Morphological and Molecular Characterization of a New Section and Two New Species of Alternaria from Iran
by
, ,
Abdollah Ahmadpour
1,*
,
Youbert Ghosta
2
,
Zahra Alavi
2,
Fatemeh Alavi
2,
Leila Mohammadi Hamidi
2 and
Pabulo Henrique Rampelotto
3,*
1
Higher Education Center of Shahid Bakeri, Urmia University, Miyandoab 59781-59111, Iran
2
Department of Plant Protection, Faculty of Agriculture, Urmia University, Urmia 57561-51818, Iran
3
Bioinformatics and Biostatistics Core Facility, Institute of Basic Health Sciences, Federal University of Rio Grande do Sul, Porto Alegre 91501-970, Brazil
*
Authors to whom correspondence should be addressed.
Life 2025, 15(6), 870; https://doi.org/10.3390/life15060870
Submission received: 12 April 2025
/
Revised: 17 May 2025
/
Accepted: 26 May 2025
/
Published: 28 May 2025
(This article belongs to the Collection Isolation and Characterization of New Microbial Species and Strains)
Abstract
:Alternaria is a large genus of fungi comprising approximately 400 species, currently classified into 29 sections. These fungi exhibit a cosmopolitan distribution, thriving in both natural and human-impacted environments with saprophytic, endophytic, and parasitic lifestyles. As part of our ongoing studies on fungi associated with wetland plants in the families Cyperaceae and Juncaceae across various regions of Iran, we isolated 21 fungal strains displaying morphological traits of Alternaria. Multigene phylogenetic analysis and morphological examination of eight selected strains confirmed their placement within Alternaria with strong support. These isolates formed a basal clade distinct from the 29 previously recognized sections and six monotypic lineages, leading to the establishment of a new section, Alternaria section Iraniana, to accommodate them. Furthermore, two monophyletic lineages within this section were identified, representing two new species, A. avrinica and A. iraniana, which are described and illustrated in this study. The new section is distinguished by long, semi-macronematous to macronematous conidiophores with multiple geniculate and sympodial proliferations, as well as solitary, non-beaked conidia that have only transverse eu-septa to pseudo-septa. The newly described species are differentiated based on conidiophore and conidial characteristics and nucleotide sequence comparisons of genomic regions. These results contribute to a better understanding of the distribution and host range of Alternaria species, while highlighting the importance of ongoing research into fungal taxonomy and biodiversity in Iran, a region rich in potential for the discovery of new fungal species.
1. Introduction
The fungal genus Alternaria was established by Nees in 1816 on a single species, A. tenuis [1]. Nees originally described Alternaria as “erect, scattered, dark hyphae with separate three to four oval articulations, united by filiform connections”. However, this description lacked clarity and completeness, which complicated accurate species identification. Despite these limitations, Nees’s account is now considered sufficiently detailed to be recognized as referring to Alternaria [2,3]. In 1832, Fries introduced Torula alternata in Systema Mycologicum, without recognizing Alternaria as a distinct genus, and instead, listed A. tenuis Nees as a synonym of T. alternata [4]. Concurrently, Fries established the genus Macrosporium, which is morphologically similar to Alternaria [5]. The taxonomy of this group of phaeodictyosporic hyphomycetes became even more complex with the later descriptions of two additional genera, Stemphylium Wallroth (1833) and Ulocladium Preuss (1851) [6,7,8]. Von Keissler re-evaluated the descriptions of A. tenuis Nees and T. alternata Fr. and synonymized them under A. alternata, which is now recognized as the type species of Alternaria [9]. Although mycelium, conidiophores, and conidia served as diagnostic traits among these genera, differentiation primarily relied on conidial morphology. In an effort to revise the taxonomy and nomenclature of Alternaria and Macrosporium, the two genera were treated as separate, the generic concept of Alternaria was refined, and six morphological groups were proposed based on spore features [2]. The representative species of Alternaria and Macrosporium were later examined to clarify their classification [4]. It was concluded that Alternaria and Macrosporium are congeneric, and Macrosporium was discarded as a nomen ambiguum in favor of Alternaria.
Given the extensive morphological diversity within Alternaria and its related genera, efforts were made to classify the genus into subgeneric groups. Neergaard categorized Alternaria species in Denmark into three sections based on conidial catenulation, each typified by a species [10]. Species within each section were identified using conidial characteristics such as shape, size, color, surface ornamentation, and beak morphology. This classification led to the identification of 16 species, two varieties, and a few special forms. Similarly, Joly classified Alternaria species into three sections based on conidia color, rigidity, and lateral symmetry [11]. Simmons redefined the generic concepts of Alternaria, Stemphylium, and Ulocladium by examining authenticated specimens and emphasizing sporulation patterns, juvenile and mature conidial shapes, and modes of conidiophores and conidia proliferation [3]. Alternaria alternata (Fries) Keissler was formally designated as the type species of Alternaria. Ellis provided detailed descriptions and illustrations for 44 Alternaria taxa [12,13]. Subsequent studies expanded the number of species to approximately 70 [14,15,16,17,18,19]. Simmons introduced a species-group system based on conidial characteristics, the patterns of chain formation, and the nature of apical extensions of conidial cells, defining 14 species-groups [20]. Further species-groups were later described [21,22,23]. However, molecular phylogenetic studies reveal that many Alternaria species clades do not fully correspond with species-groups established based on morphology [8,22,23,24,25,26,27]. Lawrence et al. elevated species-groups to the taxonomic rank of section and established eight sections within the Alternaria complex, each typified by a type species [7]. However, the A. infectoria species-group was not granted section status. Woudenberg et al. redefined Alternaria using a combination of multi-gene phylogenetic analysis and morphological characteristics, emended its generic circumscription, added 16 new sections, identified six monotypic lineages, and synonymized 13 sexual and asexual generic names (Allewia, Brachycladium, Chalastospora, Chmelia, Crivellia, Embellisia, Lewia, Nimbya, Sinomyces, Teretispora, Ulocladium, Undifilum, and Ybotromyces) under Alternaria [8]. Subsequent studies added five more sections, bringing the total number of sections to 29 [28,29,30,31,32].
As part of our ongoing studies of fungi from various wetland plants in different regions of Iran, we isolated and purified 21 fungal strains with morphological characteristics similar to those of the genus Alternaria. Following a thorough morphological examination, eight strains were selected for further study using multi-gene phylogenetic analyses. The results indicate that these isolates represent a new basal section within the Alternaria complex, forming two monophyletic lineages and representing two new species. This study aims to introduce and describe the newly identified section, Alternaria section Iraniana, along with two new species: Alternaria avrinica and A. iraniana. Detailed morphological descriptions and illustrations are provided, along with a discussion of their phylogenetic relationships within the Alternaria complex.
2. Materials and Methods
2.1. Fungal Isolates
Leaf and culm samples exhibiting brown lesions and blight symptoms were collected from various wetland plants belonging to the families of Cyperaceae and Juncaceae across three provinces in Iran, Guilan, West Azarbaijan, and Zanjan, between 2019 and 2021. The samples were labeled, stored at low temperatures, and transported to the laboratory. Fungal isolation and purification followed the method described by Ahmadpour et al. [33]. The isolated fungal strains were preserved on Potato Dextrose Agar (PDA; 39 g/L, Merck, Darmstadt, Germany) slants at 4 °C and on sterile filter paper segments at –20 °C. All purified isolates were deposited in the fungal culture collections of the Iranian Research Institute of Plant Protection (IRAN) and Urmia University (FCCUU).
2.2. Morphological Characterization
For morphological characterization, purified isolates were cultured on Potato Carrot Agar (PCA) and incubated at 23–25 °C under Cool White fluorescent light, following an 8/16 h light/dark cycle for 5–7 days without humidity control [34,35]. Appropriate slide mounts were prepared using lactophenol, and microscopic features of the hyphae, conidiophores, and conidia were examined using an Olympus AX70 compound microscope with differential interference contrast (DIC) illumination (Olympus Optical CO., Ltd., Tokyo, Japan). Thirty to fifty structures of each type were measured, and microphotographs were captured from slide mounts and edited using Adobe Photoshop 2020 v. 2.10.8 software (Adobe Inc., San Jose, CA, USA). Colony morphology was assessed on PDA, PCA, and V-8A (comprising 175 mL of commercial V8 vegetable juice, 3 g CaCO3, 20 g agar, and 1000 mL distilled water) media after a 7-day incubation at 25 °C in the dark. Colony colors were identified using Rayner’s color charts [36]. Newly described taxa were registered in MycoBank [37].
2.3. DNA Extraction and PCR Amplification
Genomic DNA was extracted from fresh fungal mycelium scraped from 10-day-old PDA cultures using a standard sodium dodecyl sulfate (SDS) lysis buffer. The procedure included chloroform extraction and isopropanol precipitation [38]. Amplification targeted the small subunit rRNA (SSU), internal transcribed spacer (ITS-rDNA), large subunit rRNA (LSU), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), RNA polymerase II largest subunit (RPB2), and translation elongation factor 1-alpha (TEF1) genes, using the primer pairs listed in Table 1. PCR conditions and reaction mixtures followed by Ahmadpour et al. [33,39]. Amplicons were analyzed on a 1% agarose gel stained with FluoroVueTM Nucleic Acid Gel Stain (SMOBIO Technology Inc., Hsinchu, Taiwan), and fragment sizes were compared against a FluoroBandTM 100 bp+3K Fluorescent DNA Ladder (SMOBIO Technology Inc., Hsinchu, Taiwan). PCR products were cleaned and sequenced by Macrogen Corp. (Seoul, South Korea) using the same primers as in PCR amplification. The resulting sequences were submitted to GenBank (Table 2).
2.4. Sequence Alignment and Phylogenetic Analyses
The generated sequences were processed and trimmed using MEGA 6.0 before being exported as FASTA files for further analysis [45]. Corresponding sequences from type or representative Alternaria strains were retrieved from the GenBank database and incorporated into phylogenetic analyses (Table 2) [7,8,23,27,28,29,30,31,32,36,46,47]. Multiple sequence alignments for each locus were performed using the MAFFT version 7 online tool (https://mafft.cbrc.jp/alignment/server/; accessed on 20 February 2025) [48], with additional manual refinements in MEGA 6.0 as needed. Concatenated multi-gene datasets were assembled using Mesquite v. 3.61 [49]. Two separate multi-locus phylogenetic analyses were conducted: (1) incorporating 167 representative strains from five families in the suborder Pleosporineae, using five gene sequences (SSU, ITS, LSU, GAPDH, and RPB2) to determine the placement of the studied isolates, and (2) incorporating 110 representative strains from 29 Alternaria sections and six monotypic lineages, using six gene sequences (SSU, ITS, LSU, GAPDH, RPB2, and TEF1), to resolve the placement of strains within the Alternaria complex. Bayesian inference (BI) analysis was performed in MrBayes v. 3.2.7 [50] using the Markov Chain Monte Carlo method with four chains, one-million generations, and a heated chain temperature of 0.1. Trees were sampled every 1000 generations, with a 25% burn-in, and posterior probabilities were calculated from the remaining trees. Convergence was confirmed when the average standard deviation of split frequencies dropped below 0.01. The best-fit evolutionary models for BI were determined using MrModeltest 2.3 [51] and the Akaike Information Criterion (AIC) (Table 3). Maximum-likelihood (ML) analysis was conducted using RAxML-HPC BlackBox v. 8.2.12 [52] via the CIPRES Science Gateway version 3.3 (accessible at https://www.phylo.org/; accessed on 20 February 2025) [53], applying the GTRGAMMA+I substitution model. Maximum Parsimony (MP) analysis was performed in PAUP v. 4.0b10 [54], using a heuristic search with 1000 random sequence additions and tree-bisection-reconnection (TBR) branch swapping while treating gaps as missing data. Bootstrap support values were estimated from 1000 replicates, and tree statistics—including Tree Length (TL), Consistency Index (CI), Retention Index (RI), and Homoplasy Index (HI)—were calculated for the MP analysis. Outgroup taxa consisted of Halojulella avicenniae (BCC 18422) for the first analysis, and Stemphylium botryosum (CBS 714.68) and S. vesicarium (CBS 191.86) for the second analysis. The final phylogenetic trees were visualized using FigTree v. 1.4.4 [55].
