scholar] [CrossRef] [Green Version]
- Daniel, F. Neue Heteroceren. Mitt. Münch. Entomol. Ges. 1953, 43, 256–261. [Google Scholar]
- Cristea, V. Fitosociologie si Vegetatia României [Phytosociology and the Vegetation of Romania]; Babes-Bolyai University: Cluj Napoca, Romania, 1993. [Google Scholar]
- Gounot, M. Methodes d’Etude, Quantitative de la Vegetation; Masson: Paris, France, 1969. [Google Scholar]
- Gafta, D.; Mountford, O. Manual de Interpretare a Habitatelor Natura 2000 din România; Risoprint: Cluj-Napoca, Romania, 2008. [Google Scholar]
- Sanda, V.; Biţă-Nicolae, C.; Barabaş, N. Flora Cormofitelor Spontane din România; Ion Borcea: Bacău, Romania, 2003. [Google Scholar]
- Hebert, P.D.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological identifications through DNA barcodes. Proc. Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Green Version]
- DeWaard, J.R.; Ivanova, N.V.; Hajibabaei, M.; Hebert, P.D. Assembling DNA Barcodes. In Environmental Genomics; Martin, C.C., Ed.; Humana Press: Totowa, NJ, USA, 2008; pp. 275–294. [Google Scholar]
- Formularul Standard Natura 2000. Dealurile Clujului Est. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0295.pdf (accessed on 20 September 2021).
- Formularul Standard Natura 2000. Suatu -Cojocna—Crairât. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0238.pdf (accessed on 20 September 2021).
- Milvus Group. Available online: https://milvus.ro/rosci0210-rapa-lechinta/ (accessed on 20 September 2021).
- Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0210.pdf (accessed on 20 September 2021).
- Melinte-Dobrinescu, M.C.; Brustur, T.; Jipa, D.; Macaleţ, R.; Ion, G.; Ion, E.; Popa, A.; Stănescu, I.; Briceag, A. The Geological and Palaeontological Heritage of the Buzău Land Geopark (Carpathians, Romania). Geoheritage 2016, 9, 225–236. [Google Scholar] [CrossRef]
- ANMP. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/view?doc_id=ROSCI0272 (accessed on 20 September 2021).
- Formularul Standard Natura 2000. Vulcanii Noroioşi de la Pâclele Mari și Pâclele Mici. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0272.pdf (accessed on 20 September 2021).
- Săvulescu, T. Flora Republicii Populare Romane (RPR); Academiei R.P.R: București, Romania, 1952. [Google Scholar]
- Available online: www.biolflor.de (accessed on 20 September 2021).
- I Monteys, V.S. Control of leopard moth, Zeuzera pyrina L, in apple orchards in NE Spain: Mating disruption technique. In Proceedings of the 5th International Conference on Integrated Fruit Production, Lleida, Spain, 22–26 October 2020. [Google Scholar]
- Yakovlev, R.V. Catoptinae subfam. n., a new subfamily of carpenter-moths (Lepidoptera, Cossidae). Entomol. Rev. 2009, 89, 927–932. [Google Scholar] [CrossRef]
Figure 1.
Distribution of Paracossulus thrips populations in Romania. Green dots represent newly populations: 1—population from Cojocna; 2—population from Ploscos, 3—population from Râpa Lechinșa; 4—population from Vulcanii Noroioși; Black dots represent known population; The two locations for sequences sampling: (a)—Jucu de Sus; (b)—Babadag, a also indicate the studied area.
Figure 1.
Distribution of Paracossulus thrips populations in Romania. Green dots represent newly populations: 1—population from Cojocna; 2—population from Ploscos, 3—population from Râpa Lechinșa; 4—population from Vulcanii Noroioși; Black dots represent known population; The two locations for sequences sampling: (a)—Jucu de Sus; (b)—Babadag, a also indicate the studied area.
Figure 2.
