Point-of-Care Diagnostic System for Viable Salmonella Species via Improved Propidium Monoazide and Recombinase Polymerase Amplification Based Nucleic Acid Lateral Flow
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Preparation of Viable and Dead S. Typhimurium Isolates
2.3. DNA Extraction
2.4. Real-Time PCR
2.5. Verification of the PMAxx Treatment
2.6. RPA for NALF Detection
2.6.1. Sequence Design and Synthesis
2.6.2. RPA Assay and Primer Selection
2.6.3. RPA-Based NALF
2.6.4. Optimization of RPA Parameters
2.7. Evaluation of PMAxx-RPA-Based NALF
2.7.1. Specificity and Sensitivity Assessment of PMAxx-RPA-Based NALF with Pure Culture
2.7.2. Detection of Viable S. Typhimurium Strains in Artificially Contaminated Foods
2.8. Statistical Analyses
3. Results and Discussion
3.1. Effect of PMAxx Treatment on Viable and Dead S. Typhimurium Isolates
3.2. Design of Primer and Probe for S. Typhimurium Detection Using the RPA-Based NALF System
3.3. Optimization of RPA Conditions for NALF-Based S. Typhimurium Detection
3.4. Validation of Detection of Viable S. Typhimurium in Pure Culture and Food Samples Using PMAxx-RPA-Based NALF
3.5. Evaluation of Viable S. Typhimurium Detection in Artificially Contaminated Food Samples
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rahman, H.S.; Mahmoud, B.M.; Othman, H.H.; Amin, K. A review of history, definition, classification, source, transmission, and pathogenesis of Salmonella: A model for human infection. J. Zankoy Sulaimani 2018, 20, 11–20. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Whitehouse, C.A.; Li, B. Presence and persistence of Salmonella in water: The impact on microbial quality of water and food safety. Front. Public Health 2018, 6, 159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stanaway, J.D.; Parisi, A.; Sarkar, K.; Blacker, B.F.; Reiner, R.C.; Hay, S.I.; Nixon, M.R.; Dolecek, C.; James, S.L.; Mokdad, A.H. The global burden of non-typhoidal Salmonella invasive disease: A systematic analysis for the Global Burden of Disease Study 2017. Lancet Infect. Dis. 2019, 19, 1312–1324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mangal, M.; Bansal, S.; Sharma, S.K.; Gupta, R.K. Molecular detection of foodborne pathogens: A rapid and accurate answer to food safety. Crit. Rev. Food Sci. Nutr. 2016, 56, 1568–1584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balasubramanian, R.; Im, J.; Lee, J.S.; Jeon, H.J.; Mogeni, O.D.; Kim, J.H.; Rakotozandrindrainy, R.; Baker, S.; Marks, F. The global burden and epidemiology of invasive non-typhoidal Salmonella infections. Hum. Vaccines Immunother. 2019, 15, 1421–1426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, K.-M.; Runyon, M.; Herrman, T.J.; Phillips, R.; Hsieh, J. Review of Salmonella detection and identification methods: Aspects of rapid emergency response and food safety. Food Control 2015, 47, 264–276. [Google Scholar] [CrossRef] [Scilit]
- Velusamy, V.; Arshak, K.; Korostynska, O.; Oliwa, K.; Adley, C. An overview of foodborne pathogen detection: In the perspective of biosensors. Biotechnol. Adv. 2010, 28, 232–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.; Lin, C.W.; Wang, J.; Oh, D.H. Advances in rapid detection methods for foodborne pathogens. J. Microbiol. Biotechnol. 2014, 24, 297–312. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Nehra, M.; Mehta, J.; Dilbaghi, N.; Marrazza, G.; Kaushik, A. Point-of-care strategies for detection of waterborne pathogens. Sensors 2019, 19, 4476. [Google Scholar] [CrossRef] [Scilit]
- Luppa, P.B.; Müller, C.; Schlichtiger, A.; Schlebusch, H. Point-of-care testing (POCT): Current techniques and future perspectives. Trends Anal. Chem. 2011, 30, 887–898. [Google Scholar] [CrossRef] [Scilit]
- Barreda-García, S.; Miranda-Castro, R.; de-Los-Santos-Álvarez, N.; Miranda-Ordieres, A.J.; Lobo-Castañón, M.J. Helicase-dependent isothermal amplification: A novel tool in the development of molecular-based analytical systems for rapid pathogen detection. Anal. Bioanal. Chem. 2018, 410, 679–693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliveira, B.B.; Veigas, B.; Baptista, P.V. Isothermal amplification of nucleic acids: The race for the next “gold standard”. Front. Sens. 2021, 2, 752600. [Google Scholar] [CrossRef] [Scilit]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. TrAC Trends Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.-Y.; Oh, S.-W. Lateral flow biosensor based on LAMP-CRISPR/Cas12a for sensitive and visualized detection of Salmonella spp. Food Control 2023, 145, 109494. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.-H.; Oh, S.-W. A colorimetric lateral flow assay based on multiplex PCR for the rapid detection of viable Escherichia coli O157: H7 and Salmonella Typhimurium without enrichment. LWT 2021, 152, 112242. [Google Scholar] [CrossRef] [Scilit]