3. Results
3.1. Phylogenetic Analyses
The results of the first phylogenetic analysis, which included 167 representative strains from five families in the suborder Pleosporineae, are presented in Figure 1. The eight studied strains were placed within the large Alternaria clade with strong support (ML/MP/BI = 100/100/1), confirming their identities as Alternaria. The concatenated matrix, which used SSU, ITS, LSU, GAPDH, and RPB2 sequences, contained a total of 4050 characters, including gaps (1373 SSU, 437 for ITS, 689 LSU, 534 for GAPDH, and 837 for RPB2). Of these, 2807 were constant sites, 1243 were variable sites, 292 were parsimony-uninformative sites, and 951 were parsimony-informative sites (Table 3). The most parsimonious tree yielded the following metrics: TL = 8516, CI = 0.241, RI = 0.686, HI = 0.759. The results of the second phylogenetic analysis, which included 110 representative strains from 29 Alternaria sections and 6 monotypic lineages, are presented in Figure 2. The studied isolates formed a distinct subclade at the base of the large Alternaria clade and comprised two monophyletic lineages, representing two different species. The concatenated matrix, which used SSU, ITS, LSU, GAPDH, RPB2, and TEF1 sequences, contained a total of 4003 characters including gaps (1022 for SSU, 457 for ITS, 851 for LSU, 557 for GAPDH, 799 for RPB2, and 317 for TEF1). Of these, 3105 were constant sites, 898 were variable sites, 121 were parsimony-uninformative sites, and 777 were parsimony-informative sites (Table 3). The most parsimonious tree yielded the following metrics: TL = 4299, CI = 0.329, RI = 0.728, HI = 0.671. The topologies of individual gene trees were consistent, with no conflicts observed in species delimitation. The best-scoring RAxML trees are shown in Figure 1 and Figure 2. A summary of phylogenetic information and substitution models for each dataset is provided in Table 3. Based on the phylogenetic results and morphological characteristics, a new section, Alternaria section Iraniana, and two new species, A. avrinica and A. iraniana (the type species of the new section), are introduced and described.
3.2. Taxonomy
A total of 21 fungal isolates were obtained from various plants in the families Cyperaceae and Juncaceae. All isolates were examined morphologically, and eight representative isolates from different plant hosts were selected for phylogenetic analyses. Based on phylogenetic and morphological analyses, the studied isolates were assigned to a new section, designated here as Alternaria section Iraniana, which includes two new species: A. avrinica and A. iraniana. Detailed morphological descriptions and illustrations of the new taxa are provided, along with a discussion of their phylogenetic relationships with other species in the Alternaria sections.
3.2.1. Section Iraniana A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi & L. Mohammadi, sect. nov.
MycoBank No. MB 858618
Type species. Alternaria iraniana A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi & L. Mohammadi
Diagnosis. Members of Alternaria section Iraniana are characterized by long, simple, semi-macronematous to macronematous conidiophores with multiple geniculate, sympodial proliferation and mono- to polytretic conidiogenous loci. Conidia are solitary, ellipsoidal to cylindrical, non-beaked, and contain only transverse eu- or pseudo-septa. Apical cells in some conidia germinate with the production of a secondary conidiophore, bearing solitary conidia, while they are attached to primary conidiophores. Sexual morph was not observed. This section is associated with plants in the families Cyperaceae and Juncaceae.
3.2.2. Alternaria avrinica A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi & L. Mohammadi, sp. nov. (Figure 3)
MycoBank No. MB 858619
Etymology. The name refers to Avrin Mountain, located in Khoy County, West Azarbaijan province, where the holotype was collected.
Diagnosis: Differs from A. iraniana by the size of primary conidiophores, conidia, and absence of secondary conidiophores.
Typification. Iran, West Azarbaijan province, Khoy County, Avrin Mountain, isolated from the culms of Juncus sp. (Juncaceae, Poales), 20 September 2021, A. Ahmadpour (holotype IRAN 18204F, ex-type culture IRAN 4772C).
Description. Asexual morph on PCA medium: Hyphae 2–4 μm wide, pale brown to brown, smooth, septate, branched. Conidiophores (32–)47–187(–250) × 4–5 µm ( = 118 × 4.5 μm, n = 50), mononematous, semi-macronematous to macronematous, unbranched, straight to flexuous, septate, geniculate, brown to dark brown, paler towards the apex, rarely swollen at the base. Conidiogenous cells mono- to polytretic, sympodial proliferation, integrated, terminal or intercalary, subcylindrical to slightly swollen, pale brown to brown, smooth-walled, with thickened and darkened scars. Conidia (9–)12–30(–35) × 5–7 µm ( = 23 × 6 μm, n = 50), solitary, pale brown to brown, smooth-walled, straight, ellipsoidal to cylindrical, tapering towards rounded ends, without beak, 1–5 transverse septate, (of which 1–4 (mostly 3) are eu-septate and 1–2 disto-septate), without longitudinal and oblique septa; hila 1–2 μm wide, inconspicuous, flat, thickened, and darkened. Sexual morph and chlamydospores were not observed.
Figure 3.
Alternaria avrinica (IRAN 4772C). (a,b) Host (Juncus sp.); (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f) Sporulation pattern on PCA (40×); (g–m) Conidiophores and conidia. Scale bars: (g–m) = 10 μm.
Figure 3.
Alternaria avrinica (IRAN 4772C). (a,b) Host (Juncus sp.); (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f) Sporulation pattern on PCA (40×); (g–m) Conidiophores and conidia. Scale bars: (g–m) = 10 μm.
Culture characteristics. Colony on PCA 42 mm diam., after 7 days at 25 °C, flat, entire, circular, margin regular, olivaceous grey, with white to grey aerial mycelia; reverse olivaceous grey. Colony on PDA 39 mm diam., flat, entire, circular, margin regular, cottony appearance, with white to grey aerial mycelia; reverse grey. Colony on V-8A 26 mm diam., flat, entire, circular, margin entire, hairy appearance, grey, with sparse white to grey aerial mycelia; reverse grey at the center and hyaline at the margin. Sporulation abundant on PCA, and V-8A media, from the erect conidiophores that arise directly from the surface or the aerial hyphae.
Additional specimens examined. Iran, West Azarbaijan province, Khoy County, Avrin Mountain, on infected culms of Juncus sp., 20 September 2021, A. Ahmadpour (culture IRAN 5031C). Iran, Zanjan province, Tarom County, Gilvan city, on infected leaves and culms of Carex sp. (Cyperaceae, Poales), 11 September 2022, A. Ahmadpour (culture FCCUU 1419). —ibid. on infected culms of Juncus sp., 11 September 2022, A. Ahmadpour (culture FCCUU 1420).
Notes. Alternaria avrinica is morphologically similar and phylogenetically closely related to A. iraniana, A. papavericola, and A. penicillata. This species can be differentiated from A. iraniana by its larger conidia (9–35 × 5–7 vs. 10–32 × 4–6 μm), shorter primary conidiophores (32–250 vs. 50–337 μm), and the absence of secondary conidiophores; from A. papavericola by longer conidiophores (32–250 vs. 20–130 μm), smaller conidia (9–35 × 5–7 vs. 40–70 × 6–8 μm), fewer transverse septa (1–5 vs. 3–8), and absence of chlamydospores and ascomata (melanized chlamydospore-like thick-walled cells are commonly formed in A. papavericola); and from A. penicillata by longer conidiophores (32–250 vs. 30–60 μm), and the absence of microsclerotia and ascomata [56]. A comparison of nucleotide differences in SSU, ITS, LSU, GAPDH, RPB2, and TEF1 indicates that A. avrinica type strain (IRAN 4772C) differs from A. iraniana type strain (IRAN 5030C) by 6/513 bp (1.16%, with 3 gaps (0%)) in ITS, 3/810 bp (0.37%) in LSU, 13/567 bp (2.29%, with 4 gaps (0%)) in GAPDH, 28/762 bp (3.67%) in RPB2 and 5/183 bp (2.73%) in TEF1, from A. papavericola type strain (CBS 116606) by 2/807 bp (0.24%, with one gap (0%)) in SSU, 27/515 bp (5.24%, with 8 gaps (1%)) in ITS, 3/833 bp (0.36%) in LSU, 61/557 bp (10.95%, with 10 gaps (1%)) in GAPDH, 63/793 bp (7.94%) in RPB2 and 23/179 bp (12.84%, with 3 gaps (1%)) in TEF1 and from A. penicillata type strain (CBS 116608) by 2/807 bp (0.24%, with one gap (0%)) in SSU, 32/515 bp (6.21%, with 7 gaps (1%)) in ITS, 3/833 bp (0.36%) in LSU, 65/559 bp (11.62%, with 16 gaps (2%)) in GAPDH, 68/793 bp (8.57%) in RPB2 and 17/179 bp (9.49%, with 3 gaps (1%)) in TEF1.
3.2.3. Alternaria iraniana A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi & L. Mohammadi, sp. nov. (Figure 4)
MycoBank No: MB 858620
Etymology. Named after the country “Iran”, where the holotype was collected.
Typification. Iran, Guilan province, Asalem County, isolated from the culms of Juncus sp. (Juncaceae, Poales), 9 September 2022, A. Ahmadpour (holotype IRAN 18473F, ex-type culture IRAN 5030C).
Description. Asexual morph on PCA medium: Hyphae 2–4 μm wide, pale brown to brown, smooth, septate, branched. Conidiophores (50–)75–250(–337) × 4–5 µm ( = 150 × 4.5 μm, n = 50), mononematous, semi-macronematous to macronematous, unbranched, straight to flexuous, septate, geniculate, brown to dark brown, paler towards the apex. Conidiogenous cells mono- to polytretic, sympodial proliferation, integrated, terminal or intercalary, subcylindrical to slightly swollen, pale brown to brown, smooth-walled, with thickened and darkened scars. Apical cells in some conidia germinate with the production of a secondary conidiophore, resembling primary conidiophores in size and geniculations, bearing solitary conidia, while they are attached to primary conidiophores. Conidia (10–)13–29(–32) × 4–6 µm ( = 20 × 5 μm, n = 50), solitary, pale brown to brown, smooth-walled, straight, ellipsoidal to cylindrical, 1–4 transverse septa, (of which 1–3 (mostly 3) are eu-septate and 1–3 disto-septate), without longitudinal and oblique septa; hila 1–2 μm wide, inconspicuous, flat, thickened, and darkened. Sexual morph and chlamydospores were not observed.
Figure 4.
Alternaria iraniana (IRAN 5030C). (a,b) Host (Juncus sp.); (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f,g) Sporulation pattern on PCA (f = 10×, g = 40×); (h–p) Conidiophores and conidia. Scale bars: (h–p) = 10 μm.
