Influence of CYP2B6 Genotype on Methadone Dosage in Patients from the Methadone Maintenance Treatment (MMT) Program in Pereira, Colombia
Abstract
1. Introduction
2. Materials and Methods
2.1. General Considerations
2.2. Inclusion and Exclusion Criteria
2.3. Participants
2.4. Paraclinical Tests
2.5. Genotyping
2.6. Statistical Analyses
3. Results
4. Discussion
5. Limitations of the Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ministerio de Justicia y del Derecho. Estudio Nacional de Consumo de Sustancias Psicoactivas. Colombia 2019. 2019; p. 164. Available online: https://www.odc.gov.co/Portals/1/publicaciones/pdf/estudioNacionaldeconsumo2019.pdf (accessed on 22 October 2022).
- United Nations Office on Drugs and Crime. World Drug Report. World Drug Report 2021. 2021. Available online: https://www.unodc.org/unodc/data-and-analysis/wdr2021.html (accessed on 22 October 2022).
- Connock, M.; Juarez-Garcia, A.; Jowett, S.; Frew, E.; Liu, Z.; Taylor, R.; Fry-Smith, A.; Day, E.; Lintzeris, N.; Roberts, T.; et al. Methadone and buprenorphine for the management of opioid dependence: A systematic review and economic evaluation. Health Technol. Assess. 2007, 11, 1–171, iii–iv. [Google Scholar] [CrossRef] [PubMed]
- Sepúlveda-Arias, J.C.; Isaza, C.; Vélez, J.P. Hepatitis B and C prevalence among heroin addicts in methadone maintenance treatment (MMT) and not in MMT in Pereira, Colombia. J. Infect. Dev. Ctries. 2014, 8, 1228–1230. [Google Scholar] [CrossRef] [PubMed]
- Fareed, A.; Vayalapalli, S.; Stout, S.; Casarella, J.; Drexler, K.; Bailey, S.P. Effect of Methadone Maintenance Treatment on Heroin Craving, a Literature Review. J. Addict. Dis. 2011, 30, 27–38. [Google Scholar] [CrossRef] [PubMed]
- Modesto-Lowe, V.; Brooks, D.; Petry, N. Methadone Deaths: Risk Factors in Pain and Addicted Populations. J. Gen. Intern. Med. 2010, 25, 305–309. [Google Scholar] [CrossRef]
- Kharasch, E.D.; Stubbert, K. Role of Cytochrome P4502B6 in Methadone Metabolism and Clearance. J. Clin. Pharmacol. 2013, 53, 305–313. [Google Scholar] [CrossRef]
- Levran, O.; Peles, E.; Randesi, M.; Shu, X.; Ott, J.; Shen, P.-H.; Adelson, M.; Kreek, M.J. Association of genetic variation in pharmacodynamic factors with methadone dose required for effective treatment of opioid addiction. Pharmacogenomics 2013, 14, 755–768. [Google Scholar] [CrossRef]
- Somogyi, A.A.; Barratt, D.T.; Ali, R.L.; Coller, J.K. Pharmacogenomics of methadone maintenance treatment. Pharmacogenomics 2014, 15, 1007–1027. [Google Scholar] [CrossRef]
- Isaza, C.; Henao, J.; Velez, J.P.; Rodríguez, M.A.; Sierra, J.C.; Beltrán, L.; Sepúlveda, A. Evaluación del programa de mantenimiento con metadona del Hospital Mental de Risaralda. Rev. Colomb. Psiquiatr. 2014, 43, 96–105. [Google Scholar] [CrossRef]
- Ramli, F.F. Pharmacogenomics biomarkers for personalized methadone maintenance treatment: The mechanism and its potential use. Bosn. J. Basic Med Sci. 2021, 21, 145–154. [Google Scholar] [CrossRef]
- Zanger, U.M.; Klein, K. Pharmacogenetics of cytochrome P450 2B6 (CYP2B6): Advances on polymorphisms, mechanisms, and clinical relevance. Front. Genet. 2013, 4, 24. [Google Scholar] [CrossRef]
- Dobrinas, M.; Crettol, S.; Oneda, B.; Lahyani, R.; Rotger, M.; Choong, E.; Lubomirov, R.; Csajka, C.; Eap, C.B. Contribution of CYP2B6 alleles in explaining extreme (S)-methadone plasma levels: A CYP2B6 gene resequencing study. Pharm. Genom. 2013, 23, 84–93. [Google Scholar] [CrossRef]
