The First Morpho-Molecular Study of Shimizuomyces paradoxus in Vietnam: Insights into Fungal Biodiversity in Bidoup National Park
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Specimen Collection
2.2. Morphological Study
2.3. DNA Extraction, PCR Amplification, and Target Sequencing
2.4. Taxa and ITS, nrLSU Sequences Collection, DNA Proofreading and Phylogeny Analysis
3. Results
3.1. Taxonomy
3.2. Distribution
3.3. Typification
3.4. Morphology Observation
3.5. The Amplification of ITS and nrLSU
3.6. Molecular Phylogeny Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wijayawardene, N. Outline of Fungi and fungus-like taxa. Mycosphere 2020, 11, 1060–1456. [Google Scholar] [CrossRef] [Scilit]
- Kirk, P.M.; Cannon, P.; Stalpers, J.; Minter, D.W. Dictionary of the Fungi, 10th ed.; CABI: Wallingford, UK, 2008. [Google Scholar]
- Torres, M.S.; White, J.F. Clavicipitaceae: Free-Living and Saprotrophs to Plant Endophytes. In Encyclopedia of Microbiology; Elsevier: Amsterdam, The Netherlands, 2009; pp. 422–430. [Google Scholar] [CrossRef] [Scilit]
- Kobayasi, Y. Revision of the genus Cordyceps and its allies 1. Bull. Natl. Sci. Mus. Tokyo Ser. B 1981, 7, 1–13. [Google Scholar]
- Johnson, D.; Sung, G.H.; Hywel-Jones, N.L.; Luangsa-Ard, J.J.; Bischoff, J.F.; Kepler, R.M.; Spatafora, J.W. Systematics and evolution of the genus Torrubiella (Hypocreales, Ascomycota). Mycol. Res. 2009, 113, 279–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sung, G.H.; Hywel-Jones, N.L.; Sung, J.M.; Luangsa-ard, J.J.; Shrestha, B.; Spatafora, J.W. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 2007, 57, 5–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sung, G.H.; Shrestha, B.; Park, K.B.; Sung, J.M. Cultural Characteristics of Shimizuomyces paradoxus Collected from Korea. Mycobiology 2010, 38, 189–194. [Google Scholar] [CrossRef] [Scilit]
- Sung, G.H.; Shrestha, B.; Park, K.B.; Han, S.K.; Sung, J.M. Enhancing Effect of Shimizuomyces paradoxus on Seed Germination and Seedling Growth of Canola, Plant Growth of Cucumber, and Harvest of Tomato. Mycobiology 2011, 39, 7–11. [Google Scholar] [CrossRef] [Scilit]
- Kobayasi, Y. Miscellaneous notes of fungi (4). J. Jpn. Bot. 1984, 59, 31–32. [Google Scholar]
- Li, C.R.; Chen, A.H.; Zuo, D.P.; Fan, M.Z.; Li, Z.Z. Species of Cordyceps and Shimizuomyces new to China. Mycosystema 2008, 27, 464–468. [Google Scholar]
- Mai, T.N.; Thuy, T.P.D.; Hong, V.N.; Tawat, T.; Shrestha, B. Morphological and phylogenetic study of Ophiocordyceps sphecocephala and Ophiocordyceps asiana from Vietnam. Appl. Ecol. Environ. Res. 2022, 20, 3995–4009. [Google Scholar] [CrossRef] [Scilit]
- Lao, T.D.; Le, T.A.H.; Truong, N.B. Morphological and genetic characteristics of the novel entomopathogenic fungus Ophiocordyceps langbianensis (Ophiocordycipitaceae, Hypocreales) from Lang Biang Biosphere Reserve, Vietnam. Sci. Rep. 2021, 11, 1412. [Google Scholar] [CrossRef] [Scilit]
- Thuan, L.D.; Dinh, P.T.; Hue, T.H.; Hai, V.H.; Giang, N.V.; Nguyen, T.B.; Thuy, L.H.A. The phylogenetic authentication of Ophiocordyceps sphecocephala from Lang Biang Biosphere Reserve, Lam Dong, Vietnam. Ho Chi Minh City Open Univ. J. Sci. Eng. Technol. 2023, 13, 18–23. [Google Scholar] [CrossRef] [Scilit]
- Thuan, L.D.; Thuy, L.H.A.; Hac, L.C.; Mai, N.H.; Giang, N.V.; Binh Nguyen, T. The first record of Metacordyceps neogunnii (Metacordyceps, Clavicipitaceae) isolated from larva of Lepidoptera in Vietnam: Morphological, phylogenetic characterization and chemical constituent analysis. Vietnam J. Biotechnol. 2022, 20, 317–327. [Google Scholar] [CrossRef] [Scilit]
- Tran, M.H.; Nguyen, T.M.; Huynh, V.B. Diversity evaluation of Cordyceps spp. in Bidoup Nui Ba, Lam Dong province, Vietnam. IOP Conf. Ser. Earth Environ. Sci. 2023, 1155, 012003. [Google Scholar] [CrossRef] [Scilit]
- Chomczynski, P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 1993, 15, 536–537. [Google Scholar]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal Rna Genes for Phylogenetics. In PCR Protocols; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef] [Scilit]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [Scilit]
- Posada, D. jModelTest: Phylogenetic Model Averaging. Mol. Biol. Evol. 2008, 25, 1253–1256. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
- NCBI. Genbank. Available online: https://www.ncbi.nlm.nih.gov/ (accessed on 6 March 2024).