Figure 4.
Alternaria iraniana (IRAN 5030C). (a,b) Host (Juncus sp.); (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f,g) Sporulation pattern on PCA (f = 10×, g = 40×); (h–p) Conidiophores and conidia. Scale bars: (h–p) = 10 μm.
Culture characteristics. Colony on PCA 50 mm diam., after 7 days at 25 °C, flat, entire, circular, margin regular, grey with white to grey aerial mycelia; reverse grey. Colony on PDA 46 mm diam., flat, entire, circular, margin regular, velvety, with white to grey aerial mycelia; reverse pale brown at the center to grey at the margin. Colony on V-8A 22 mm diam., flat, entire, circular, margin entire, hairy appearance, grey with sparse white to grey aerial mycelia; reverse grey at the center and hyaline at the margin. Sporulation abundant on PCA, and V-8A media, from the erect conidiophores that arise directly from the surface or the aerial hyphae.
Additional specimens examined. Iran, Guilan province, Asalem County, isolated from the culms of Juncus sp. (Juncaceae, Poales), 9 September 2022, A. Ahmadpour (cultures FCCUU 1421, FCCUU 1422, FCCUU 1423).
Notes. Alternaria iraniana is morphologically similar and phylogenetically closely related to A. avrinica, A. papavericola, and A. penicillata. This species can be differentiated from A. avrinica by its smaller conidia (10–32 × 4–6 vs. 9–35 × 5–7 μm), longer primary conidiophores (50–337 vs. 32–250 μm), and the presence of secondary conidiophores; from A. papavericola by longer conidiophores (50–337 vs. 20–130 μm), smaller conidia (10–32 × 4–6 vs. 40–70 × 6–8 μm), fewer transverse septa (1–4 vs. 3–8); and from A. penicillata by longer conidiophores (50–337 vs. 30–60 μm), smaller conidia (10–32 × 4–6 vs. 17–35 × 5–7) and the absence of microsclerotia and ascomata [56]. Comparisons of nucleotide differences in A. iraniana are provided in the notes section for A. avrinica. A comparison of nucleotide differences in ITS, LSU, GAPDH, RPB2, and TEF1 indicates that A. iraniana type strain (IRAN 5030C) differs from A. papavericola type strain (CBS 116606) by 29/545 bp (5.32%, with 6 gaps (1%)) in ITS, 2/826 bp (0.24%) in LSU, 66/560 bp (11.78%, with 14 gaps (2%)) in GAPDH, 64/829 bp (7.72%, with 1 gaps (0%)) in RPB2 and 33/221 bp (14.93%, with 5 gaps (2%)) in TEF1 and from A. penicillata type strain (CBS 116608) by 31/515 bp (5.67%, with 6 gaps (1%)) in ITS, 2/826 bp (0.14%) in LSU, 59/558 bp (10.57%, with 8 gaps (1%)) in GAPDH, 68/829 bp (8.20%, with 1 gaps (0%)) in RPB2 and 27/221 bp (12.21%, with 5 gaps (2%)) in TEF1.
4. Discussion
Alternaria (Pleosporaceae, Pleosporales, Dothideomycetes, Ascomycota) is a widely distributed fungal genus found in diverse habitats and substrates, including agricultural products, animals, the atmosphere, food and feed commodities, indoor environments, plants, and soil [8,57,58,59]. According to the Index Fungorum database (https://www.indexfungorum.org/; accessed 29 March 2025), 861 species epithets have been recorded, although only approximately 400 species have been formally described [33,39,60,61,62,63,64,65]. Many species in this genus are plant pathogens, responsible for destructive diseases in more than 400 plant species, and some act as post-harvest pathogens, contributing to losses of horticultural products [66,67,68,69]. Additionally, some Alternaria species are opportunistic pathogens in animals and humans or serve as airborne allergens. They are also well-known for producing toxic secondary metabolites, including mycotoxins and host-specific toxins, which pose serious food safety risks when contaminating food and feed [70,71,72,73,74,75,76,77]. Accurate species identification is essential in both fundamental and applied fungal research, aiding in the understanding of fungal biology, biodiversity, evolution, and ecological impact [56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81]. Traditionally, species identification has relied on morphological characteristics of asexual/sexual morphs, with host relationships being a secondary factor [20,35,82,83,84]. However, phylogenetic studies demonstrate that these morphological classifications do not always reflect true evolutionary relationships [28,46,85]. Currently, species delimitation is based on multi-locus sequence analysis combined with morphological characteristics; however, various gene combinations are used for species identification, depending on the specific sections of Alternaria [8,32,69,86,87]. These advances have refined Alternaria taxonomy, clarified species boundaries, and facilitated the regular description of new species.
Cyperaceae and Juncaceae are two families of graminoid, monocotyledonous flowering plants that dominate wetland ecosystems. They provide essential ecological functions, such as habitat and food for wildlife, nutrient cycling, and water purification. In addition, they have various traditional applications in cosmetics, medicine, perfumery, and handicrafts. However, they are also considered invasive weeds that compete with crop plants and harbor diverse fungal communities [88,89,90,91,92,93,94]. Identifying and characterizing fungi associated with these plants is of primary relevance for understanding their impact on host health, host range, and potential for disease management, biocontrol applications, and biotechnology. In our study on fungi associated with plants in families Cyperaceae and Juncaceae, 21 strains resembling the genus Alternaria were isolated and purified. These strains exhibited simple, elongated, geniculately proliferating conidiophores, and solitary beakless conidia with only transverse septa, both eu-septa and distosepta. The morphological characteristics of conidiophores, especially successive geniculations with porospores and the formation of solitary conidia at each condiogenous locus, are somewhat similar to those of Pleosporaceae genera (Bipolaris, Curvularia, Exserohilum, Johnalcornia, and Pyrenophora). However, the conidial shape and the formation of transverse eu-septa distinguish the new species from those of other Pleosporaceae genera [95,96,97]. Multi-gene phylogenetic analysis confirmed that the studied strains form a well-supported monophyletic clade within Alternaria (Figure 1 and Figure 2), positioned as a basal clade relative to other Alternaria sections and monotypic lineages. Based on these findings, we propose a new section, Iraniana. The topology of our phylogenetic tree aligns with those of Lawrence et al. [8] and Li et al. [59]. The closest related section, Crivellia, includes two species, A. penicillata, and A. papavericola, isolated from Papaver spp. (Papaveraceae) [56]. While species in both sections share similar conidial morphology and septation patterns, members of section Iraniana lack microsclerotia/chlamydospore formation and sexual morphs (pseudothecia), which are observed in section Crivellia. Within section Iraniana, two species were identified and differentiated based on morphological characteristics and nucleotide sequence comparisons. In our previous studies, we identified 13 species of Alternaria within section Nimbya [33,38,39]. The present study further highlights that plants in the families of Cyperaceae and Juncaceae serve as primary hosts of previously undescribed Alternaria species. Additional research is required to explore their full diversity in wetlands, assess the pathogenicity and host range of these newly identified strains, and evaluate their potential for biocontrol of weedy wetland plants. On fostering interdisciplinary collaboration, we can better address the challenges posed by these fungi and leverage their potential benefits in sustainable agriculture and ecosystem management.
Author Contributions
A.A. and Y.G. designed and performed sampling, fungal isolation, experiments, writing, and editing, and A.A., Z.A., F.A. and L.M.H. took photography. A.A., F.A. and P.H.R. carried out phylogenetic analyses. All authors have read and agreed to the published version of the manuscript.
Funding
This work is based upon research funded by the Iran National Science Foundation (INSF) under project No. 99033118.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All of the data supporting the findings of this study are available in the main text.
Acknowledgments
The authors thank the Iran National Science Foundation (INSF), and the Research Deputy of Urmia University.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Nees von Esenbeck, C.G. Das System der Pilze und Schwämme: Ein Versuch; Stahel: Würzburg, Germany, 1816. [Google Scholar]
- Elliott, J.A. Taxonomic characters of the genera Alternaria and Macrosporium. Am. J. Bot. 1917, 4, 439–476. [Google Scholar] [CrossRef]
- Simmons, E.G. Typification of Alternaria, Stemphylium, and Ulocladium. Mycologia 1967, 59, 67–92. [Google Scholar] [CrossRef]
- Wiltshire, S.P. The foundation species of Alternaria and Macrosporium. Trans. Br. Mycol. Soc. 1933, 18, 135–160. [Google Scholar] [CrossRef]
- Fries, E.M. Systema Mycologicum. Vol. 3; Gryphiswaldae: Sumtibus Ernesti Maurittii: Gryphiswaldia, Germany, 1832. [Google Scholar]
- Thomma, B.P. Alternaria spp.: From general saprophyte to specific parasite. Mol. Plant Pathol. 2003, 4, 225–236. [Google Scholar] [CrossRef]
- Lawrence, D.P.; Gannibal, P.B.; Peever, T.L.; Pryor, B.M. The sections of Alternaria: Formalizing species-group concepts. Mycologia 2013, 105, 530–546. [Google Scholar] [CrossRef]
- Woudenberg, J.; Groenewald, J.; Binder, M.; Crous, P. Alternaria redefined. Stud. Mycol. 2013, 75, 171–212. [Google Scholar] [CrossRef] [PubMed]
- Von Keissler, K. Zur kenntnis der pilzflora krains. Beih. Bot. Centralbl. 1912, 29, 395–440. [Google Scholar]
- Neergaard, P. Danish Species of Alternaria and Stemphylium; Oxford University Press: London, UK, 1945. [Google Scholar]
- Joly, P. Le Genre Alternaria. Encyclopédie Mycologique XXXIII; P. Lechevalier: Paris, France, 1964. [Google Scholar]
