Oxidative Stress, Endoparasite Prevalence and Social Immunity in Bee Colonies Kept Traditionally vs. Those Kept for Commercial Purposes
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling and Sample Preparation
2.2. Oxidative Stress Parameters
2.3. Detection and Species Identification of Trypanosomatids and Microsporidians
2.4. Glucose Oxidase (GOX) Gene Expression Analysis
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Taric, E.; Glavinic, U.; Stevanovic, J.; Vejnovic, B.; Aleksic, N.; Dimitrijevic, V.; Stanimirovic, Z. Occurrence of honey bee (Apis mellifera L.) pathogens in commercial and traditional hives. J. Apicult. Res. 2019, 58, 433–443. [Google Scholar] [CrossRef] [Scilit]
- Thompson, C.E.; Biesmeijer, C.J.; Allnutt, T.R.; Pietravalle, S.; Budge, G.E. Parasite pressures on feral honey bees (Apis mellifera sp.). PLoS ONE 2014, 9, e105164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Appler, R.H.; Frank, S.D.; Tarpy, D.R. Within-Colony Variation in the Immunocompetency of Managed and Feral Honey Bees (Apis mellifera L.) in Different Urban Landscapes. Insects 2015, 6, 912–925. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Youngsteadt, E.; Appler, R.H.; López-Uribe, M.M.; Tarpy, D.R.; Frank, S.D. Urbanization Increases Pathogen Pressure on Feral and Managed Honey Bees. PLoS ONE 2015, 10, e0142031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, M.K.F.; Tripodi, A.D.; Szalanski, A.L. Molecular survey for the honey bee (Apis mellifera L.) trypanosome parasites Crithidia mellificae and Lotmaria passim. J. Apicult. Res. 2019, 58, 553–556. [Google Scholar] [CrossRef] [Scilit]
- Sorci, G.; Faivre, B. Inflammation and oxidative stress in vertebrate host–parasite systems. Philos. T. Roy. Soc. B. 2009, 364, 71–83. [Google Scholar] [CrossRef] [Scilit]
- Halliwell, B.; Gutteridge, J.M. Free radicals in biology and medicine, 5th ed.; Oxford University Press: Oxford, UK, 2015. [Google Scholar]
- Dubovskiy, I.M.; Martemyanov, V.V.; Vorontsova, Y.L.; Rantala, M.J.; Gryzanova, E.V.; Glupov, V.V. Effect of bacterial infection on antioxidant activity and lipid peroxidation in the midgut of Galleria mellonella L. larvae (Lepidoptera, Pyralidae). Comp. Biochem. Phys. C. 2008, 148, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Gülmez, Y.; Dursun, K.; Ilyas, C. Effects of Varroa destructor Anderson & Trueman Infestation on Antioxidant Enzymes of Adult Worker Honey Bee (Apis mellifera L.). Asian. J. Chem. 2016, 28, 663–665. [Google Scholar]
- Dussaubat, C.; Brunet, J.L.; Higes, M.; Colbourne, J.K.; Lopez, J.; Choi, J.H.; Hernández, R.M.; Botías, C.; Cousin, M.; McDonnell, C.; et al. Gut pathology and responses to the microsporidium Nosema ceranae in the honey bee Apis mellifera. PLoS ONE 2012, 7, e37017. [Google Scholar] [CrossRef] [Scilit]
- Alaux, C.; Ducloz, F.; Crauser, D.; Le Conte, Y. Diet effects on honeybee immunocompetence. Biol. Lett. 2010, 6, 562–565. [Google Scholar] [CrossRef] [Scilit]
- Stanimirovic, Z.; Glavinic, U.; Ristanic, M.; Aleksic, A.; Jovanovic, N.; Vejnovic, B.; Stevanović, J. Looking for the causes of and solutions to the issue of honey bee colony losses. Acta Vet. 2019, 69, 1–31. [Google Scholar] [CrossRef] [Scilit]