- Kharasch, M.E.D.; Regina, M.K.J.; Blood, R.J.; Friedel, B.C. Methadone Pharmacogenetics: CYP2B6 Polymorphisms Determine Plasma Concentrations, Clearance, and Metabolism. Anesthesiology 2015, 123, 1142–1153. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.-C.; Ho, I.-K.; Tsou, H.-H.; Tian, J.-N.; Hsiao, C.-F.; Chen, C.-H.; Tan, H.K.-L.; Lin, L.; Wu, C.-S.; Su, L.-W.; et al. CYP2B6 Polymorphisms Influence the Plasma Concentration and Clearance of the Methadone S-Enantiomer. J. Clin. Psychopharmacol. 2011, 31, 463–469. [Google Scholar] [CrossRef] [PubMed]
- Mangó, K.; Kiss, F.; Fekete, F.; Erdős, R.; Monostory, K. CYP2B6 allelic variants and non-genetic factors influence CYP2B6 enzyme function. Sci. Rep. 2022, 12, 2984. [Google Scholar] [CrossRef] [PubMed]
- Afjeh, S.S.A.; Boshehri, B.; Hamednia, S.; Amini, A.; Mashayekhi, P.; Omrani, M.D.; Laboratory, T.S.M.G. Investigating the CYP2B6 rs3745274 and rs3211371 polymorphisms in Methadone-Responder and Non-Responder Addicts in Iran. Iran. Biomed. J. 2021, 25, 220–225. [Google Scholar] [CrossRef]
- Chawar, C.; Hillmer, A.; Lamri, A.; Kapczinski, F.; Thabane, L.; Pare, G.; Samaan, Z. Implications of OPRM1 and CYP2B6 variants on treatment outcomes in methadone-maintained patients in Ontario: Exploring sex differences. PLoS ONE 2021, 16, e0261201. [Google Scholar] [CrossRef]
- Kelley, K.W. NIH public access policy. Brain Behav. Immun. 2008, 22, 629. [Google Scholar] [CrossRef]
- Kelly, S.M.; O’Grady, K.E.; Mitchell, S.G.; Brown, B.S.; Schwartz, R.P. Predictors of methadone treatment retention from a multi-site study: A survival analysis. Drug Alcohol Depend. 2011, 117, 170–175. [Google Scholar] [CrossRef]
- Krantz, M.J.; Martin, J.; Stimmel, B.; Mehta, D.; Haigney, M.C. QTc Interval Screening in Methadone Treatment. Ann. Intern. Med. 2009, 150, 387–395. [Google Scholar] [CrossRef]
- Packiasabapathy, S.; Aruldhas, B.W.; Horn, N.; Overholser, B.R.; Quinney, S.K.; Renschler, J.S.; Sadhasivam, S. Pharmacogenomics of methadone: A narrative review of the literature. Pharmacogenomics 2020, 21, 871–887. [Google Scholar] [CrossRef]
- Isaza, C.; Henao, J.; Beltrán, L.; Porras-Hurtado, L.; Gonzalez, M.; Cruz, R.; Carracedo, A. Genetic variants associated with addictive behavior in Colombian addicted and non-addicted to heroin or cocaine. Colomb. Med. 2013, 44, 19–25. [Google Scholar] [CrossRef]
- Wang, P.-W.; Wu, H.-C.; Yen, C.-N.; Yeh, Y.-C.; Chung, K.-S.; Chang, H.-C.; Yen, C.-F. Change in Quality of Life and Its Predictors in Heroin Users Receiving Methadone Maintenance Treatment in Taiwan: An 18-Month Follow-Up Study. Am. J. Drug Alcohol Abus. 2012, 38, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Coller, J.K.; Hutchinson, M.R. Implications of central immune signaling caused by drugs of abuse: Mechanisms, mediators and new therapeutic approaches for prediction and treatment of drug dependence. Pharmacol. Ther. 2012, 134, 219–245. [Google Scholar] [CrossRef] [PubMed]
- Proctor, S.L.; Copeland, A.L.; Kopak, A.M.; Hoffmann, N.G.; Herschman, P.L.; Polukhina, N. Predictors of patient retention in methadone maintenance treatment. Psychol. Addict. Behav. 2015, 29, 906–917. [Google Scholar] [CrossRef] [PubMed]
- Fathollahi, M.S.; Torkashvand, F.; Najmeddin, H.; Rezaeian, M. Predictors of One-Year Retention in Methadone Maintenance Treatment (MMT) in Iran, Rafsanjan. Int. J. High Risk Behav. Addict. 2016, 5, e29121. [Google Scholar] [CrossRef]
- Katz, D.F.; Sun, J.; Khatri, V.; Kao, D.; Bucher-Bartelson, B.; Traut, C.; Lundin-Martinez, J.; Goodman, M.; Mehler, P.S.; Krantz, M.J. QTc Interval Screening in an Opioid Treatment Program. Am. J. Cardiol. 2013, 112, 1013–1018. [Google Scholar] [CrossRef]
- Juba, K.M.; Khadem, T.M.; Hutchinson, D.J.; Brown, J.E. Methadone and Corrected QT Prolongation in Pain and Palliative Care Patients: A Case–Control Study. J. Palliat. Med. 2017, 20, 722–728. [Google Scholar] [CrossRef]