- Ellis, M.B. Dematiaceous Hyphomycetes; Commonwealth Mycological Institute: Kew, UK, 1971. [Google Scholar]
- Ellis, M.B. More Dematiaceous Hyphomycetes; Commonwealth Mycological Institute: Kew, UK, 1976. [Google Scholar]
- Simmons, E.G. Alternaria themes and variations (1–6). Mycotaxon 1981, 13, 16–34. [Google Scholar]
- Simmons, E.G. Alternaria themes and variations (11–13). Mycotaxon 1982, 14, 44–57. [Google Scholar]
- Simmons, E.G. Alternaria themes and variations (14–16). Mycotaxon 1986, 25, 195–202. [Google Scholar]
- Simmons, E.G. Alternaria themes and variations (17–21). Mycotaxon 1986, 25, 203–216. [Google Scholar]
- Simmons, E.G. Alternaria themes and variations (22–26). Mycotaxon 1986, 25, 287–308. [Google Scholar]
- Simmons, E.G. Alternaria themes and variations (27–53). Mycotaxon 1990, 37, 79–119. [Google Scholar]
- Simmons, E.G. Alternaria taxonomy: Current status, viewpoint, challenge. In Alternaria Biology, Plant Diseases and Metabolites; Chelkowski, J., Visconti, A., Eds.; Elsevier Science Publishers: Amsterdam, The Netherlands, 1992; pp. 1–35. [Google Scholar]
- Simmons, E.G. Alternaria themes and variations (112–144). Mycotaxon 1995, 55, 55–163. [Google Scholar]
- Hong, S.G.; Cramer, R.A.; Lawrence, C.B.; Pryor, B.M. Alt a 1 allergen homologs from Alternaria and related taxa: Analysis of phylogenetic content and secondary structure. Fungal Genet. Biol. 2005, 42, 119–129. [Google Scholar] [CrossRef]
- Lawrence, D.P.; Park, M.S.; Pryor, B.M. Nimbya and Embellisia revisited, with nov. comb. for Alternaria celosiae and A. perpunctulata. Mycol. Prog. 2012, 11, 799–815. [Google Scholar] [CrossRef]
- Pryor, B.M.; Gilbertson, R.L. Molecular phylogenetic relationships amongst Alternaria species and related fungi based upon analysis of nuclear ITS and mt SSU rDNA sequences. Mycol. Res. 2000, 104, 1312–1321. [Google Scholar] [CrossRef]
- Pryor, B.M.; Bigelow, D.M. Molecular characterization of Embellisia and Nimbya species and their relationship to Alternaria, Ulocladium and Stemphylium. Mycologia 2003, 95, 1141–1154. [Google Scholar] [CrossRef] [PubMed]
- Andrew, M.; Peever, T.L.; Pryor, B.M. An expanded multilocus phylogeny does not resolve species among the small-spored Alternaria species complex. Mycologia 2009, 101, 95–109. [Google Scholar] [CrossRef]
- Wang, Y.; Geng, Y.; Ma, J.; Wang, Q.; Zhang, X.G. Sinomyces: A new genus of anamorphic Pleosporaceae. Fungal Biol. 2011, 115, 188–195. [Google Scholar] [CrossRef]
- Woudenberg, J.H.C.; Truter, M.; Groenewald, J.Z.; Crous, P.W. Large-spored Alternaria pathogens in section Porri disentangled. Stud. Mycol. 2014, 79, 1–47. [Google Scholar] [CrossRef] [PubMed]
- Grum-Grzhimaylo, A.A.; Georgieva, M.L.; Bondarenko, S.A.; Debeta, A.J.M.; Bilanenko, E.N. On the diversity of fungi from soda soils. Fungal Divers. 2016, 76, 27–74. [Google Scholar] [CrossRef]
- Lawrence, D.P.; Rotondo, F.; Gannibal, P.B. Biodiversity and taxonomy of the pleomorphic genus Alternaria. Mycol. Prog. 2016, 15, 3. [Google Scholar] [CrossRef]
- Ghafri, A.A.; Maharachchikumbura, S.S.N.; Hyde, K.D.; Al-Saady, N.A.; Al-Sadi, A.M. A new section and a new species of Alternaria encountered from Oman. Phytotaxa 2019, 405, 279–289. [Google Scholar] [CrossRef]
- Gannibal, P.B.; Orina, A.S.; Gasich, E.L. A new section for Alternaria helianthiinficiens found on sunflower and new asteraceous hosts in Russia. Mycol. Prog. 2022, 21, 34. [Google Scholar] [CrossRef]
- Ahmadpour, A.; Ghosta, Y.; Poursafar, A. Novel species of Alternaria section Nimbya from Iran as revealed by morphological and molecular data. Mycologia 2021, 113, 1073–1088. [Google Scholar] [CrossRef]
- Simmons, E.G. Macrospora Fuckel (Pleosporales) and related anamorphs. Sydowia 1989, 41, 314–329. [Google Scholar]
- Simmons, E.G. Alternaria an Identification Manual; CBS Fungal Biodiversity Centre: Utrecht, The Netherlands, 2007. [Google Scholar]
- Rayner, R.W. A Mycological Colour Chart; Commonwealth Mycological Institute: Kew, UK, 1970. [Google Scholar]
- Crous, P.W.; Gams, W.; Stalpers, J.A.; Robert, V.; Stegehuis, G. MycoBank: An online initiative to launch mycology into the 21st century. Stud. Mycol. 2004, 50, 19–22. [Google Scholar]
- Ahmadpour, A. Alternaria caricicola, a new species of Alternaria in the section Nimbya from Iran. Phytotaxa 2019, 405, 65–73. [Google Scholar] [CrossRef]
- Ahmadpour, A.; Ghosta, Y.; Alavi, Z.; Alavi, F.; Poursafar, A.; Rampelotto, P.H. Diversity of Alternaria section Nimbya in Iran, with the description of eight new species. J. Fungi 2025, 11, 225. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Shinsky, J.J., White, T.J., Eds.; Elsevier: Berlin/Heidelberg, Germany, 1990; pp. 315–322. [Google Scholar]
- Berbee, M.L.; Pirseyedi, M.; Hubbard, S. Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 1999, 91, 964–977. [Google Scholar] [CrossRef]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Sung, G.H.; Sung, J.M.; Hywel-Jones, N.L.; Spatafora, J.W. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 2007, 44, 1204–1223. [Google Scholar] [CrossRef]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Woudenberg, J.H.C.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes. Stud. Mycol. 2015, 82, 1–21. [Google Scholar] [CrossRef]
- Nishikawa, J.; Nakashima, C. Japanese species of Alternaria and their species boundaries based on host range. Fungal Syst. Evol. 2020, 5, 197–281. [Google Scholar] [CrossRef]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 108, 1160–1166. [Google Scholar] [CrossRef]
- Maddison, W.P.; Maddison, D.R. Mesquite: A Modular System for Evolutionary Analysis. Version 3.61. 2019. Available online: http://www.mesquiteproject.org (accessed on 20 February 2025).
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
- Nylander, J.A.A. MrModeltest v2.0. Program Distributed by the Author; Evolutionary Biology Centre, Uppsala University: Uppsala, Sweden, 2004. [Google Scholar]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. The CIPRES Science Gateway: Enabling High-Impact Science for Phylogenetics Researchers with Limited Resources. In Proceedings of the 1st Conference of the Extreme Science and Engineering Discovery Environment: Bridging from the Extreme to the Campus and Beyond (ACM), Chicago, IL, USA, 16–20 July 2012. [Google Scholar]
- Swofford, D.L. Paup: Phylogenetic Analysis Using Parsimony (and Other Methods) 4.0. B5. Version 4.0b10; Sinauer Associates: Sunderland, MA, USA, 2002. [Google Scholar]
- Rambaut, A. FigTree, a Graphical Viewer of Phylogenetic Trees. 2019. Available online: http://tree.bio.ed.ac.uk/software/figtree (accessed on 20 February 2025).
- Inderbitzin, P.; Shoemaker, R.A.; O’Neill, N.R.; Turgeon, B.G.; Berbee, M.L. Systematics and mating systems of two fungal pathogens of opium poppy: The heterothallic Crivellia papaveracea with a Brachycladium penicillatum asexual state and a homothallic species with a Brachycladium papaveris asexual state. Can. J. Bot. 2006, 84, 1304–1326. [Google Scholar] [CrossRef]
- Amatulli, M.T.; Fanelli, F.; Moretti, A.; Mule, G.; Logrieco, A.F. Alternaria species and mycotoxins associated to black point of cereals. Mycotoxins 2013, 63, 39–46. [Google Scholar] [CrossRef]
- Somma, S.; Amatulli, M.T.; Masiello, M.; Moretti, A.; Logrieco, A.F. Alternaria species associated to wheat black point identified through a multilocus sequence approach. Int. J. Food Microbiol. 2019, 293, 34–43. [Google Scholar] [CrossRef]
- Li, J.; Jiang, H.; Jeewon, R.; Hongsanan, S.; Bhat, D.J.; Tang, S.M.; Lumyong, S.; Mortimer, P.E.; Xu, J.C.; Camporesi, E.; et al. Alternaria: Update on species limits, evolution, multi-locus phylogeny, and classification. Stud. Fungi 2023, 7, 23. [Google Scholar] [CrossRef]
- He, L.; Cheng, H.; Zhao, L.; Htun, A.A.; Yu, Z.H.; Deng, J.X.; Li, Q.L. Morphological and molecular identification of two new Alternaria species (Ascomycota, Pleosporaceae) in section Radicina from China. MycoKeys 2021, 78, 187–198. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Li, D.W.; Cui, W.L.; Huang, L. Seven new species of Alternaria (Pleosporales, Pleosporaceae) associated with Chinese fir, based on morphological and molecular evidence. MycoKeys 2024, 101, 1–44. [Google Scholar] [CrossRef]
- Li, J.; Phookamsak, R.; Jiang, H.; Bhat, D.J.; Camporesi, E.; Lumyong, S.; Kumla, J.; Hongsanan, S.; Mortimer, P.E.; Xu, J.; et al. Additions to the inventory of the genus Alternaria section Alternaria (Pleosporaceae, Pleosporales) in Italy. J. Fungi 2022, 8, 898. [Google Scholar] [CrossRef]
- Huang, J.H.; Gou, Y.N.; New, Z.M.; Aung, S.L.L.; Deng, J.X.; Li, M.J. Alternaria youyangensis sp. nov. (Ascomycota: Pleosporaceae) from leaf spot of Fagopyrum esculentum in China. Phytotaxa 2024, 672, 176–186. [Google Scholar] [CrossRef]
- Nwe, Z.M.; Htut, K.N.; Aung, S.L.L.; Gou, Y.N.; Huang, C.X.; Deng, J.X. Two novel species and new host of Alternaria (Pleosporales, Pleosporaceae) from sunflower (Compositae) in Myanmar. MycoKeys 2024, 105, 337–354. [Google Scholar] [CrossRef]
- Bessadat, N.; Bataillé-Simoneau, N.; Colou, J.; Hamon, B.; Mabrouk, K.; Simoneau, P. New members of Alternaria (Pleosporales, Pleosporaceae) collected from Apiaceae in Algeria. MycoKeys 2025, 113, 169–192. [Google Scholar] [CrossRef]
- Ozkilinc, H.; Sarpakaya, K.; Kurt, S.; Can, C.; Polatbilek, H.; Yasar, A.; Sevinc, U.; Uysal, A.; Konukoglu, F. Pathogenicity, morpho-species and mating types of Alternaria spp. causing Alternaria blight in Pistacia spp. in Turkey. Phytoparasitica 2017, 45, 719–728. [Google Scholar] [CrossRef]
- Aloi, F.; Riolo, M.; Sanzani, S.M.; Mincuzzi, A.; Ippolito, A.; Siciliano, I.; Pane, A.; Gullino, M.L.; Cacciola, S.O. Characterization of Alternaria species associated with heart rot of pomegranate fruit. J. Fungi 2021, 7, 172. [Google Scholar] [CrossRef] [PubMed]
- Salotti, I.; Giorni, P.; Battilani, P. Biology, ecology, and epidemiology of Alternaria species affecting tomato: Ground information for the development of a predictive model. Front. Plant Sci. 2024, 15, 1430965. [Google Scholar] [CrossRef]