- Wilson-Rich, N.; Spivak, M.; Fefferman, N.H.; Starks, P.T. Genetic, individual group facilitation of disease resistance in insect societies. Annu. Rev. Entomol. 2009, 54, 405–423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alaux, C.; Brunet, J.L.; Dussaubat, C.; Mondet, F.; Tchamitchan, S.; Cousin, M.; Brillard, J.; Baldy, A.; Belzunces, L.P.; Le Conte, Y. Interactions between Nosema microspores and a neonicotinoid weaken honeybees (Apis mellifera). Environ. Microbiol. 2010, 12, 774–782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, B.; Shipley, E.; Arnold, K.E. Social immunity in honeybees—Density dependence, diet, and body mass trade-offs. Ecol. Evol. 2018, 8, 4852–4859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Visscher, P.K. Adaptations of honey bees (Apis mellifera) to problems of nest hygiene. Sociobiology 1980, 5, 249–260. [Google Scholar]
- Sano, O.; Kunikata, T.; Kohno, K.; Iwaki, K.; Ikeda, M.; Kurimoto, M. Characterization of royal jelly proteins in both Africanized and European honeybees (Apis mellifera) by two-dimensional gel electrophoresis. J. Agric. Food. Chem. 2004, 52, 15–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brudzynski, K. Effect of hydrogen peroxide on antibacterial activities of Canadian honeys. Can. J. Microbiol. 2006, 52, 1228–1237. [Google Scholar] [CrossRef] [Scilit]
- López-Uribe, M.M.; Fitzgerald, A.; Simone-Finstrom, M. Inducible versus constitutive social immunity: Examining effects of colony infection on glucose oxidase and defensin-1 production in honeybees. Roy. Soc. Open. Sci. 2017, 4, 170224. [Google Scholar] [CrossRef] [Scilit]
- Fries, I. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr. Pathol. 2010, 103, 73–79. [Google Scholar] [CrossRef] [Scilit]
- Higes, M.; Martín-Hernández, R.; Meana, A. Nosema ceranae in Europe: An emergent type C nosemosis. Apidologie. 2010, 41, 375–392. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Botías, C.; Barrios, L.; Martínez-Salvador, A.; Meana, A.; Mayack, C.; Higes, M. Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera). Parasitol. Res. 2011, 109, 605–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayack, C.; Naug, D. Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J. Invertebr. Pathol. 2009, 100, 185–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antúnez, K.; Martín-Hernández, R.; Prieto, L.; Meana, A.; Zunino, P.; Higes, M. Immune suppression in the honey bee (Apis mellifera) following infection by Nosema ceranae (Microsporidia). Environ. Microbiol. 2009, 11, 2284–2290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaimanee, V.; Chantawannakul, P.; Chen, Y.; Evans, J.D.; Pettis, J.S. Differential expression of immune genes of adult honey bee (Apis mellifera) after inoculated by Nosema ceranae. J. Insect Physiol. 2012, 58, 1090–1095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glavinic, U.; Stankovic, B.; Draskovic, V.; Stevanovic, J.; Petrovic, T.; Lakic, N.; Stanimirovic, Z. Dietary amino acid and vitamin complex protects honey bee from immunosuppression caused by Nosema ceranae. PLoS ONE 2017, 12, e0187726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goblirsch, M.; Huang, Z.Y.; Spivak, M. Physiological and behavioral changes in honey bees (Apis mellifera) induced by Nosema ceranae infection. PLoS ONE 2013, 8, e58165. [Google Scholar] [CrossRef] [Scilit]
- Higes, M.; Martín, R.; Meana, A. Nosema ceranae, a new microsporidian parasite in honeybees in Europe. J. Invertebr. Pathol. 2006, 92, 93–95. [Google Scholar] [CrossRef] [Scilit]
- Schwarz, R.S.; Bauchan, G.R.; Murphy, C.; Ravoet, J.; de Graaf, D.C.; Evans, J.D. Characterization of two species of Trypanosomatidae from the honey bee Apis mellifera: Crithidia mellificae Langridge and McGhee, and Lotmaria passim. J. Eukaryot. Microbiol. 2015, 62, 567–583. [Google Scholar] [CrossRef] [Scilit]
