Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Plasmodium Isolates
2.2. Microscopic Technique
2.3. Reference Real-Time PCR
2.4. Vitassay qPCR Malaria 5 Test
2.5. Analysis of the Results
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Malaria Report 2021. Available online: https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2021 (accessed on 8 August 2022).
- Kendjo, E.; Houzé, S.; Mouri, O.; Taieb, A.; Gay, F.; Jauréguiberry, S.; Tantaoui, I.; Ndour, P.A.; Buffet, P.; Thellier, M.; et al. Epidemiologic trends in malaria incidence among travelers returning to metropolitan France, 1996–2016. JAMA Netw. Open 2019, 2, e191691. [Google Scholar] [CrossRef] [PubMed]
- Kamaliddin, C.; Le Bouar, M.; Berry, A.; Fenneteau, O.; Gillet, P.; Godineau, N.; Candolfi, E.; Houzé, S. Assessment of diagnostic methods for imported malaria in mainland France. Med. Mal. Infect. 2020, 50, 141–160. [Google Scholar] [CrossRef] [PubMed]
- Bamou, R.; Nematchoua-Weyou, Z.; Lontsi-Demano, M.; Ningahi, L.G.; Tchoumbou, M.A.; Defo-Talom, B.A.; Mayi, M.P.A.; Tchuinkam, T. Performance assessment of a widely used diagnostic test CareStart™ compared to microscopy for the detection of Plasmodium in asymptomatic patients in the Western region of Cameroon. Heliyon 2021, 7, e06271. [Google Scholar] [CrossRef] [PubMed]
- Larréché, S.; Rapp, C.; Delacour, H.; Sanmartin, N.; Ficko, C.; Bigaillon, C.; Andriamanantena, D.; Pilo, J.E.; Mérens, A. Sensitivity of parasitological tests in imported Plasmodium vivax malaria in adults and impact of chemoprophylaxis and attack type. J. Travel Med. 2014, 21, 195–200. [Google Scholar] [CrossRef] [PubMed]
- Gendrot, M.; Fawaz, R.; Dormoi, J.; Madamet, M.; Pradines, B. Genetic diversity and deletion of Plasmodium falciparum histidine-rich protein 2 and 3: A threat to diagnosis of P. falciparum malaria. Clin. Microbiol. Infect. 2019, 25, 580–585. [Google Scholar] [CrossRef]
- Wurtz, N.; Mint Lekweiry, K.; Bogreau, H.; Pradines, B.; Rogier, C.; Boukhary, A.O.M.S.; Hafid, J.E.; Salem, M.S.O.A.; Trape, J.F.; Basco, L.K.; et al. Vivax malaria in Mauritania includes infection of a Duffy-negative individual. Malar. J. 2011, 10, 336. [Google Scholar] [CrossRef][Green Version]
- Joste, V.; Bailly, J.; Hubert, V.; Pauc, C.; Gendrot, M.; Guillochon, E.; Madamet, M.; Thellier, M.; Kendjo, E.; Argy, N.; et al. Plasmodium ovale wallikeri and P. ovale curtisi infections and diagnostic approaches to imported malaria, France, 2013–2018. Emerg. Infect. Dis. 2021, 27, 372–384. [Google Scholar] [CrossRef]
- Ginouves, M.; Veron, V.; Musset, L.; Legrand, E.; Stefani, A.; Prevot, G.; Demar, M.; Djossou, F.; Brousse, P.; Nacher, M.; et al. Frequency and distribution of mixed Plasmodium falciparum-vivax infections in French Guiana between 2000 and 2008. Malar. J. 2015, 14, 446. [Google Scholar] [CrossRef]
- Pommier de Santi, V.; Girod, R.; Mura, M.; Dia, A.; Briolant, S.; Djoussou, F.; Dusfour, I.; Mendibil, A.; Simon, F.; Deparis, X.; et al. Epidemiological and entomological studies of a malaria outbreak among French armed forces deployed at illegal gold mining sites reveal new aspects of the disease’s transmission in French Guiana. Malar. J. 2016, 15, 35. [Google Scholar] [CrossRef]
- Khaireh, B.A.; Briolant, S.; Pascual, A.; Mokrane, M.; Machault, V.; Travaillé, C.; Khaireh, M.A.; Farah, I.H.; Ali, H.M.; Abdi, A.I.A.; et al. Plasmodium vivax and Plasmodium falciparum infections in the Republic of Djibouti: Evaluation of their prevalence and potential determinants. Malar. J. 2012, 11, 395. [Google Scholar] [CrossRef]