Paracossulus thrips—imago (A) Female collected from ROSCI0210 Râpa Lechința on 14 August 2021. (B) Male collected from ROSCI0238 Suatu–Cojocna–Crairât near Ploscoș (Valea Florilor) on 7 July 2015. (C) Male collected from ROSCI0272 Vulcanii Noroioși on 5 August 2015. (D) P. thrips eggs—photo under stereomicroscope.
Figure 2.
Paracossulus thrips—imago (A) Female collected from ROSCI0210 Râpa Lechința on 14 August 2021. (B) Male collected from ROSCI0238 Suatu–Cojocna–Crairât near Ploscoș (Valea Florilor) on 7 July 2015. (C) Male collected from ROSCI0272 Vulcanii Noroioși on 5 August 2015. (D) P. thrips eggs—photo under stereomicroscope.
Figure 3.
The pattern of damage caused by Paracossulus thrips larvae in underground stems and tuberous roots of Phlomis tuberosa: (A) P. thrips larva piercing the tuber of P. tuberosa; (B) Feeding damage on the rhizome of P. tuberosa; (C) P. tuberosa tuber eaten by P. thrips caterpillar; (D) P. tuberosa tuber showing characteristic P. thrips larval damage; (E) After hatching, the larvae of P. thrips enter the stems of P. tuberosa at the base of the leaves that form the basal rosette.
Figure 3.
The pattern of damage caused by Paracossulus thrips larvae in underground stems and tuberous roots of Phlomis tuberosa: (A) P. thrips larva piercing the tuber of P. tuberosa; (B) Feeding damage on the rhizome of P. tuberosa; (C) P. tuberosa tuber eaten by P. thrips caterpillar; (D) P. tuberosa tuber showing characteristic P. thrips larval damage; (E) After hatching, the larvae of P. thrips enter the stems of P. tuberosa at the base of the leaves that form the basal rosette.
Figure 4.
Phlomis tuberosa: (A) Pink flowers arranged in multiflora verticil; (B) triangular lower root leaves; (C) Brown rhizome with fibrous roots; (D) P. tuberosa tubers.
Figure 4.
Phlomis tuberosa: (A) Pink flowers arranged in multiflora verticil; (B) triangular lower root leaves; (C) Brown rhizome with fibrous roots; (D) P. tuberosa tubers.
Figure 5.
The habitat in sample locations: (A,B) The Natura 2000 protected area ROSCI0295 Dealurile Clujului Est (Jucu de Sus); (C,D) The Natura 2000 protected area ROSCI0238 Suatu–Cojocna–Crairât (Cojocna); (E,F) The Natura 2000 protected site ROSCI0210 Râpa Lechința; (G,H) The Natura 2000 protected area ROSCI0272 Vulcanii Noroioși from Pâclele Mari and Pâclele Mici.
Figure 5.
The habitat in sample locations: (A,B) The Natura 2000 protected area ROSCI0295 Dealurile Clujului Est (Jucu de Sus); (C,D) The Natura 2000 protected area ROSCI0238 Suatu–Cojocna–Crairât (Cojocna); (E,F) The Natura 2000 protected site ROSCI0210 Râpa Lechința; (G,H) The Natura 2000 protected area ROSCI0272 Vulcanii Noroioși from Pâclele Mari and Pâclele Mici.
Figure 6.
The ecological perspective of investigated vegetation in Natura 2000 ROSCI0295 Dealurile Clujului Est (Jucu de Sus).
Figure 6.
The ecological perspective of investigated vegetation in Natura 2000 ROSCI0295 Dealurile Clujului Est (Jucu de Sus).
Figure 7.
The ecological perspective of investigated vegetation in Natura 2000 ROSCI0238 Suatu–Cojocna–Crairat (Cojocna).
Figure 7.
The ecological perspective of investigated vegetation in Natura 2000 ROSCI0238 Suatu–Cojocna–Crairat (Cojocna).
Figure 8.