- Arismendi, N.; Bruna, A.; Zapata, N.; Vargas, M. PCR-specific detection of recently described Lotmaria passim (Trypanosomatidae) in Chilean apiaries. J. Invertebr. Pathol. 2016, 134, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Ravoet, J.; Schwarz, R.S.; Descamps, T.; Yañez, O.; Tozkar, C.O.; Martín-Hernández, R.; Bartolomé, C.; De Smet, L.; Higes, M.; Wenseleers, T.; et al. Differential diagnosis of the honey bee trypanosomatids Crithidia mellificae and Lotmaria passim. J. Invertebr. Pathol. 2015, 130, 21–27. [Google Scholar] [CrossRef] [Scilit]
- Stevanovic, J.; Schwarz, R.S.; Vejnovic, B.; Evans, J.D.; Irwin, R.E.; Glavinic, U.; Stanimirovic, Z. Species-specific diagnostics of Apis mellifera trypanosomatids: A nine-year survey (2007–2015) for trypanosomatids and microsporidians in Serbian honey bees. J. Invertebr. Pathol. 2016, 139, 6–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vejnovic, B.; Stevanovic, J.; Schwarz, R.S.; Aleksic, N.; Mirilovic, M.; Jovanovic, N.; Stanimirovic, Z. Quantitative PCR assessment of Lotmaria passim in Apis mellifera colonies co-infected naturally with Nosema ceranae. J. Invertebr. Pathol. 2018, 151, 76–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ravoet, J.; Maharramov, J.; Meeus, I.; de Smet, L.; Wenseleers, T.; Smagghe, G.; de Graaf, D.C. Comprehensive bee pathogen screening in Belgium reveals Crithidia mellificae as a new contributory factor to winter mortality. PLoS ONE 2013, 8, e72443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- OIE-Office International Des Epizooties. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. 2019. Available online: http://www.oie.int/en/international-standard-setting/terrestrial-manual/access-online/ (accessed on 21 January 2020).
- Aebi, H. Catalase in vitro. In Packer Lester. 1st ed: Methods Enzymol; Academic Press: Cambridge, MA, USA, 1984; pp. 121–126. [Google Scholar]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-transferases the first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar] [PubMed]
- Misra, H.P.; Fridovich, I. The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase. J. Biol. Chem. 1972, 247, 3170–3175. [Google Scholar] [PubMed]
- Girotti, M.J.; Khan, N.; McLellan, B.A. Early measurement of systemic lipid peroxidation products in the plasma of major blunt trauma patients. J. Trauma. Acute. Care. 1991, 31, 32–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Martín-Hernández, R.; Meana, A.; Prieto, L.; Salvador, A.M.; Garrido-Bailón, E.; Higes, M. Outcome of colonization of Apis mellifera by Nosema ceranae. Appl. Environ. Microbiol. 2007, 73, 6331–6338. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Cox-Foster, D.L. Impact of an ectoparasite on the immunity and pathology of an invertebrate: Evidence for host immunosuppression and viral amplification. Proc. Natl. Acad. Sci. USA 2005, 102, 7470–7475. [Google Scholar] [CrossRef] [Scilit]
- Evans, J.D. Beepath: An ordered quantitative-PCR array for exploring honey bee immunity and disease. J. Invertebr. Pathol. 2006, 93, 135–139. [Google Scholar] [CrossRef] [Scilit]
- Brodschneider, R.; Gray, A.; Adjlane, N.; Ballis, A.; Brusbardis, V.; Charrière, J.D.; Chlebo, R.; Coffey, M.F.; Dahle, B.; de Graaf, D.C.; et al. Multi-country loss rates of honey bee colonies during winter 2016/2017 from the COLOSS survey. J. Apicult. Res. 2018, 57, 452–457. [Google Scholar] [CrossRef] [Scilit]