- Xu, Z.T.; Long, J.-H.; Liu, J.Q.; Zhang, R.-Z.; Xu, L.L.; Wang, J.-J.; Wei, X.K.; White, J.F.; Kamran, M.; Cui, H.W.; et al. Characterization and pathogenicity of Alternaria species associated with leaf spot on Plantago lanceolata in Sichuan Province, China. Plant Pathol. 2024, 73, 1749–1760. [Google Scholar] [CrossRef]
- Salo, P.M.; Arbes, S.J., Jr.; Sever, M.; Jaramillo, R.; Cohn, R.D.; London, S.J.; Zeldin, D.C. Exposure to Alternaria alternata in US homes is associated with asthma symptoms. J. Allergy Clin. Immunol. 2006, 118, 892–898. [Google Scholar] [CrossRef]
- Dye, C.; Johnson, E.M.; Gruffydd-Jones, T.J. Alternaria species infection in nine domestic cats. J. Feline Med. Surg. 2009, 11, 332–336. [Google Scholar] [CrossRef]
- Lopes, L.; Borges-Costa, J.; Soares-Almeida, L.; Filipe, P.; Neves, F.; Santana, A.; Guerra, J.; Kutzner, H. Cutaneous alternariosis caused by Alternaria infectoria: Three cases in kidney transplant patients. Healthcare 2013, 1, 100–106. [Google Scholar] [CrossRef] [PubMed]
- Meena, M.; Gupta, S.K.; Swapnil, P.; Zehra, A.; Dubey, M.K.; Upadhyay, R.S. Alternaria toxins: Potential virulence factors and genes related to pathogenesis. Front. Microbiol. 2017, 8, 1451. [Google Scholar] [CrossRef]
- Sharma, B.; Kamble, U.; Ghosh, G.; Prasad, A.; Chowdhary, A. Invasive rhinosinusitis due to Alternaria alternata and Rhizopus arrhizus mixed infection: A case report and review. Int. J. Infect. 2017, 4, e42127. [Google Scholar]
- Kim, G.; Yoo, S.J.; Yoo, J.R.; Seo, K.B. The first case report of thorn-induced Alternaria alternata infection of the hand in an immunocompetent host. BMC Infect. Dis. 2022, 22, 34. [Google Scholar] [CrossRef]
- Xia, X.; Liu, Z.; Shen, H. Subcutaneous phaeohyphomycosis caused by Alternaria section Alternaria. Int. J. Infect. Dis. 2023, 134, 99–101. [Google Scholar] [CrossRef] [PubMed]
- Minaeva, L.P.; Markova, Y.M.; Sedova, I.B.; Chaly, Z.A. Micromycetes of the genus Alternaria are producers of emerging mycotoxins: Analysis of profile and toxinogenic potential in vitro. Bull. Exp. Biol. Med. 2024, 178, 218–222. [Google Scholar] [CrossRef] [PubMed]
- Lücking, R.; Aime, M.C.; Robbertse, B.; Miller, A.N.; Ariyawansa, H.A.; Aoki, T.; Cardinali, G.; Crous, P.W.; Druzhinina, I.S.; Geiser, D.M.; et al. Unambiguous identification of fungi: Where do we stand and how accurate and precise is fungal DNA barcoding? IMA Fungus 2020, 11, 14. [Google Scholar] [CrossRef]
- Gautam, A.K.; Verma, R.K.; Avasthi, S.; Sushma; Bohra, Y.; Devadatha, B.; Niranjan, M.; Suwannarach, N. Current insight into traditional and modern methods in fungal diversity estimates. J. Fungi 2022, 8, 226. [Google Scholar] [CrossRef]
- Mansourvar, M.; Charylo, K.R.; Frandsen, R.J.N.; Brewer, S.S.; Hoof, J.B. Automated fungal identification with deep learning on time-lapse images. Information 2025, 16, 109. [Google Scholar] [CrossRef]
- Pouris, J.; Konstantinidis, K.; Pyrri, I.; Papageorgiou, E.G.; Voyiatzaki, C. FungID: Innovative fungi identification method with chromogenic profiling of colony color patterns. Pathogens 2025, 14, 242. [Google Scholar] [CrossRef]
- Deshpande, K.B.; Rajderkar, N.R. New species of Alternaria from Marathwada (India). Mycopathol. Mycol. Appl. 1964, 23, 277–280. [Google Scholar] [CrossRef]
- Chen, W.Q.; Zhang, T.Y. Two new species of Alternaria from China. Mycol. Res. 1997, 101, 1257–1258. [Google Scholar] [CrossRef]
- Roberts, R.G. Alternaria roseogrisea, a new species from achenes of Helianthus annuus L. (Sunflower). Mycotaxon 2008, 103, 21–26. [Google Scholar]
- Gannibal, P.B.; Gomzhina, M.M. Revision of Alternaria sections Pseudoulocladium and Ulocladioides: Assessment of species boundaries, determination of mating-type loci, and identification of Russian strains. Mycologia 2024, 116, 744–763. [Google Scholar] [CrossRef]
- Poursafar, A.; Ghosta, Y.; Orina, A.S.; Gannibal, P.B.; Javan-Nikkhah, M.; Lawrence, D.P. Taxonomic study on Alternaria sections Infectoriae and Pseudoalternaria associated with black (sooty) head mold of wheat and barley in Iran. Mycol. Prog. 2018, 17, 343–356. [Google Scholar] [CrossRef]
- Iturrieta-González, I.; Pujol, I.; Iftimie, S.; Gracía, D.; Morente, V.; Queralt, R.; Guevara-Suarez, M.; Alastruey-Izquierdo, A.; Ballester, F.; Hernández-Restrepo, M.; et al. Polyphasic identification of three new species in Alternaria section Infectoria causing human cutaneous infection. Mycoses 2020, 63, 212–224. [Google Scholar] [CrossRef] [PubMed]
- Wong, M.K.M.; Hyde, K.D. Diversity of fungi on six species of Gramineae and one species of Cyperaceae in Hong Kong. Mycol. Res. 2001, 105, 1485–1491. [Google Scholar] [CrossRef]
- Bryson, C.T.; Carter, R. The significance of Cyperaceae as weeds. In Sedges: Uses, Diversity, and Systematics of the Cyperaceae; Naczi, R.C.F., Ford, B.A., Eds.; Missouri Botanical Garden Press: St. Louis, MO, USA, 2008; pp. 15–101. [Google Scholar]
- Escudero, M. Phylogenetic congruence of parasitic smut fungi (Anthracoidea, Anthracoideaceae) and their host plants (Carex, Cyperaceae): Cospeciation or host-shift speciation? Am. J. Bot. 2015, 102, 1108–1114. [Google Scholar] [CrossRef]
- Mishra, S.; Tripathi, A.; Tripathi, D.K.; Chauhan, D.K. Role of sedges (Cyperaceae) in wetlands, environmental cleaning and as food material: Possibilities and future perspectives. In Plant-Environment Interaction: Responses and Approaches to Mitigate Stress; Azooz, M.M., Ahmad, P., Eds.; John Wiley & Sons, Ltd.: Bognor Regis, UK, 2016; pp. 327–338. [Google Scholar]
- Riess, K.; Schön, M.E.; Ziegler, R.; Lutz, M.; Shivas, R.S.; Piątek, M.; Garnica, S. The origin and diversification of the Enthorrhizales: Deep evolutionary roots but recent specialization with a phylogenetic and phenotypic split between associates of the Cyperaceae and Juncaceae. Org. Divers. Evol. 2019, 19, 13–30. [Google Scholar] [CrossRef]
- Léveillé-Bourret, É.; Eggertson, Q.; Hambleton, S.; Starr, J.R. Cryptic diversity and significant cophylogenetic signal detected by DNA barcoding the rust fungi (Pucciniaceae) of Cyperaceae-Juncaceae. J. Syst. Evol. 2021, 59, 833–851. [Google Scholar] [CrossRef]
- Portalanza, D.; Acosta-Mejillones, A.; Alcivar, J.; Colorado, T.; Guaita, J.; Montero, L.; Villao-Uzho, L.; Santos-Ordonez, E. Fungal community dynamics in Cyperus rotundus: Implications for Rhizophora mangle in a mangrove ecosystem. Int. J. Plant Biol. 2025, 16, 23. [Google Scholar] [CrossRef]
- Ahmadpour, A.; Heidarian, Z.; Ghosta, Y.; Alavi, Z.; Alavi, F.; Manamgoda, D.S.; Karunarathna, S.C.; Rampelotto, P.H. Morphological and molecular characterization of Curvularia species from Iran, with description of two novel species and two new records. Mycologia 2025, 117, 261–285. [Google Scholar] [CrossRef]
- Ahmadpour, A.; Heidarian, Z.; Ghosta, Y.; Alavi, Z.; Alavi, F.; Manamgoda, D.S.; Kumla, J.; Karunarathna, S.C.; Rampelotto, P.H.; Suwannarach, N. Morphological and phylogenetic analyses of Bipolaris species associated with Poales and Asparagales host plants in Iran. Front. Cell. Infect. Microbiol. 2025, 15, 1520125. [Google Scholar] [CrossRef]
- Tan, Y.P.; Madrid, H.; Crous, P.W.; Shivas, R.G. Johnalcornia gen. et. comb. nov., and nine new combinations in Curvularia based on molecular phylogenetic analysis. Australas. Plant Pathol. 2014, 43, 589–603. [Google Scholar] [CrossRef]
Figure 1.
Phylogenetic tree generated using maximum-likelihood (ML) analysis of 167 strains in the suborder Pleosporineae, based on a concatenated dataset of SSU, ITS, LSU, GAPDH, and RPB2 sequences. Bootstrap support values for maximum likelihood and maximum parsimony (MLBS/MPBS) ≥70% and Bayesian posterior probabilities (BIPP) ≥ 0.95 are shown at the nodes. The tree is rooted with Halojulella avicenniae (BCC 18422). The scale bar represents the number of nucleotide substitutions. Newly identified strains are highlighted in bold blue. Families, genera, and sections are presented with colored blocks and * indicate monotypic lineages.
Figure 1.
Phylogenetic tree generated using maximum-likelihood (ML) analysis of 167 strains in the suborder Pleosporineae, based on a concatenated dataset of SSU, ITS, LSU, GAPDH, and RPB2 sequences. Bootstrap support values for maximum likelihood and maximum parsimony (MLBS/MPBS) ≥70% and Bayesian posterior probabilities (BIPP) ≥ 0.95 are shown at the nodes. The tree is rooted with Halojulella avicenniae (BCC 18422). The scale bar represents the number of nucleotide substitutions. Newly identified strains are highlighted in bold blue. Families, genera, and sections are presented with colored blocks and * indicate monotypic lineages.
Figure 2.
Phylogenetic tree generated using maximum-likelihood (ML) analysis of 110 Alternaria spp. strains based on a concatenated dataset of SSU, ITS, LSU, GAPDH, RPB2, and TEF1 sequences. Bootstrap support values for maximum likelihood and maximum parsimony (MLBS/MPBS) ≥ 70% and Bayesian posterior probabilities (BIPP) ≥ 0.95 are shown at the nodes. The tree is rooted with Stemphylium botryosum (CBS 714.68) and S. vesicarium (CBS 191.86). Newly identified strains are highlighted in bold blue. The scale bar represents the number of nucleotide substitutions. Six monotypic lineages are marked with a black asterisk.
Figure 2.
Phylogenetic tree generated using maximum-likelihood (ML) analysis of 110 Alternaria spp. strains based on a concatenated dataset of SSU, ITS, LSU, GAPDH, RPB2, and TEF1 sequences. Bootstrap support values for maximum likelihood and maximum parsimony (MLBS/MPBS) ≥ 70% and Bayesian posterior probabilities (BIPP) ≥ 0.95 are shown at the nodes. The tree is rooted with Stemphylium botryosum (CBS 714.68) and S. vesicarium (CBS 191.86). Newly identified strains are highlighted in bold blue. The scale bar represents the number of nucleotide substitutions. Six monotypic lineages are marked with a black asterisk.
Table 1.