Neighbor-joining (NJ) tree of COI barcodes of Palearctic Cossidae. The tree includes sequences of P. thrips and as out-group Noctua fimbriata (Lepidoptera: Noctuidae), all highlighted in red.
Figure 8.
Neighbor-joining (NJ) tree of COI barcodes of Palearctic Cossidae. The tree includes sequences of P. thrips and as out-group Noctua fimbriata (Lepidoptera: Noctuidae), all highlighted in red.
Figure 9.
The average values of the genetic distances of the analyzed species towards the P. thrips species.
Figure 9.
The average values of the genetic distances of the analyzed species towards the P. thrips species.
Table 1.
Voucher and specimens’ details from studied locations.
| Species | Voucher | Locality | Natura 2000 Site | County | Sex | Age |
|---|---|---|---|---|---|---|
| Paracossulus thrips | LEP007309 | Jucu de Sus | ROSCI0295 | Cluj | female | imago |
| LEP007310 | Jucu de Sus | ROSCI0295 | Cluj | male | imago | |
| LEP007311 | Cojocna | ROSCI0238 | Cluj | - | larva | |
| LEP007312 | Râpa Lechința, Iernut | ROSCI0238 | Mureș | female | imago | |
| LEP007313 | Ploscoș, Gorgan Hill | ROSCI0210 | Cluj | male | imago | |
| LEP007314 | Vulcanii Noroioși | ROSCI0272 | Buzău | male | imago |
Table 2.
The details of specimens used for DNA barcoding.
| Sequence_ID | Species | Collected By | Collection Date | Country | County | Locality |
|---|---|---|---|---|---|---|
| RONOC164-18 | Paracossulus thrips | Sitar C. | 21 July 2016 | Romania | Cluj | Jucu de Sus |
| RONOC165-18 | Paracossulus thrips | Sitar C. | 5 August 2016 | Romania | Cluj | Jucu de Sus |
| RONOC166-18 | Paracossulus thrips | Sitar C. | 21 July 2016 | Romania | Cluj | Jucu de Sus |
| RONOC167-18 | Paracossulus thrips | Szekely L. | 26 August 2011 | Romania | Tulcea | Babadag Forest |
Table 3.
The genetic distances between P. thrips and the species from the same clade. The genetic distances from the out-group are presented in column 14.
Table 3.
The genetic distances between P. thrips and the species from the same clade. The genetic distances from the out-group are presented in column 14.
| SEQUENCE_ID | SPECIES | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| RONOC164-18 | Paracossulus thrips | 1 | 0.0021 | 0.0021 | 0.0021 | 0.1037 | 0.1058 | 0.1058 | 0.1120 | 0.1328 | 0.1328 | 0.1120 | 0.1079 | 0.1079 | 0.6846 | |
| RONOC165-18 | Paracossulus thrips | 2 | 0.0000 | 0.0000 | 0.1017 | 0.1037 | 0.1037 | 0.1100 | 0.1307 | 0.1307 | 0.1100 | 0.1058 | 0.1058 | 0.6867 | ||
| RONOC166-18 | Paracossulus thrips | 3 | 0.0000 | 0.1017 | 0.1037 | 0.1037 | 0.1100 | 0.1307 | 0.1307 | 0.1100 | 0.1058 | 0.1058 | 0.6867 | |||
| RONOC167-18 | Paracossulus thrips | 4 | 0.1017 | 0.1037 | 0.1037 | 0.1100 | 0.1307 | 0.1307 | 0.1100 | 0.1058 | 0.1058 | 0.6867 | ||||
| GBGL13661-14 | Eogystia sibirica | 5 | 0.0021 | 0.0021 | 0.0705 | 0.1058 | 0.1058 | 0.0954 | 0.0954 | 0.0954 | 0.6888 | |||||
| GBGL13662-14 | Eogystia sibirica | 6 | 0.0000 | 0.0726 | 0.1079 | 0.1079 | 0.0975 | 0.0975 | 0.0975 | 0.6909 | ||||||
| GBGL13663-14 | Eogystia sibirica | 7 | 0.0726 | 0.1079 | 0.1079 | 0.0975 | 0.0975 | 0.0975 | 0.6909 | |||||||
| GWORZ172-10 | Parahypopta caestrum | 8 | 0.1183 | 0.1183 | 0.1037 | 0.0996 | 0.0996 | 0.6846 | ||||||||
| BCMI261-11 | Mormogystia proleuca | 9 | 0.0000 | 0.1100 | 0.1100 | 0.1100 | 0.6805 | |||||||||
| BCMI266-11 | Mormogystia proleuca | 10 | 0.1100 | 0.1100 | 0.1100 | 0.6805 | ||||||||||
| MAMOT1708-12 | Holcocerus gloriosus | 11 | 0.0041 | 0.0041 | 0.6888 | |||||||||||
| MAMOT1709-12 | Holcocerus gloriosus | 12 | 0.0000 | 0.6929 | ||||||||||||
| MAMOT1710-12 | Holcocerus gloriosus | 13 | 0.6929 | |||||||||||||
| GU663065.1 | Noctua fimbriata | 14 |
Table 4.