- Luu, H.T.; Hsieh, C.L.; Chuang, C.R.; Tran, N.T.; Vu, N.L.; Chung, K.-F. Langbiangia, a new genus of Gesneriaceae endemic to Langbiang Plateau, southern Vietnam and a taxonomic endeavor to achieve key targets of the post-2020 global biodiversity framework. PLoS ONE 2023, 18, e0284650. [Google Scholar] [CrossRef] [Scilit]
- Lücking, R.; Aime, M.C.; Robbertse, B.; Miller, A.N.; Ariyawansa, H.A.; Aoki, T.; Cardinali, G.; Crous, P.W.; Druzhinina, I.S.; Geiser, D.M.; et al. Unambiguous identification of fungi: Where do we stand and how accurate and precise is fungal DNA barcoding? IMA Fungus 2020, 11, 14. [Google Scholar] [CrossRef] [Scilit]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Fungal Barcoding Consortium; Bolchacova, E.; Voigt, K.; et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [Scilit]
- Lam, K.Y.C.; Chan, G.K.L.; Xin, G.-Z.; Xu, H.; Ku, C.-F.; Chen, J.-P.; Yao, P.; Lin, H.-Q.; Dong, T.T.X.; Tsim, K.W.K. Authentication of Cordyceps sinensis by DNA Analyses: Comparison of ITS Sequence Analysis and RAPD-Derived Molecular Markers. Molecules 2015, 20, 22454–22462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Irinyi, L.; Serena, C.; Garcia-Hermoso, D.; Arabatzis, M.; Desnos-Ollivier, M.; Vu, D.; Cardinali, G.; Arthur, I.; Normand, A.C.; Giraldo, A.; et al. International Society of Human and Animal Mycology (ISHAM)-ITS reference DNA barcoding database—The quality controlled standard tool for routine identification of human and animal pathogenic fungi. Med. Mycol. 2015, 53, 313–337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J. Fungal DNA barcoding. Genome 2016, 59, 913–932. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Target Gene | Primer | Sequence (5′–3′) |
|---|---|---|
| ITS [17] | ITS1F (F) | TCCGTAGGTGAACCTGCGG |
| ITS4 (R) | TCCTCCGCTTATTGATATGC | |
| nrLSU [18] | LROR (F) | GTACCCGCTGAACTTAAGC |
| LR5 (R) | ATCCTGAGGGA AACTTC |
| STT | Taxon | Genus | Strain | ITS | nrLSU |
|---|---|---|---|---|---|
| 1 | Ophiocordyceps cf. acicularis | Ophiocordyceps | NHJ12622 | GU723772 | n/a |
| 2 | Ophiocordyceps acicularis | Ophiocordyceps | OSC128580 | JN049820 | n/a |
| 3 | Claviceps fusiformis | Claviceps | ATCC 26019 | JN049817 | n/a |
| 4 | Claviceps paspali | Claviceps | ATCC 13892 | JN049818 | n/a |
| 5 | Verticillium epiphytum | Verticillium | CBS 154.61 | MH858003 | MH869561 |
| 6 | Verticillium epiphytum | Verticillium | CBS 384.81 | MH861358 | MH873113 |
| 7 | Claviceps purpurea | Claviceps | SS-F26 | KJ529004 | n/a |
| 8 | Claviceps purpurea | Claviceps | PA1 | KX977396 | n/a |
| 9 | Conoideocrella luteorostrata | Conoideocrella | NHJ 12516 | JN049860 | EF468849 |
| 10 | Conoideocrella luteorostrata | Conoideocrella | NHJ 11343 | JN049859 | EF468850 |
| 11 | Shimizuomyces paradoxus | Shimizuomyces | EFCC 6279 | JN049847 | EF469083 |
| 12 | Simplicillium obclavatum | Simplicillium | CBS:311.74 | MH860859 | MH872599 |
| 13 | Ophiocordyceps rhizoidea | Ophiocordyceps | NHJ 12522 | JN049857 | EF468825 |
| 14 | Ophiocordyceps rhizoidea | Ophiocordyceps | BCC 48879 | MH754720 | MH753673 |
| 15 | Ophiocordyceps nigrella | Ophiocordyceps | EFCC 9247 | JN049853 | EF468818 |
| 16 | Ophiocordyceps gracilis | Ophiocordyceps | 2684.S | AJ786563 | n/a |
| 17 | Ophiocordyceps gracilis | Ophiocordyceps | 2685.4 | AJ786564 | n/a |