- Grey, A.; Brodschneider, R.; Adjlane, N.; Ballis, A.; Brusbardis, V.; Charrière, J.D.; Chlebo, R.; Coffey, M.F.; Cornelissen, B.; da Costa, C.A.; et al. Loss rates of honey bee colonies during winter 2017/18 in 36 countries participating in the COLOSS survey, including effects of forage sources. J. Apicult. Res. 2019, 58, 479–485. [Google Scholar] [CrossRef] [Scilit]
- Surai, P.F. Antioxidant Systems in Poultry Biology: Superoxide Dismutase. J. Anim. Res. Nut. 2015, 1, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Ha, E.M.; Oh, C.T.; Ryu, J.H.; Bae, Y.S.; Kang, S.W.; Jang, I.H.; Brey, P.T.; Lee, W.J. An antioxidant system required for host protection against gut infection in Drosophila. Dev. Cell. 2005, 8, 125–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vidau, C.; Diogon, M.; Aufauvre, J.; Fontbonne, R.; Viguès, B.; Brunet, J.L.; Texier, C.; Biron, D.G.; Blot, N.; Alaoui, H.E.; et al. Exposure to sublethal doses of fipronil and thiacloprid highly increases mortality of honeybees previously infected by Nosema ceranae. PLoS ONE 2011, 6, e21550. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, A.M. Lipid peroxidation and oxidative protein products as biomarkers of oxidative stress in the autogenous mosquito, Aedes caspius, upon infection with the mosquitocidal bacterium, Bacillus thuringiensis kurstaki. Pakistan. J. Zool. 2012, 44, 525–536. [Google Scholar]
- Wang, Y.; Oberley, L.W.; Murhammer, D.W. Evidence of oxidative stress following the viral infection of two Lepidopteran insect cell lines. Free. Rad. Biol. Med. 2001, 31, 1448–1455. [Google Scholar] [CrossRef] [Scilit]
- Nikolić, V.T.; Purac, J.; Orcic, S.; Kojic, D.; Vujanovic, D.; Stanimirovic, Z.; Grzetic, I.; Ilijevic, K.; Sikoparija, B.; Blagojevic, P.D. Environmental effects on superoxide dismutase and catalase activity and expression in honey bee. Arch. Insect Biochem. 2015, 90, 181–194. [Google Scholar]
- Orcic, S.; Nikolic, T.; Purac, J.; Sikoparija, B.; Blagojević, P.D.; Vukasinovic, E.; Plavsa, N.; Stevanovic, J.; Kojic, D. Seasonal variations in the activity of selected antioxidant enzymes and malondialdehyde level in worker honey bees. Entomol. Exp. Appl. 2017, 165, 120–128. [Google Scholar] [CrossRef] [Scilit]
- Simone-Finstrom, M.; Li-Byarlay, H.; Huang, M.H.; Strand, M.K.; Rueppell, O.; Tarpy, D.R. Migratory management and environmental conditions affect lifespan and oxidative stress in honey bees. Sci. Rep. 2016, 6, 32023. [Google Scholar] [CrossRef] [Scilit]
- Glavinic, U. The effects of various antimicrobials and supplements on the expression of immune-related genes, oxidative stress and survival of honey bee Apis mellifera infected with microsporidium Nosema ceranae. Ph.D. Thesis, Faculty of Veterinary Medicine, University of Belgrade, Belgrade, Serbia, October 2019; pp. 1–238. [Google Scholar]
- López-Uribe, M.M.; Appler, R.H.; Youngsteadt, E.; Dunn, R.R.; Frank, S.D.; Tarpy, D.R. Higher immunocompetences associated with higher genetic diversity in feral honey bee colonies (Apis mellifera). Conserv. Genet. 2017, 18, 659–666. [Google Scholar]
- Simeunovic, P. Molecular detection and identification of microsporidia and viruses in honey bee colonies in Serbia. Ph.D. Thesis, Faculty of Veterinary Medicine, University of Belgrade, Belgrade, Serbia, June 2015; pp. 1–145. Available online: http://uvidok.rcub.bg.ac.rs/bitstream/handle/123456789/252/Doktorat.pdf?sequence=1 (accessed on 21 January 2020).