Primer sets used for PCR amplifications in this study, their sequences, and references.
| Loci | Primer Name | Primer Sequence (5′–3′) | Direction | References |
|---|---|---|---|---|
| SSU | NS1 | GTAGTCATATGCTTGTCTC | Forward | [40] |
| NS4 | CTTCCGTCAATTCCTTTAAG | Reverse | ||
| ITS | ITS1 | TCCGTAGGTGAACCTGCGG | Forward | [40] |
| ITS4 | TCCTCCGCTTATTGATATGC | Reverse | ||
| LSU | LR0R | GTACCCGCTGAACTTAAGC | Forward | [40] |
| LR5 | TCCTGAGGGAAACTTCG | Reverse | ||
| GAPDH | gpd1 | CAACGGCTTCGGTCGCATTG | Forward | [41] |
| gpd2 | GCCAAGCAGTTGGTTGTG | Reverse | ||
| RPB2 | RPB2-5F2 | GGGGWGAYCAGAAGAAGGC | Forward | [42] |
| RPB2-7cR | CCCATRGCTTGTYYRCCCAT | Reverse | [43] | |
| TEF1 | EF1-728F | CATCGAGAAGTTCGAGAAGG | Forward | [44] |
| EF1-986R | TACTTGAAGGAACCCTTACC | Reverse |
Table 2.
Lists of the Alternaria species and allied genera in Pleosporineae used for phylogenetic analyses, with details about host/substrate, country, and GenBank accession numbers. Newly generated sequences are in bold. R and T indicate reference and ex-type strains, respectively.
Table 2.
Lists of the Alternaria species and allied genera in Pleosporineae used for phylogenetic analyses, with details about host/substrate, country, and GenBank accession numbers. Newly generated sequences are in bold. R and T indicate reference and ex-type strains, respectively.
| Species Name | Section | Collection No. | Country | Host/Substrate | GenBank Accession Numbers | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| SSU | ITS | LSU | GAPDH | RPB2 | TEF1 | |||||
| Alternaria abundans | Chalastospora | CBS 534.83 T | New Zealand | Fragaria sp. | KC584581 | JN383485 | KC584323 | KC584154 | KC584448 | KC584707 |
| A. alternantherae | Alternantherae | CBS 1243s92 | China | Solanum melongena | KC584506 | KC584179 | KC584251 | KC584096 | KC584374 | KC584633 |
| A. alternariae | Ulocladium | CBS 126989 T | USA | Daucus carota | KC584604 | AF229485 | KC584346 | AY278815 | KC584470 | KC584730 |
| A. alternata | Alternaria | CBS 916.96 T | India | Arachis hypogaea | KC584507 | AF347031 | DQ678082 | AY278808 | KC584375 | KC584634 |
| A. arborescens | Alternaria | CBS 102605 T | USA | Lycopersicon esculentum | KC584509 | AF347033 | KC584253 | AY278810 | KC584377 | KC584636 |
| A. argyranthemi | - | CBS 116530 T | New Zealand | Argyranthemum sp. | KC584510 | KC584181 | KC584254 | KC584098 | KC584378 | KC584637 |
| A. arrhenatheri | Pseudoalternaria | LEP 140372 T | USA | Arrhenatherum elatius | - | JQ693677 | - | JQ693635 | - | - |
| A. aspera | Pseudoulocladium | CBS 115269 T | Japan | Pistacia vera | KC584607 | KC584242 | KC584349 | KC584166 | KC584474 | KC584734 |
| A. atra | Ulocladioides | CBS 195.67 T | USA | Soil | KC584608 | AF229486 | KC584350 | KC584167 | KC584475 | KC584735 |
| A. avenicola | Panax | CBS 121459 T | Norway | Avena sp. | KC584512 | KC584183 | KC584256 | KC584100 | KC584380 | KC584639 |
| A. avrinica | Iraniana | IRAN 4772C T | Iran | Juncus sp. | PV435164 | PV435148 | PV435156 | PV443215 | PV443231 | PV443223 |
| A. avrinica | Iraniana | IRAN 5031C | Iran | Juncus sp. | PV435165 | PV435149 | PV435157 | PV443216 | PV443232 | PV443224 |
| A. avrinica | Iraniana | FCCUU 1419 | Iran | Carex sp. | PV435166 | PV435150 | PV435158 | PV443217 | PV443233 | PV443225 |
| A. avrinica | Iraniana | FCCUU 1420 | Iran | Juncus sp. | PV435167 | PV435151 | PV435159 | PV443218 | PV443234 | PV443226 |
| A. bornmuelleri | Undifilum | DAOM 231361 T | Austria | Securigera varia | KC584624 | FJ357317 | KC584366 | FJ357305 | KC584491 | KC584751 |
| A. botryospora | Embellisioides | CBS 478.90 T | New Zealand | Leptinella dioica | KC584594 | MH862228 | KC584336 | AY278831 | KC584461 | KC584720 |
| A. botrytis | Ulocladium | CBS 197.67 T | USA | Contaminant | KC584609 | KC584243 | KC584351 | KC584168 | KC584476 | KC584736 |
| A. brassicae | - | CBS 116528 R | USA | Brassica oleracea | KC584514 | KC584185 | KC584258 | KC584102 | KC584382 | KC584641 |
| A. brassicicola | Brassicicola | CBS 118699 R | USA | Brassica oleracea | KC584515 | JX499031 | KC584259 | KC584103 | KC584383 | KC584642 |
| A. brassicifolii | - | CNU 111118 T | Korea | Brassica rapa subsp. pekinensis | - | JQ317188 | - | KM821537 | - | - |
| A. breviramosa | Chalastospora | CBS 121331 T | Australia | Triticum sp. | KC584574 | FJ839608 | KC584318 | KC584148 | KC584442 | KC584700 |
| A. cantlous | Ulocladioides | CBS 123007 T | China | Cucumis melo | KC584612 | KC584245 | KC584354 | KC584171 | KC584479 | KC584739 |
| A. caricicola | Nimbya | IRAN 3418C T | Iran | Carex sp. | - | MK508871 | - | MK505392 | MT187279 | MT187265 |
| A. caricis | Nimbya | CBS 480.90 T | USA | Carex hoodii | KC584600 | AY278839 | KC584342 | AY278826 | KC584467 | KC584726 |
| A. celosiicola | Alternantherae | MAFF 243058 | Japan | Celosia argentea var. plumosa | - | AB678217 | - | AB744033 | LC476781 | LC480205 |
| A. cetera | Chalastospora | CBS 121340 T | Australia | Elymus scabrus | KC584573 | JN383482 | KC584317 | AY562398 | KC584441 | KC584699 |
| A. chartarum | Pseudoulocladium | CBS 200.67 T | Canada | Populus sp. | KC584614 | AF229488 | KC584356 | KC584172 | KC584481 | KC584741 |
| A. cheiranthi | Cheiranthus | CBS 109384R | Italy | Cheiranthus cheiri | KC584519 | AF229457 | KC584263 | KC584107 | KC584387 | KC584646 |
| A. chlamydospora | Phragmosporae | CBS 491.72 T | Egypt | Soil | KC584520 | KC584189 | KC584264 | KC584108 | KC584388 | KC584647 |
| A. chlamydosporigena | Embellisia | CBS 341.71 R | USA | Air | KC584584 | KC584231 | KC584326 | KC584156 | KC584451 | KC584710 |
| A. cinerariae | Sonchi | CBS 116495 R | USA | Ligularia sp. | KC584521 | KC584190 | KC584265 | KC584109 | KC584389 | KC584648 |
| A. conjuncta | Infectoriae | CBS 196.86 T | Switzerland | Pastinaca sativa | KC584522 | FJ266475 | KC584266 | AY562401 | KC584390 | KC584649 |
| A. conoidea | Brassicicola | CBS 132.89 | Saudi Arabia | Ricinus communis | KC584585 | FJ348226 | KC584327 | FJ348227 | KC584452 | KC584711 |
| A. cucurbitae | Ulocladioides | CBS 483.81R | New Zealand | Cucumis sativus | KC584616 | FJ266483 | KC584358 | AY562418 | KC584483 | KC584743 |
| A. cumini | Eureka | CBS 121329 T | India | Cuminum cyminum | KC584523 | KC584191 | KC584267 | KC584110 | KC584391 | KC584650 |
| A. cypericola | Nimbya | IRAN 3423C T | Iran | Cyperus sp. | - | MT176120 | - | MT187250 | MT187276 | MT187262 |
| A. dauci | Porri | CBS 111.38 T | Italy | Daucus carota | - | KJ718158 | - | KJ718005 | KJ718331 | KJ718506 |
| A. daucifolii | Alternaria | CBS 118812 T | USA | Daucus carota | KC584525 | KC584193 | KC584269 | KC584112 | KC584393 | KC584652 |
| A. dennisii | - | CBS 476.90 T | Isle of Man | Senecio jacobaea | KC584587 | JN383488 | KC584329 | JN383469 | KC584454 | KC584713 |
| A. dennisii | - | CBS 110533 | New Zealand | Senecio jacobaea | KC584586 | KC584232 | KC584328 | KC584157 | KC584453 | KC584712 |
| A. dianthicola | Dianthicola | CBS 116491 R | New Zealand | Dianthus × allwoodii | KC584526 | KC584194 | KC584270 | KC584113 | KC584394 | KC584653 |
| A. didymospora | Phragmosporae | CBS 766.79 | Adriatic Sea | Seawater | KC584588 | FJ357312 | KC584330 | FJ357300 | KC584455 | KC584714 |
| A. elegans | Dianthicola | CBS 109159 T | Burkina Faso | Lycopersicon esculentum | KC584527 | KC584195 | KC584271 | KC584114 | KC584395 | KC584654 |
| A. embellisia | Embellisia | CBS 339.71 R | USA | Allium sativum | KC584582 | KC584230 | KC584324 | KC584155 | KC584449 | KC584708 |
| A. ershadii | Pseudoalternaria | IRAN 3275C | Iran | Triticum aestivum | - | MK829647 | - | MK829645 | - | - |
| A. eryngii | Panax | CBS 121339 R | - | Eryngium sp. | KC584529 | JQ693661 | KC584273 | AY562416 | KC584397 | KC584656 |
| A. euphorbiicola | Euphorbiicola | CBS 119410 R | USA | Euphorbia pulcherrima | - | KJ718173 | - | KJ718018 | KJ718346 | KJ718521 |
| A. euphorbiicola | Euphorbiicola | CBS 133874 | USA | Euphorbia hyssopifolia | - | KJ718174 | - | KJ718019 | KJ718347 | KJ718522 |
| A. eureka | Eureka | CBS 193.86 T | Australia | Medicago rugosa | KC584589 | JN383490 | KC584331 | JN383471 | KC584456 | KC584715 |
| A. gypsophilae | Gypsophilae | CBS 107.41 T | Unknown | Gypsophila elegans | KC584533 | KC584199 | KC584277 | KC584118 | KC584401 | KC584660 |
| A. helianthiinficiens | Helianthiinficientes | CBS 117370 R | UK | Helianthus annuus | KC584534 | KC584200 | KC584278 | KC584119 | KC584402 | KC584661 |
| A. helianthiinficiens | Helianthiinficientes | CBS 208.86 T | USA | Helianthus annuus | KC584535 | JX101649 | KC584279 | KC584120 | KC584403 | EU130548 |
| A. heterospora | Ulocladioides | CBS 123376 T | China | Lycopersicon esculentum | KC584621 | KC584248 | KC584363 | KC584176 | KC584488 | KC584748 |