- Nema, S.; Singh, A.; Krishna, S.; Poriya, R.; Dubey, S.; Ali, N.A.; Singh, M.P.; Verma, A.K.; Das, A.; Bharti, P.K. Unreported mixed Plasmodium species infection may increase vivax malaria in India: A challenge for malaria elimination. Trans. R. Soc. Trop. Med. Hyg. 2022, 116, 600–603. [Google Scholar] [CrossRef] [PubMed]
- Manor, U.; Grossman, T.; Vainer, J.; Schwartz, E. A nationwide study of imported Plasmodium ovale and mixed infections to Israel 2008–2020. J. Travel Med. 2022, 29, taab192. [Google Scholar] [CrossRef] [PubMed]
- Epelboin, L.; Rapp, C.; Faucher, J.F.; Méchaï, F.; Bottieu, E.; Matheron, S.; Malvy, D.; Caumes, E. Management and treatment of uncomplicated imported malaria in adults. Update of the French malaria clinical guidelines. Med. Mal. Infect. 2020, 50, 194–212. [Google Scholar] [CrossRef] [PubMed]
- Bouchaud, O.; Bruneel, F.; Caumes, E.; Houzé, S.; Imbert, P.; Pradines, B.; Rapp, C.; Strady, C. Management and prevention of imported malaria. 2018 update of the 2007 French clinical guidelines. Med. Mal. Infect. 2020, 50, 161–193. [Google Scholar] [CrossRef] [PubMed]
- Pradines, B. Antimalarial drug resistance: Clinical prospectives. In Antimicrobial Drug Resistance; Ouellette, M., Ed.; Springer: Berlin/Heidelberg, Germany, 2017; pp. 1245–1275. [Google Scholar]
- Mahittikorn, A.; Masangkay, F.R.; Kotepui, K.U.; Milanez, G.J.; Kotepui, M. The high risk of malaria recurrence in patients with Plasmodium-mixed infection after treatment with antimalarial drugs: A systematic review and meta-analysis. Parasit. Vectors 2021, 14, 280. [Google Scholar] [CrossRef]
- Kotepui, M.; Kotepui, K.U.; Milanez, G.J.; Masangkay, F.R. Plasmodium spp. mixed infection leading to severe malaria: A systematic review and meta-analysis. Sci. Rep. 2020, 10, 11068. [Google Scholar] [CrossRef]
- de Laval, F.; Simon, F.; Bogreau, H.; Rapp, C.; Wurtz, N.; Oliver, M.; Demaison, X.; Dia, A.; de Pina, J.J.; Merens, A.; et al. Emergence of Plasmodium ovale malaria among the French Armed Forces in the Republic of Ivory Coast: 20 years of clinical and biological experience. Clin. Infect. Dis. 2014, 58, e122–e128. [Google Scholar] [CrossRef]
- Manego, R.Z.; Mombo-Ngoma, G.; Witte, M.; Held, J.; Gmeiner, M.; Gebru, T.; Tazemda, B.; Mischlinger, J.; Groger, M.; Adegnika, A.A.; et al. Demography, maternal health and the epidemiology of malaria and other major infectious diseases in the rural department Tsamba-Magotsi, Ngounie Province, in central African Gabon. BMC Public Health 2017, 17, 130. [Google Scholar] [CrossRef]
- Roucher, C.; Rogier, C.; Sokhna, C.; Tall, A.; Trape, J.F. A 20-year longitudinal study of Plasmodium ovale and Plasmodium malariae prevalence and morbidity in a West African population. PLoS ONE 2014, 9, e87169. [Google Scholar] [CrossRef]
- Velut, G.; Dia, A.; Briolant, S.; Javelle, E.; Pommier de Santi, V.; Berger, F.; Savini, H.; Simon, F.; Michel, R.; Pradines, B. Le paludisme: Toujours d’actualité dans les armées françaises. Med. Armées 2018, 46, 13–26. [Google Scholar]