- Pavankumar, A.R.; Engström, A.; Liu, J.; Herthnek, D.; Nilsson, M. Proficient detection of multi-drug-resistant Mycobacterium tuberculosis by padlock probes and lateral flow nucleic acid biosensors. Anal. Chem. 2016, 88, 4277–4284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sohrabi, H.; Majidi, M.R.; Fakhraei, M.; Jahanban-Esfahlan, A.; Hejazi, M.; Oroojalian, F.; Baradaran, B.; Tohidast, M.; de la Guardia, M.; Mokhtarzadeh, A. Lateral flow assays (LFA) for detection of pathogenic bacteria: A small point-of-care platform for diagnosis of human infectious diseases. Talanta 2022, 243, 123330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, V.T.; Song, S.; Park, S.; Joo, C. Recent advances in high-sensitivity detection methods for paper-based lateral-flow assay. Biosens. Bioelectron. 2020, 152, 112015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baert, L.; Debevere, J.; Uyttendaele, M. The efficacy of preservation methods to inactivate foodborne viruses. Int. J. Food Microbiol. 2009, 131, 83–94. [Google Scholar] [CrossRef] [Scilit]
- Zeng, D.; Chen, Z.; Jiang, Y.; Xue, F.; Li, B. Advances and challenges in viability detection of foodborne pathogens. Front. Microbiol. 2016, 7, 1833. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Li, Y.; Mustapha, A. Detection of viable Escherichia coli O157: H7 by ethidium monoazide real-time PCR. J. Appl. Microbiol. 2009, 107, 1719–1728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ni, J.Z.; Flynn, B.B.; Jacobs, F.R. Impact of product recall announcements on retailers’ financial value. Int. J. Prod. Econ. 2014, 153, 309–322. [Google Scholar] [CrossRef] [Scilit]
- Fittipaldi, M.; Nocker, A.; Codony, F. Progress in understanding preferential detection of live cells using viability dyes in combination with DNA amplification. J. Microbiol. Methods 2012, 91, 276–289. [Google Scholar] [CrossRef] [Scilit]
- Lin, X.; Jin, X.; Du, W.; Shan, X.; Huang, Q.; Fu, R.; Lv, W.; Yang, H.; Su, Y.; Huang, G. Quantitative and specific detection of viable pathogens on a portable microfluidic chip system by combining improved propidium monoazide (PMAxx) and loop-mediated isothermal amplification (LAMP). Anal. Methods 2021, 13, 3569–3576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhuang, L.; Gong, J.; Shen, Q.; Yang, J.; Song, C.; Liu, Q.; Zhao, B.; Zhang, Y.; Zhu, M. Advances in detection methods for viable Salmonella spp.: Current applications and challenges. Anal. Sci. 2023, 39, 1643–1660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daum, L.T.; Barnes, W.J.; McAvin, J.C.; Neidert, M.S.; Cooper, L.A.; Huff, W.B.; Gaul, L.; Riggins, W.S.; Morris, S.; Salmen, A.; et al. Real-time PCR detection of Salmonella in suspect foods from a gastroenteritis outbreak in Kerr County, Texas. J. Clin. Microbiol. 2002, 40, 3050–3052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martins, C.; Lima, G.; Carvalho, M.; Cainé, L.; Porto, M. DNA quantification by real-time PCR in different forensic samples. Forensic Sci. Int. Genet. Suppl. Ser. 2015, 5, e545–e546. [Google Scholar] [CrossRef] [Scilit]
- Manfredini, A.; Malusà, E.; Pinzari, F.; Canfora, L. Quantification of nitrogen cycle functional genes from viable archaea and bacteria in paddy soil. J. Appl. Microbiol. 2023, 134, lxad169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daddy Gaoh, S.; Kweon, O.; Lee, Y.J.; Hussong, D.; Marasa, B.; Ahn, Y. A propidium monoazide (PMAxx)-droplet digital PCR (ddPCR) for the detection of viable Burkholderia cepacia complex in nuclease-free water and antiseptics. Microorganisms 2022, 10, 943. [Google Scholar] [CrossRef] [Scilit]
- Mu, D.; Zhou, D.; Xie, G.; Liu, J.; Wang, Z.; Xiong, Q.; Xu, H. Real-time recombinase-aided amplification with improved propidium monoazide for the rapid detection of viable Escherichia coli O157: H7 in milk. J. Dairy Sci. 2022, 105, 1028–1038. [Google Scholar] [CrossRef] [Scilit]
- Smith, S.I.; Fowora, M.A.; Atiba, A.; Anejo-Okopi, J.; Fingesi, T.; Adamu, M.E.; Omonigbehin, E.A.; Ugo-Ijeh, M.I.; Bamidele, M.; Odeigah, P. Molecular Detection of Some Virulence Genes in Salmonella spp. Isolated from Food Samples in Lagos, Nigeria. 2015. Available online: http://hdl.handle.net/123456789/2008 (accessed on 28 February 2024).