| A. heyranica | Nimbya | IRAN 3516C T | Iran | Carex sp. | - | MT176114 | - | MT187244 | MT187270 | MT187256 |
| A. hyacinthi | Embellisioides | CBS 416.71 T | Netherlands | Hyacinthus orientalis | KC584590 | KC584233 | KC584332 | KC584158 | KC584457 | KC584716 |
| A. indefessa | Cheiranthus | CBS 536.83 T | USA | Soil | KC584591 | KC584234 | KC584333 | KC584159 | KC584458 | KC584717 |
| A. infectoria | Infectoriae | CBS 210.86 T | UK | Triticum aestivum | KC584536 | DQ323697 | KC584280 | AY278793 | KC584404 | KC584662 |
| A. iraniana | Iraniana | IRAN 5030C T | Iran | Juncus sp. | - | PV435152 | PV435160 | PV443219 | PV443235 | PV443227 |
| A. iraniana | Iraniana | FCCUU 1421 | Iran | Juncus sp. | - | PV435153 | PV435161 | PV443220 | PV443236 | PV443228 |
| A. iraniana | Iraniana | FCCUU 1422 | Iran | Juncus sp. | - | PV435154 | PV435162 | PV443221 | PV443237 | PV443229 |
| A. iraniana | Iraniana | FCCUU 1423 | Iran | Juncus sp. | - | PV435155 | PV435163 | PV443222 | PV443238 | PV443230 |
| A. japonica | Japonicae | CBS 118390 R | USA | Brassica chinensis | KC584537 | KC584201 | KC584281 | KC584121 | KC584405 | KC584663 |
| A. junci-acuti | Nimbya | IRAN 3512C T | Iran | Juncus acutus | - | MT176113 | - | MT187243 | MT187269 | MT187255 |
| A. kordkuyana | Pseudoalternaria | IRAN 2764C T | Iran | Triticum aestivum | - | MF033843 | - | MF033826 | - | - |
| A. kulundii | Soda | M313 T | Russia | Soil | KJ443087 | KJ443262 | KJ443132 | KJ649618 | KJ443176 | - |
| A. leucanthemi | Teretispora | CBS 422.65 R | USA | Chrysanthemum maximum | KC584606 | KC584241 | KC584348 | KC584165 | KC584473 | KC584733 |
| A. leucanthemi | Teretispora | CBS 421.65 T | Netherlands | Chrysanthemum maximum | KC584605 | KC584240 | KC584347 | KC584164 | KC584472 | KC584732 |
| A. limaciformis | Phragmosporae | CBS 481.81 T | UK | Soil | KC584539 | KC584203 | KC584283 | KC584123 | KC584407 | KC584665 |
| A. longipes | Alternaria | CBS 540.94 R | USA | Nicotiana tabacum | KC584541 | AY278835 | KC584285 | AY278811 | KC584409 | KC584667 |
| A. mimicula | Brassicicola | CBS 118696 T | USA | Lycopersicon esculentum | KC584543 | FJ266477 | KC584287 | AY562415 | KC584411 | KC584669 |
| A. nepalensis | Japonicae | CBS 118700 T | Nepal | Brassica sp. | KC584546 | KC584207 | KC584290 | KC584126 | KC584414 | KC584672 |
| A. nobilis | Gypsophilae | CBS 116490 R | New Zealand | Dianthus caryophyllus | KC584547 | KC584208 | KC584291 | KC584127 | KC584415 | KC584673 |
| A. obovoidea | Ulocladioides | CBS 101229 | New Zealand | Cucumis sativus | KC584618 | FJ266487 | KC584360 | FJ266498 | KC584485 | KC584745 |
| A. omanensis | Omanenses | SQUCC 15560 | Oman | dead wood | MK878560 | MK878563 | MK878557 | MK880900 | MK880894 | MK880897 |
| A. omanensis | Omanenses | SQUCC 13580 T | Oman | dead wood | MK878559 | MK878562 | MK878556 | MK880899 | MK880893 | MK880896 |
| A. oregonensis | Infectoriae | CBS 542.94 T | USA | Triticum aestivum | KC584548 | FJ266478 | KC584292 | FJ266491 | KC584416 | KC584674 |
| A. oudemansii | Ulocladium | CBS 114.07 T | - | - | KC584619 | FJ266488 | KC584361 | KC584175 | KC584486 | KC584746 |
| A. panax | Panax | CBS 482.81 R | USA | Aralia racemosa | KC584549 | KC584209 | KC584293 | KC584128 | KC584417 | KC584675 |
| A. papavericola | Crivellia | CBS 116606 T | USA | Papaver somniferum | KC584579 | FJ357310 | KC584321 | FJ357298 | KC584446 | KC584705 |
| A. penicillata | Crivellia | CBS 116608 T | Austria | Papaver rhoeas | KC584572 | FJ357311 | KC584316 | FJ357299 | KC584440 | KC584698 |
| A. penicillata | Crivellia | CBS 116607 T | Austria | Papaver rhoeas | KC584580 | KC584229 | KC584322 | KC584153 | KC584447 | KC584706 |
| A. perpunctulata | Alternantherae | CBS 115267 T | USA | Alternanthera philoxeroides | KC584550 | KC584210 | KC584294 | KC584129 | KC584418 | KC584676 |
| A. petroselini | Radicina | CBS 112.41 T | - | Petroselinum sativum | KC584551 | KC584211 | KC584295 | KC584130 | KC584419 | KC584677 |
| A. petuchovskii | Soda | M304 T | Russia | Alkaline soil | KJ443079 | KJ443254 | KJ443124 | KJ649616 | KJ443170 | - |
| A. photistica | Panax | CBS 212.86 T | UK | Digitalis purpurea | KC584552 | KC584212 | KC584296 | KC584131 | KC584420 | KC584678 |
| A. phragmospora | Phragmosporae | CBS 274.70 | Netherlands | Soil | KC584595 | JN383493 | KC584337 | JN383474 | KC584462 | KC584721 |
| A. porri | Porri | CBS 116699 T | USA | Allium cepa | - | KJ718218 | - | KJ718053 | KJ718391 | KJ718564 |
| A. proteae | Embellisioides | CBS 475.90 T | Australia | Protea sp. | KC584597 | AY278842 | KC584339 | KC584161 | KC584464 | KC584723 |
| A. protenta | Porri | CBS 116651 R | USA | Solanum tuberosum | KC584562 | KC584217 | KC584306 | KC584139 | KC584430 | KC584688 |
| A. pseudorostrata | Porri | CBS 119411 T | USA | Euphorbia pulcherrima | KC584554 | JN383483 | KC584298 | AY562406 | KC584422 | KC584680 |
| A. radicina | Radicina | CBS 245.67 T | USA | Daucus carota | KC584555 | KC584213 | KC584299 | KC584133 | KC584423 | KC584681 |
| A. rosae | Pseudoalternaria | CBS 121341 T | New Zealand | Rosa rubiginosa | - | JQ693639 | - | JQ646279 | - | - |
| A. scirpicola | Nimbya | CBS 481.90 | UK | Scirpus sp. | KC584602 | KC584237 | KC584344 | KC584163 | KC584469 | KC584728 |
| A. scirpinfestans | Nimbya | EGS 49-185 | USA | Scirpus acutus | - | JN383499 | - | JN383480 | - | - |
| A. scirpivora | Nimbya | EGS 50-021 | USA | Scirpus acutus | - | JN383500 | - | JN383481 | - | - |
| A. scirpivora | Nimbya | IRAN 3421C | Iran | Scirpus acutus | - | MT176118 | - | MT187248 | MT187274 | MT187260 |
| A. selini | Radicina | CBS 109382 T | Saudi Arabia | Petroselinum crispum | KC584558 | AF229455 | KC584302 | AY278800 | KC584426 | KC584684 |
| A. septospora | Pseudoulocladium | CBS 109.38 | Italy | Wood | KC584620 | FJ266489 | KC584362 | FJ266500 | KC584487 | KC584747 |
| A. shukurtuzii | Soda | M307 T | Russia | Alkaline soil | KJ443082 | KJ443257 | KJ443127 | KJ649620 | KJ443172 | - |
| A. simsimi | Dianthicola | CBS 115265 T | Argentina | Sesamum indicum | KC584560 | JF780937 | KC584304 | KC584137 | KC584428 | KC584686 |
| A. smyrnii | Radicina | CBS 109380 R | UK | Smyrnium olusatrum | KC584561 | AF229456 | KC584305 | KC584138 | KC584429 | KC584687 |
| A. soliaridae | - | CBS 118387 T | USA | Soil | KC584563 | KC584218 | KC584307 | KC584140 | KC584431 | KC584689 |
| A. sonchi | Sonchi | CBS 119675 R | Canada | Sonchus asper | KC584565 | KC584220 | KC584309 | KC584142 | KC584433 | KC584691 |
| A. tellustris | Embellisia | CBS 538.83 T | USA | Soil | KC584598 | MH861643 | KC584340 | AY562419 | KC584465 | KC584724 |
| A. thalictrigena | - | CBS 121712 T | Germany | Thalictrum sp. | KC584568 | EU040211 | KC584312 | KC584144 | KC584436 | KC584694 |
| A. triglochinicola | Eureka | CBS 119676 T | Australia | Triglochin procera | KC584569 | KC584222 | KC584313 | KC584145 | KC584437 | KC584695 |
| A. tumida | Embellisioides | CBS 539.83 T | Australia | Triticum aestivum | KC584599 | FJ266481 | KC584341 | FJ266493 | KC584466 | KC584725 |
| A. vaccariicola | Gypsophilae | CBS 118714 T | USA | Vaccaria hispanica | KC584571 | KC584224 | KC584315 | KC584147 | KC584439 | KC584697 |
| Alternariaster bidentis | - | CBS 134021 T | Brazil | Bidens sulphurea | - | KC609333 | KC609341 | KC609325 | KC609347 | - |
| Alternariaster helianthi | - | CBS 119672 R | USA | Helianthus sp. | KC584626 | KC609337 | KC584368 | KC609329 | KC584493 | - |
| Amarenomyces ammophilae | - | CBS 114595 | Sweden | Ammophila arenaria | GU296185 | KF766146 | GU301859 | - | GU371724 | - |
| Ascochyta pisi | - | CBS 126.54 | Netherlands | Pisum sativum | EU754038 | - | DQ678070 | - | DQ677967 | - |
| Bipolaris maydis | - | CBS 137271 T | USA | Zea mays | - | AF071325 | KM243280 | KM034846 | - | - |
| Bipolaris oryzae | - | CBS 157.50 | Indonesia | Oryza sativa | - | HF934931 | HF934870 | HG779090 | HF934833 | - |
| Bipolaris sorokiniana | - | CBS 480.74 | South Africa | Tribulus terrestris | - | KJ909771 | KM243282 | KM034827 | - | - |
| Boeremia exigua | - | CBS 431.74 | Netherlands | Solanum tuberosum | EU754084 | FJ427001 | EU754183 | - | GU371780 | - |
| Calophoma complanata | - | CBS 268.92 | Netherlands | Anglica sylvestris | EU754081 | FJ515608 | EU754180 | - | GU371778 | - |
| Chaetosphaeronema hispidulum | - | CBS 216.75 | Germany | Anthyllis vulneraria | EU754045 | KF251148 | EU754144 | - | GU371777 | - |
| Cicatricea salina | - | CBS 302.84 T | North Sea, Skagerrak | Cancer pagurus | KC584583 | JN383486 | KC584325 | JN383467 | KC584450 | KC584709 |
| Cnidariophoma eilatica | - | CPC 44117 T | Israel | Stylophora pistillata | - | OQ628480 | OQ629062 | - | OQ627943 | - |