- Charpentier, E.; Benichou, E.; Pagès, A.; Chauvin, P.; Fillaux, J.; Valentin, A.; Guegan, H.; Guemas, E.; Salabert, A.S.; Armengol, C.; et al. Performance evaluation of different strategies based on microscopy techniques, rapid diagnostic test and molecular loop-mediated isothermal amplification assay for the diagnosis of imported malaria. Clin. Microbiol. Infect. 2020, 26, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Berry, A.; Benoit-Vical, F.; Fabre, R.; Cassaing, S.; Magnaval, J.F. PCR-based methods to the diagnosis of imported malaria. Parasite 2008, 15, 484–488. [Google Scholar] [CrossRef] [PubMed][Green Version]

| P. falciparum | P. vivax | P. ovale | P. malariae | P. falciparum P. ovale | P. falciparum P. malariae | P. falciparum P. ovale P. malariae | Negative | Total | |
|---|---|---|---|---|---|---|---|---|---|
| Selected samples | 62 | 3 | 9 | 9 | 3 | 2 | 0 | 2 | 90 |
| Other samples | 85 | 2 | 7 | 2 | 0 | 2 | 1 | 1 | 100 |
| Total | 147 | 5 | 16 | 11 | 3 | 4 | 1 | 3 | 190 |
| Plasmodium Species | Access Number Genes | Probe or Primer Name | Primer Sequence |
|---|---|---|---|
| P. falciparum | Aquaglyceroporine (AJ413249) | Probe Pf | FAM-5′ TACACTACCAACACATGGGGCTCAAGAGGT 3′- BHQ1 |
| P falciparum F | 5′ TTTATGTATTGGTATAACATTCGG 3′ | ||
| P falciparum R | 5′ GGCAAATAACTTTATCATAGAATTGAC 3′ | ||
| P. vivax | Enoyl-acyl carrier protein reductase (AY423071) | Probe Pv | HEX-5′ CATCTACGTGGACAACGGGCTCAACA 3′-BHQ1 |
| P vivax F | 5′ GTGGCCGCCTTTTTGCT 3′ | ||
| P vivax R | 5′CCTCCCTGAAACAAGTCATCG 3′ | ||
| P. ovale | Circumsporozoïte (S69014) | Probe Po | HEX- 5′ ATTTTTTGCATCAACCTTTCTTCTAGCCC 3′-BHQ1 |
| P ovale F | 5′ GGAGGAATGGTCACCATGTAGTGT 3′ | ||
| P ovale R | 5′ CAAATTTCAGTTTCAAGGTCACTTAA 3′ | ||
| P. malariae | Ookinete surface protein 25 (AB074976) | Probe Pm | FAM-5′ TTATTGTCCTCTGGGTTTGGAACTTTGCC 3′- BHQ1 |
| P malariae F | 5′ CCAAGCCCAGATAATAAGGAAGGT 3′ | ||
| P malariae R | 5′ TTCGTGCACTTCAACTTACATTCAGT 3′ |
| Vitassay | Homemade Real-Time PCR | |||||
|---|---|---|---|---|---|---|
| P. falciparum | P. vivax | P. ovale | P. malariae | Negative | Total | |
| Positive | 153 + 1 a | 5 | 20 + 1 c | 15 | 0 | 195 |
| Negative | 1 b | 0 | 0 | 1 c | 3 | 5 |
| Total | 155 | 5 | 21 | 16 | 3 | 200 |
| Plasmodium Species | Sensitivity a Vitassay qPCR Malaria 5 | Specificity b Vitassay qPCR Malaria 5 |
|---|---|---|
| P. falciparum | 99.35% | 97.72% |
| P. vivax | 100% | 100% |
| P. ovale | 100% | 99.44% |
| P. malariae | 93.75% | 100% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Madamet, M.; Amalvict, R.; Benoit, N.; French National Reference Centre for Imported Malaria Study Group; Pradines, B. Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France. Diagnostics 2022, 12, 2747. https://doi.org/10.3390/diagnostics12112747
Madamet M, Amalvict R, Benoit N, French National Reference Centre for Imported Malaria Study Group, Pradines B. Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France. Diagnostics. 2022; 12(11):2747. https://doi.org/10.3390/diagnostics12112747
Chicago/Turabian StyleMadamet, Marylin, Rémy Amalvict, Nicolas Benoit, French National Reference Centre for Imported Malaria Study Group, and Bruno Pradines. 2022. "Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France" Diagnostics 12, no. 11: 2747. https://doi.org/10.3390/diagnostics12112747
APA StyleMadamet, M., Amalvict, R., Benoit, N., French National Reference Centre for Imported Malaria Study Group, & Pradines, B. (2022). Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France. Diagnostics, 12(11), 2747. https://doi.org/10.3390/diagnostics12112747