- Green, M.R.; Sambrook, J. Analysis of DNA by agarose gel electrophoresis. Cold Spring Harb. Protoc. 2019, 2019, top100388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, S.K.; Chen, C.C.; Lin, H.J.; Lin, H.Y.; Chen, T.T.; Wang, L.C. Combination of multiplex reverse transcription recombinase polymerase amplification assay and capillary electrophoresis provides high sensitive and high-throughput simultaneous detection of avian influenza virus subtypes. J. Vet. Sci. 2020, 21, e24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.B.; Zang, Y.X.; Du, X.J.; Li, P.; Wang, S. Development of an isothermal amplification-based assay for the rapid visual detection of Salmonella bacteria. J. Dairy Sci. 2017, 100, 7016–7025. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, X.J.; Zang, Y.X.; Liu, H.B.; Li, P.; Wang, S. Recombinase polymerase amplification combined with lateral flow strip for Listeria monocytogenes detection in food. J. Food Sci. 2018, 83, 1041–1047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Ma, B.; Fang, J.; Zhi, A.; Chen, E.; Xu, Y.; Yu, X.; Sun, C.; Zhang, M. Recombinase polymerase amplification (RPA) combined with lateral flow immunoassay for rapid detection of Salmonella in food. Foods 2019, 9, 27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Pelt-Verkuil, E.; te Witt, R. Primers and Probes, Molecular Diagnostics: Part 1: Technical Backgrounds and Quality Aspects; Springer: Berlin/Heidelberg, Germany, 2019; pp. 51–95. [Google Scholar]
- Zhou, Q.; Liu, Y.; Wang, Z.; Wang, H.; Zhang, X.; Lu, Q. Rapid on-site detection of the Bursaphelenchus xylophilus using recombinase polymerase amplification combined with lateral flow dipstick that eliminates interference from primer-dependent artifacts. Front. Plant Sci. 2022, 13, 856109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase polymerase amplification for diagnostic applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valloly, P.; Roy, R. Nucleic acid quantification with amplicon yield in recombinase polymerase amplification. Anal. Chem. 2022, 94, 13897–13905. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Salcedo, R.; Miranda-Castro, R.; de los Santos-Álvarez, N.; Lobo-Castañón, M.J. On-Gold recombinase polymerase primer elongation for electrochemical detection of bacterial genome: Mechanism insights and influencing factors. ChemElectroChem 2019, 6, 793–800. [Google Scholar] [CrossRef] [Scilit]
- Armenante, P.M.; Akiti, O. Sterilization Processes in the Pharmaceutical Industry, Chemical Engineering in the Pharmaceutical Industry: Drug Product Design, Development, and Modeling; John Wiley & Sons Inc.: Hoboken, NJ, USA, 2019; pp. 311–379. [Google Scholar]
- McDonnell, G.E. Antisepsis, Disinfection, and Sterilization: Types, Action, and Resistance; John Wiley & Sons: Hoboken, NJ, USA, 2020. [Google Scholar]
- Koyama, K.; Hokunan, H.; Hasegawa, M.; Kawamura, S.; Koseki, S. Modeling stochastic variability in the numbers of surviving Salmonella enterica, enterohemorrhagic Escherichia coli, and Listeria monocytogenes cells at the single-cell level in a desiccated environment. Appl. Environ. Microbiol. 2017, 83, e02974-16. [Google Scholar] [CrossRef] [Scilit]
- Du, X.J.; Zhou, T.J.; Li, P.; Wang, S. A rapid Salmonella detection method involving thermophilic helicase-dependent amplification and a lateral flow assay. Mol. Cell. Probes. 2017, 34, 37–44. [Google Scholar] [CrossRef] [Scilit]