| Cochliobolus heterostrophus | - | CBS 134.39 | – | Zea mays | AY544727 | DQ491489 | AY544645 | - | DQ247790 | - |
| Comoclathris compressa | - | CBS 156.53 | USA | Castilleja miniata | KC584630 | - | KC584372 | - | KC584497 | - |
| Comoclathris incompta | - | CBS 467.76 | Greece | Olea europaea | GU238220 | - | GU238087 | - | KC584504 | - |
| Comoclathris typhicola | - | CBS 132.69 | Netherlands | Typha angustifolia | JF740105 | - | JF740325 | - | KC584505 | - |
| Curvularia affinis | - | CBS 154.34 T | Java | Manihot utilissima | - | HG778981 | HG779028 | HG779126 | HG779159 | - |
| Curvularia hawaiiensis | - | BRIP 11987 T | USA | Oryza sativa | - | KJ415547 | KJ415502 | KJ415399 | - | - |
| Curvularia lunata | - | CBS 730.96 T | USA | Human lung biopsy | - | JX256429 | JX256396 | JX276441 | HF934813 | - |
| Decorospora gaudefroyi | - | CBS 332.63 | France | Unknown | AF394542 | MH858305 | MH869915 | - | - | - |
| Decorospora gaudefroyi | - | CBS 250.60 | UK | Unknown | - | MH857974 | MH869526 | - | - | - |
| Dichotomophthora lutea | - | CBS 145.57 T | Unknown | Unknown | - | MH857676 | NG069497 | LT990663 | LT990634 | - |
| Dichotomophthora portulacae | - | CBS 174.35 T | Unknown | Unknown | - | NR158421 | MH867137 | LT990668 | LT990638 | - |
| Didymella glomerata | - | CBS 528.66 | Netherlands | Chrysanthemum sp. | EU754085 | FJ427013 | EU754184 | - | GU371781 | - |
| Didymella maydis | - | CBS 588.69 T | USA | Zea mays | EU754093 | FJ427086 | EU754192 | - | GU371782 | - |
| Exserohilum corniculatum | - | BRIP 11426 T | Australia | Oryza sativa | - | LT837453 | LT883391 | LT883533 | LT852480 | - |
| Exserohilum khartoumensis | - | IMI 249194 IsoT | Sudan | Sorghum bicolor var. mayo | - | LT837461 | LT715619 | LT715888 | LT852490 | - |
| Exserohilum turcicum | - | CBS 690.71 ET | Germany | Zea mays | - | LT837487 | LT883415 | LT882581 | - | - |
| Exserohilum turcicum | - | CBS 387.58 | USA | Zea mays | - | MH857820 | LT883412 | LT883554 | LT852514 | - |
| Halojulella avicenniae | - | BCC 18422 | Thailand | Mangrove wood | GU371831 | - | GU371823 | - | GU371787 | - |
| Heterosporicola chenopodii | - | CBS 115.96 | Netherlands | Chenopodium album | EU754089 | JF740227 | EU754188 | - | GU371775 | - |
| Johnalcornia aberrans | - | BRIP 16281 T | Australia | Eragrostis parviflora | - | KJ415522 | KJ415475 | KJ415424 | - | - |
| Leptosphaeria maculans | - | DAOM 229267 | France | Brassica sp. | DQ470993 | KT225526 | DQ470946 | - | DQ470894 | - |
| Leptosphaerulina australis | - | CBS 317.83 | Indonesia | Eugenia aromatica | GU296160 | GU237829 | GU301830 | - | GU371790 | - |
| Loratospora aestuarii | - | JK 5535B | USA | Juncus roemerianus | GU296168 | MH863024 | GU301838 | - | GU371760 | - |
| Neocamarosporium betae | - | CBS 109410 | Netherlands | Beta vulgaris | EU754079 | KY940790 | EU754178 | - | GU371774 | - |
| Neocamarosporium calvescens | - | CBS 246.79 | Germany | Atriplex hastata | EU754032 | KY940774 | EU754131 | - | KC584500 | - |
| Neocamarosporium goegapense | - | CPC 23676 T | South Africa | Mesembryanthemum sp. | - | KJ869163 | KJ869220 | - | - | - |
| Neophaeosphaeria filamentosa | - | CBS 102202 | Mexico | Yucca rostrata | GQ387516 | JF740259 | GQ387577 | - | GU371773 | - |
| Neostemphylium polymorphum | - | FMR 17886 T | Spain | Fluvial sediment | - | OU195609 | OU195892 | OU195960 | OU196009 | ON368192 |
| Neostemphylium polymorphum | - | FMR 17889 | Spain | Fluvial sediment | - | OU195610 | OU195914 | OU195977 | OU196957 | ON368193 |
| Ophiosphaerella herpotricha | - | CBS 620.86 | Switzerland | Bromus erectus | DQ678010 | - | DQ678062 | - | DQ677958 | - |
| Paradendryphiella arenariae | - | CBS 181.58 T | France | Coastal sand | KC793336 | KF156010 | KC793338 | - | DQ470924 | - |
| Paradendryphiella salina | - | CBS 142.60 | UK | Spartina sp. | KC793337 | DQ411540 | KC793339 | - | KC793340 | - |
| Paraleptosphaeria dryadis | - | CBS 643.86 | Switzerland | Dryas octopetala | KC584632 | JF740213 | GU301828 | - | GU371733 | - |
| Phaeosphaeria avenaria | - | DAOM 226215 | Canada | Avena sativa | AY544725 | - | AY544684 | - | DQ677941 | - |
| Phaeosphaeria eustoma | - | CBS 573.86 | Switzerland | Dactylis glomerata | DQ678011 | - | DQ678063 | - | DQ677959 | - |
| Phoma herbarum | - | CBS 276.37 | Sweden | Wood pulp | DQ678014 | - | DQ678066 | - | DQ677962 | - |
| Porocercospora seminalis | - | CBS 134907 | USA | Bouteloua dactyloides | - | HF934941 | HF934862 | - | HF934843 | - |
| Porocercospora seminalis | - | CPC 213.49 | USA | Bouteloua dactyloides | - | HF934945 | HF934861 | - | HF934845 | - |
| Pyrenophora avenicola | - | CBS 307.84 T | Sweden | Avena sp. | - | MK539972 | MK540042 | MK540180 | - | - |
| Pyrenophora phaeocomes | - | DAOM 222769 | Switzerland | Calamagrostis villosa | DQ499595 | JN943649 | DQ499596 | - | DQ497614 | - |
| Scleromyces submersus | - | FMR 18289 T | Spain | Fluvial sediment | - | OU195893 | OU195959 | OU196008 | OU197244 | OU196982 |
| Setomelanomma holmii | - | CBS 110217 | USA | Picea pungens | GU296196 | KT389542 | GU301871 | - | GU371800 | - |
| Stemphylium botryosum | - | CBS 714.68 T | Canada | Medicago sativa | KC584603 | KC584238 | KC584345 | AF443881 | AF107804 | KC584729 |
| Stemphylium vesicarium | - | CBS 191.86 T | India | Medicago sativa | GU238232 | KC584239 | GU238160 | AF443884 | KC584471 | KC584731 |
| Tamaricicola muriformis | - | MFLUCC 150488 | Italy | Tamarix sp. | KU870909 | KU752187 | KU561879 | - | KU820870 | - |
| Tamaricicola muriformis | - | MFLUCC 150489 | Italy | Tamarix sp. | KU870910 | KU752188 | KU729857 | - | - | - |
| Typhicola typharum | - | CBS 145043 NT | Germany | Leaf of Typha sp. | - | MK442590 | MK442530 | - | MK442666 | - |
Table 3.
Phylogenetic information of individual and combined sequence datasets used in phylogenetic analyses.
Table 3.
Phylogenetic information of individual and combined sequence datasets used in phylogenetic analyses.
| Analysis | Region/Gene | Parameter | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Number of Taxa | Total Characters | Constant Sites | Variable Sites | Parsimony Informative Sites | Parsimony Uninformative Sites | AIC Substitution Model * | Lset nst, Rates | −lnL | ||
| First analysis (suborder Pleosporineae) | SSU | 122 | 1373 | 1194 | 179 | 69 | 110 | GTR+I+G | 6, invgamma | 3432.2908 |
| ITS | 158 | 437 | 266 | 171 | 143 | 28 | GTR+I+G | 6, invgamma | 5161.6314 | |
| LSU | 150 | 869 | 686 | 183 | 113 | 70 | GTR+I+G | 6, invgamma | 3733.1211 | |
| GAPDH | 130 | 534 | 302 | 232 | 207 | 25 | GTR+I+G | 6, invgamma | 8174.018 | |
| RPB2 | 150 | 837 | 359 | 478 | 419 | 59 | GTR+I+G | 6, invgamma | 21800.52 | |
| Combined | 167 | 4050 | 2807 | 1243 | 951 | 292 | GTR+I+G | 6, invgamma | 44380.022 | |
| Second analysis (All Alternaria sections) | SSU | 89 | 1022 | 982 | 40 | 27 | 13 | GTR+I | 6, propinv | 1813.347845 |
| ITS | 110 | 457 | 336 | 121 | 95 | 26 | SYM+I+G | 6, invgamma | 2892.446526 | |
| LSU | 93 | 851 | 798 | 53 | 36 | 17 | GTR+I+G | 6, invgamma | 1734.095321 | |
| GAPDH | 110 | 557 | 334 | 223 | 195 | 28 | GTR+I+G | 6, invgamma | 6256.718561 | |
| RPB2 | 103 | 799 | 500 | 299 | 285 | 14 | GTR+I+G | 6, invgamma | 9217.307515 | |
| TEF1 | 100 | 317 | 155 | 162 | 139 | 23 | GTR+I+G | 6, invgamma | 3802.639587 | |
| Combined | 110 | 4003 | 3105 | 898 | 777 | 121 | SYM+I+G | 6, invgamma | 27448.64266 | |
* Akaike Information Criterion Substitution models implemented in Bayesian Inference.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Ahmadpour, A.; Ghosta, Y.; Alavi, Z.; Alavi, F.; Hamidi, L.M.; Rampelotto, P.H. Morphological and Molecular Characterization of a New Section and Two New Species of Alternaria from Iran. Life 2025, 15, 870. https://doi.org/10.3390/life15060870
AMA Style
Ahmadpour A, Ghosta Y, Alavi Z, Alavi F, Hamidi LM, Rampelotto PH. Morphological and Molecular Characterization of a New Section and Two New Species of Alternaria from Iran. Life. 2025; 15(6):870. https://doi.org/10.3390/life15060870
Chicago/Turabian StyleAhmadpour, Abdollah, Youbert Ghosta, Zahra Alavi, Fatemeh Alavi, Leila Mohammadi Hamidi, and Pabulo Henrique Rampelotto. 2025. "Morphological and Molecular Characterization of a New Section and Two New Species of Alternaria from Iran" Life 15, no. 6: 870. https://doi.org/10.3390/life15060870
APA StyleAhmadpour, A., Ghosta, Y., Alavi, Z., Alavi, F., Hamidi, L. M., & Rampelotto, P. H. (2025). Morphological and Molecular Characterization of a New Section and Two New Species of Alternaria from Iran. Life, 15(6), 870. https://doi.org/10.3390/life15060870
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