| 18 | Ophiocordyceps gracilis | Ophiocordyceps | n/a | HM119586 | EF468811 |
| 19 | Ophiocordyceps stylophora | Ophiocordyceps | OSC 111000 | JN049828 | DQ518766 |
| 20 | Beauveria scarabaeicola | Beauveria | ARSEF 5689 | JN049827 | AF339524 |
| 21 | Ophiocordyceps brunneipunctata | Ophiocordyceps | NHJ1491 | GU723777 | n/a |
| 22 | Beauveria caledonica | Beauveria | ARSEF 2567 | HQ880817 | AF339520 |
| 23 | Aschersonia placenta | Hypocrella | BCC 7869 | JN049842 | EF469074 |
| 24 | Aschersonia placenta | Hypocrella | NHJ6225 | DQ365839 | n/a |
| 25 | Simplicillium lanosoniveum | Simplicillium | CBS 704.86 | AJ292396 | AF339553 |
| 26 | Simplicillium lanosoniveum | Simplicillium | IMI 317442 | AJ292395 | AF339554 |
| 27 | Lecanicillium fusisporum | Lecanicillium | CBS:164.70 | MH859538 | MH871316 |
| 28 | Lecanicillium psalliotae | Lecanicillium | CBS 532.81 | JN049846 | AF339560 |
| 29 | Cordyceps kyusyuensis | Cordyceps | HMAS 78115 | EF368021 | n/a |
| 30 | Cordyceps militaris | Cordyceps | OSC 93623 | JN049825 | AY184966 |
| 31 * | Glomerella cingulate | Colletotrichum | NW677b | EU520087 | JN940395 |
| 32 * | Glomerella cingulate | Colletotrichum | Gr212 | FJ904831 | JN940411 |
| The Morphological Characteristics | Shimizuomyces paradoxus | ||||
|---|---|---|---|---|---|
| DL0035 (Current Study, Vietnam) | China [10] | Korea [7] | Japan [9] | ||
| Fruiting bodies | Size | 22–65 mm | 16.7–24 mm | NA | 15–40 mm |
| Stem | 10–15 mm × 1.0–2.0 mm | NA | 4–38 mm | 10–30 mm × 0.5–1.2 mm | |
| Fertile | 9.0–50 mm × 1.5–3.0 mm | 2.2–5.9 mm × 1.2–1.5 mm | 3–17 mm | 5.0–15 mm × 1.0–2.0 mm | |
| Perithecia | 450–500 µm × 200–230 µm | 320–390 µm × 180–270 µm | 300–500 µm × 150–300 µm | 350–400 µm × 200–250 µm | |
| Asci | 100–234 µm × 6.5–7.8 µm | 90–150 µm × 6.5–7 µm | 100–130 µm | 90–130 µm | |
| Ascospore | 65–104 µm Cylindrical, a chain of 5–7 cells. The largest cell: middle, 7.8 µm × 13–15.6 µm in diameter. | 55–87.5 µm × 3–3.5 µm Cylindrical, a chain of 3–14 cells. | 60–70 µm Cylindrical, no information: amount cells. | 60–75 µm × 2–2.5 µm Cylindrical, a chain of 3–7 cells. | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nguyen, G.V.; Nguyen, B.V.; Thieu, H.H.; Nguyen, H.N.; Le, T.A.H.; Truong, N.B.; Lao, T.D. The First Morpho-Molecular Study of Shimizuomyces paradoxus in Vietnam: Insights into Fungal Biodiversity in Bidoup National Park. Life 2025, 15, 644. https://doi.org/10.3390/life15040644
Nguyen GV, Nguyen BV, Thieu HH, Nguyen HN, Le TAH, Truong NB, Lao TD. The First Morpho-Molecular Study of Shimizuomyces paradoxus in Vietnam: Insights into Fungal Biodiversity in Bidoup National Park. Life. 2025; 15(4):644. https://doi.org/10.3390/life15040644
Chicago/Turabian StyleNguyen, Giang Van, Binh Van Nguyen, Hue Hong Thieu, Hanh Ngoc Nguyen, Thuy Ai Huyen Le, Nguyen Binh Truong, and Thuan Duc Lao. 2025. "The First Morpho-Molecular Study of Shimizuomyces paradoxus in Vietnam: Insights into Fungal Biodiversity in Bidoup National Park" Life 15, no. 4: 644. https://doi.org/10.3390/life15040644
APA StyleNguyen, G. V., Nguyen, B. V., Thieu, H. H., Nguyen, H. N., Le, T. A. H., Truong, N. B., & Lao, T. D. (2025). The First Morpho-Molecular Study of Shimizuomyces paradoxus in Vietnam: Insights into Fungal Biodiversity in Bidoup National Park. Life, 15(4), 644. https://doi.org/10.3390/life15040644