- Cirkovic, D.; Stevanovic, J.; Glavinic, U.; Aleksic, N.; Djuric, S.; Aleksic, J.; Stanimirovic, Z. Honeybee viruses in Serbian colonies of different strength. PeerJ 2018, 6, e5887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernández, J.M.; Puerta, F.; Cousinou, M.; Dios-Palomares, R.; Campano, F.; Redondo, L. Asymptomatic presence of Nosema spp. in Spanish commercial apiaries. J. Invertebr. Pathol. 2012, 111, 106–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevanovic, J.; Stanimirovic, Z.; Genersch, E.; Kovacevic, R.S.; Ljubenkovic, J.; Radakovic, M.; Aleksic, N. Dominance of Nosema ceranae in honey bees in the Balkan countries in the absence of symptoms of colony collapse disorder. Apidologie 2011, 41, 49–58. [Google Scholar] [CrossRef] [Scilit]
- Stevanovic, J.; Simeunovic, P.; Gajic, B.; Lakic, N.; Radovic, D.; Fries, I.; Stanimirovic, Z. Characteristics of Nosemaceranae infection in Serbian honey bee colonies. Apidologie 2013, 44, 522–536. [Google Scholar] [CrossRef] [Scilit]
- Traver, B.E.; Fell, R.D. Prevalence and infection intensity of Nosema in honey bee (Apis mellifera L.) colonies in Virginia. J. Invertebr. Pathol. 2011, 107, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Bordier, C.; Suchail, S.; Pioz, M.; Devaud, J.M.; Collet, C.; Charreton, M.; Le Conte, Y.; Alaux, C. Stress response in honeybees is associated with changes in task-related physiology and energetic metabolism. J. Insect Physiol. 2017, 98, 47–54. [Google Scholar] [CrossRef] [Scilit]
- Kiljanek, T.; Niewiadowska, A.; Posyniak, A. Pesticide poisoning of honeybees: A review of symptoms, incident classification, and causes of poisoning. J. Apic. Sci. 2016, 60, 5–24. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Bayo, F.; Goulson, D.; Pennacchio, F.; Nazzi, F.; Goka, K.; Desneux, N. Are bee diseases linked to pesticides?—A brief review. Environ. Int. 2016, 89, 7–11. [Google Scholar] [CrossRef] [Scilit]
- Glavinic, U.; Tesovnik, T.; Stevanovic, J.; Zorc, M.; Cizelj, I.; Stanimirovic, Z.; Narat, M. Response of adult honey bees treated in larval stage with prochloraz to infection with Nosema ceranae. PeerJ 2019, 7, e6325. [Google Scholar] [CrossRef] [Scilit]
- Stanimirovic, Z.; Pejovic, D.; Stevanovic, J.; Vucinic, M.; Mirilovic, M. Investigations of hygienic behaviour and disease resistance in organic beekeeping of two honeybee ecogeographic varieties from Serbia. Acta Vet. 2002, 52, 169–180. [Google Scholar]
- Stanimirovic, Z.; Stevanovic, J.; Cirkovic, D. Behavioural defenses of the honey bee ecotype from Sjenica–Pester against Varroa destructor. Acta Vet. 2005, 55, 69–82. [Google Scholar]
- Stanimirovic, Z.; Stevanovic, J.; Jovanovic, S.; Andjelkovic, M. Evaluation of genotoxic effects of Apitol® (cymiazole hydrochloride) in vitro by measurement of sister chromatid exchange. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2005, 588, 152–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stanimirovic, Z.; Stevanovic, J.; Bajic, V.; Radovic, I. Evaluation of genotoxic effects of fumagillin by cytogenetic tests in vivo. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2007, 628, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Stevanovic, J.; Stanimirovic, Z.; Radakovic, M.; Stojic, V. In vitro evaluation of the clastogenicity of fumagillin. Environ. Mol. Mutagen. 2008, 49, 594–601. [Google Scholar] [CrossRef] [Scilit]