- Mei, X.; Zhai, X.; Lei, C.; Ye, X.; Kang, Z.; Wu, X.; Xiang, R.; Wang, Y.; Wang, H. Development and application of a visual loop-mediated isothermal amplification combined with lateral flow dipstick (LAMP-LFD) method for rapid detection of Salmonella strains in food samples. Food Control 2019, 104, 9–19. [Google Scholar] [CrossRef] [Scilit]
- Rani, A.; Dike, C.C.; Mantri, N.; Ball, A. Point-of-care lateral flow detection of viable Escherichia coli O157: H7 using an improved propidium monoazide-recombinase polymerase amplification method. Foods 2022, 11, 3207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moon, Y.J.; Lee, S.Y.; Oh, S.W. A review of isothermal amplification methods and food-origin inhibitors against detecting food-borne pathogens. Foods 2022, 11, 322. [Google Scholar] [CrossRef] [Scilit]
- Sidstedt, M.; Rådström, P.; Hedman, J. PCR inhibition in qPCR, dPCR and MPS—Mechanisms and solutions. Anal. Bioanal. Chem. 2020, 412, 2009–2023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santiago-Felipe, S.; Tortajada-Genaro, L.A.; Morais, S.; Puchades, R.; Maquieira, Á. Isothermal DNA amplification strategies for duplex microorganism detection. Food Chem. 2015, 174, 509–515. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Wang, J.; Sun, X.X.; Wang, J.; Chen, Z.; Xu, X.; Dong, M.; Guo, Y.N.; Wang, Y.; Chen, P.; et al. Development and evaluation of the rapid and sensitive RPA assays for specific detection of Salmonella spp. in food samples. Front. Cell. Infect. Microbiol. 2021, 11, 631921. [Google Scholar] [CrossRef] [Scilit]








| Methods | Oligoname | Sequence (5′–3′) | Reference |
|---|---|---|---|
| RPA | F-1 | CTATGTTCGTCATTCCATTACCTACCTATCTG | This study |
| R-1 | CAAGATAAGACGACTGGTACTGATCGATAATG | ||
| F-2 | GATATTGGTGTTTATGGGGTCGTTCTACATTG | ||
| R-2 | CTTCAATCAAGATAAGACGACTGGTACTGATC | ||
| F-3 | GATTGCACATAAAGATCTTGTCCTCCTTAC | ||
| R-3 | CTATCTGCTATCTCACCGAAAGATAAAACCTC | ||
| F-4 | CATTATCGATCAGTACCAGTCGTCTTATCTTG | ||
| R-4 | CTGAACCTTTGGTAATAACGATAAACTGGACC | ||
| F-5 | TAACAGGATACCTATAGTGCTGCTTTCTCTAC | ||
| R-5 | CAATGTAGAACGACCCCATAAACACCAATATC | ||
| NALF based on RPA | F | CTATGTTCGTCATTCCATTACCTACCTATCTG | |
| R | Biotin–CAAGATAAGACGACTGGTACTGATCGATAATG | ||
| Probe | 6–FAM-TTCTACATTGACAGAATCCTCAGTTTTTCA-/dSpacer/CGTTTCCTGCGGTAC–C3Spacer | ||
| Real-time PCR | F | GCGTTCTGAACCTTTGGTAA | [26] |
| R | CGTTCGGGCAATTCGTTA | ||
| Probe | 6–FAM–TGGCGGTGGGTTTTGTTGTCTTCT–TAMRA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.-Y.; Oh, S.-W. Point-of-Care Diagnostic System for Viable Salmonella Species via Improved Propidium Monoazide and Recombinase Polymerase Amplification Based Nucleic Acid Lateral Flow. Diagnostics 2024, 14, 831. https://doi.org/10.3390/diagnostics14080831
Lee S-Y, Oh S-W. Point-of-Care Diagnostic System for Viable Salmonella Species via Improved Propidium Monoazide and Recombinase Polymerase Amplification Based Nucleic Acid Lateral Flow. Diagnostics. 2024; 14(8):831. https://doi.org/10.3390/diagnostics14080831
Chicago/Turabian StyleLee, So-Young, and Se-Wook Oh. 2024. "Point-of-Care Diagnostic System for Viable Salmonella Species via Improved Propidium Monoazide and Recombinase Polymerase Amplification Based Nucleic Acid Lateral Flow" Diagnostics 14, no. 8: 831. https://doi.org/10.3390/diagnostics14080831
APA StyleLee, S.-Y., & Oh, S.-W. (2024). Point-of-Care Diagnostic System for Viable Salmonella Species via Improved Propidium Monoazide and Recombinase Polymerase Amplification Based Nucleic Acid Lateral Flow. Diagnostics, 14(8), 831. https://doi.org/10.3390/diagnostics14080831