The matrix with the genetic distances between P. thrips and Catopta species.
| SEQUENCE_ID | SPECIES | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| RONOC164-18 | Paracossulus thrips | 1 | 0.0021 | 0.0021 | 0.0021 | 0.1846 | 0.1846 | 0.1846 | 0.1826 | 0.1846 | 0.1846 | 0.1846 | 0.1846 | 0.1846 | |
| RONOC165-18 | Paracossulus thrips | 2 | 0.0000 | 0.0000 | 0.1867 | 0.1867 | 0.1826 | 0.1805 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | ||
| RONOC166-18 | Paracossulus thrips | 3 | 0.0000 | 0.1867 | 0.1867 | 0.1826 | 0.1805 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | |||
| RONOC167-18 | Paracossulus thrips | 4 | 0.1867 | 0.1867 | 0.1826 | 0.1805 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | ||||
| KC860946.1 | Catopta griseotincta | 5 | 0.0000 | 0.1079 | 0.1100 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | |||||
| QUNOE344-12 | Catopta griseotincta | 6 | 0.1079 | 0.1100 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | ||||||
| GBMNC49256-20 | Catopta albonubilus | 7 | 0.0021 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | |||||||
| GBMNC49258-20 | Catopta albonubilus | 8 | 0.0021 | 0.0021 | 0.0021 | 0.0021 | 0.0021 | ||||||||
| GBMNC49259-20 | Catopta albonubilus | 9 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | |||||||||
| GBMNC49260-20 | Catopta albonubilus | 10 | 0.0000 | 0.0000 | 0.0000 | ||||||||||
| GBMNC49261-20 | Catopta albonubilus | 11 | 0.0000 | 0.0000 | |||||||||||
| GBMNC49262-20 | Catopta albonubilus | 12 | 0.0000 | ||||||||||||
| GBMNC49263-20 | Catopta albonubilus | 13 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Iacob, G.M.; Craioveanu, C.; Hula, V.; Aurelian, V.M.; Beldean, M.; Sitar, C. Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania. Insects 2021, 12, 1087. https://doi.org/10.3390/insects12121087
AMA Style
Iacob GM, Craioveanu C, Hula V, Aurelian VM, Beldean M, Sitar C. Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania. Insects. 2021; 12(12):1087. https://doi.org/10.3390/insects12121087
Chicago/Turabian StyleIacob, Geanina Magdalena, Cristina Craioveanu, Vladimír Hula, Virgiliu Marius Aurelian, Monica Beldean, and Cristian Sitar. 2021. "Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania" Insects 12, no. 12: 1087. https://doi.org/10.3390/insects12121087
APA StyleIacob, G. M., Craioveanu, C., Hula, V., Aurelian, V. M., Beldean, M., & Sitar, C. (2021). Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania. Insects, 12(12), 1087. https://doi.org/10.3390/insects12121087
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