- Neumann, P.; Blacquière, T. The Darwin cure for apiculture? Natural selection and managed honeybee health. Evol. Appl. 2017, 10, 226–230. [Google Scholar] [CrossRef] [Scilit]
- Ruiz-González, M.X.; Brown, M.J. Honey bee and bumblebee trypanosomatids: Specificity and potential for transmission. Ecol. Entomol. 2006, 31, 616–622. [Google Scholar] [CrossRef] [Scilit]





| Primer | Target | Sequence (5′–3′) | Reference |
|---|---|---|---|
| 218MITOC-for 218MITOC-rev | Nosema ceranae | CGGCGACGATGTGATATGAAAATATTAA CCCGGTCATTCTCAAACAAAAAACCG | [41] |
| 321APIS-for 321APIS-rev | N. apis | GGGGGCATGTCTTTGACGTACTATGTA GGGGGGCGTTTAAAATGTGAAACAACTATG | |
| LpCytb_F1 LpCytb_R | Lotmaria passim | cGAAGTgCaCATATATGCTTtAC gcCAaAcACCaATaACtGGtACt | [32] |
| CmCytb_F CmCytb_R | Crithidia mellificae | AGTtTGAgCtGTtGGaTTTgTt AACCtATtACaGGcACaGTTGC | |
| GOX_F GOX_R | Glucose oxidase (GOX) | GAGCGAGGTTTCGAATTGGA GTCGTTCCCCCGAGATTCTT | [42] |
| Bee Parasite | Samples | Hives | Significance | |
|---|---|---|---|---|
| Commercial % (N) | Traditional—Trmka % (N) | |||
| N. ceranae | Adult bees | 61.67 (74) | 29.17 (7) | ** |
| L. passim | Bee brood | 16.67 (20) | 8.33 (2) | ns |
| L. passim | Adult bees | 50.00 (60) | 25.00 (6) | * |
| Samples Positive for L. passim in Commercial Apiaries—DB Hives | Samples Positive for L. passim in Traditional Apiaries—Trmka Hives | ||||
|---|---|---|---|---|---|
| Bee Brood % (N) | Adult Bees % (N) | Significance | Bee Brood % (N) | Adult Bees % (N) | Significance |
| 16.67 (20) | 50.00 (60) | ** | 8.33 (2) | 25.00 (6) | ns |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Taric, E.; Glavinic, U.; Vejnovic, B.; Stanojkovic, A.; Aleksic, N.; Dimitrijevic, V.; Stanimirovic, Z. Oxidative Stress, Endoparasite Prevalence and Social Immunity in Bee Colonies Kept Traditionally vs. Those Kept for Commercial Purposes. Insects 2020, 11, 266. https://doi.org/10.3390/insects11050266
Taric E, Glavinic U, Vejnovic B, Stanojkovic A, Aleksic N, Dimitrijevic V, Stanimirovic Z. Oxidative Stress, Endoparasite Prevalence and Social Immunity in Bee Colonies Kept Traditionally vs. Those Kept for Commercial Purposes. Insects. 2020; 11(5):266. https://doi.org/10.3390/insects11050266
Chicago/Turabian StyleTaric, Elmin, Uros Glavinic, Branislav Vejnovic, Aleksandar Stanojkovic, Nevenka Aleksic, Vladimir Dimitrijevic, and Zoran Stanimirovic. 2020. "Oxidative Stress, Endoparasite Prevalence and Social Immunity in Bee Colonies Kept Traditionally vs. Those Kept for Commercial Purposes" Insects 11, no. 5: 266. https://doi.org/10.3390/insects11050266
APA StyleTaric, E., Glavinic, U., Vejnovic, B., Stanojkovic, A., Aleksic, N., Dimitrijevic, V., & Stanimirovic, Z. (2020). Oxidative Stress, Endoparasite Prevalence and Social Immunity in Bee Colonies Kept Traditionally vs. Those Kept for Commercial Purposes. Insects, 11(5), 266. https://doi.org/10.3390/insects11050266