- Titus-Lay, E.N.; Jaynes, H.A.; Muensterman, E.T.; Walroth, T.A.; Ott, C.A.; Desta, Z.; Williams, G.; Moe, P.R.; Wilbrandt, M.; Tisdale, J.E. Methadone-associated QT interval prolongation in patients undergoing maintenance therapy in an urban opioid treatment program. Pharmacother. J. Hum. Pharmacol. Drug Ther. 2021, 41, 238–246. [Google Scholar] [CrossRef]
- Hassamal, S.; Fernandez, A.; Rekabdarkolaee, H.M.; Pandurangi, A. QTc Prolongation in Veterans With Heroin Dependence on Methadone Maintenance Treatment. Int. J. High Risk Behav. Addict. 2015, 4, e23819. [Google Scholar] [CrossRef]
- Zerdazi, E.-H.; Vorspan, F.; Marees, A.T.; Naccache, F.; Lepine, J.-P.; Laplanche, J.-L.; Prince, N.; Marie-Claire, C.; Bellivier, F.; Mouly, S.; et al. QT length during methadone maintenance treatment: Gene × dose interaction. Fundam. Clin. Pharmacol. 2018, 33, 96–106. [Google Scholar] [CrossRef]
- Bart, G.; Wyman, Z.; Wang, Q.; Hodges, J.S.; Karim, R.; Bart, B.A. Methadone and the QTc Interval: Paucity of Clinically Significant Factors in a Retrospective Cohort. J. Addict. Med. 2017, 11, 489–493. [Google Scholar] [CrossRef] [PubMed]
- Pani, P.P.; Trogu, E.; Maremmani, I.; Pacini, M. QTc interval screening for cardiac risk in methadone treatment of opioid dependence. Cochrane Database Syst. Rev. 2013, CD008939. [Google Scholar] [CrossRef] [PubMed]
- Peles, E.; Linzy, S.; Kreek, M.J.; Adelson, M. Prospective Study of QTc Changes Among Former Opiate Addicts Since Admission to Methadone Maintenance Treatment: Benzodiazepine risk. J. Addict. Med. 2013, 7, 428–434. [Google Scholar] [CrossRef] [PubMed]
- Eap, C.B.; Crettol, S.; Rougier, J.-S.; Schläpfer, J.; Grilo, L.S.; Déglon, J.-J.; Besson, J.; Croquette-Krokar, M.; Carrupt, P.-A.; Abriel, H. Stereoselective Block of hERG Channel by (S)-Methadone and QT Interval Prolongation in CYP2B6 Slow Metabolizers. Clin. Pharmacol. Ther. 2007, 81, 719–728. [Google Scholar] [CrossRef]
- Hajj, A.; Ksouda, K.; Peoc’H, K.; Curis, E.; Messali, A.; Deveaux, L.L.; Bloch, V.; Prince, N.; Mouly, S.; Scherrmann, J.-M.; et al. KCNH2 polymorphism and methadone dosage interact to enhance QT duration. Drug Alcohol Depend. 2014, 141, 34–38. [Google Scholar] [CrossRef]
- Fonseca, F.; Torrens, M. Pharmacogenetics of Methadone Response. Mol. Diagn. Ther. 2018, 22, 57–78. [Google Scholar] [CrossRef]
- Crist, R.C.; Clarke, T.-K.; Berrettini, W.H. Pharmacogenetics of Opioid Use Disorder Treatment. CNS Drugs 2018, 32, 305–320. [Google Scholar] [CrossRef]
- Talal, A.H.; Ding, Y.; Venuto, C.S.; Chakan, L.M.; McLeod, A.; Dharia, A.; Morse, G.D.; Brown, L.S.; Markatou, M.; Kharasch, E.D. Toward precision prescribing for methadone: Determinants of methadone deposition. PLoS ONE 2020, 15, e0231467. [Google Scholar] [CrossRef]
- Hall, W.D.; Mattick, R.P. Clinical update: Codeine maintenance in opioid dependence. Lancet 2007, 370, 550–552. [Google Scholar] [CrossRef]
- Gadel, S.; Crafford, A.; Regina, K.; Kharasch, E.D. MethadoneN-Demethylation by the CommonCYP2B6Allelic Variant CYP2B6.6. Drug Metab. Dispos. 2013, 41, 709–713. [Google Scholar] [CrossRef]
- Dennis, B.B.; Bawor, M.; Thabane, L.; Sohani, Z.; Samaan, Z. Impact of ABCB1 and CYP2B6 Genetic Polymorphisms on Methadone Metabolism, Dose and Treatment Response in Patients with Opioid Addiction: A Systematic Review and Meta-Analysis. PLoS ONE 2014, 9, e86114. [Google Scholar] [CrossRef] [PubMed]
- Levran, O.; Peles, E.; Hamon, S.; Randesi, M.; Adelson, M.; Kreek, M.J. CYP2B6 SNPs are associated with methadone dose required for effective treatment of opioid addiction. Addict. Biol. 2013, 18, 709–716. [Google Scholar] [CrossRef] [PubMed]
- Hung, C.-C.; Chiou, M.-H.; Huang, B.-H.; Hsieh, Y.-W.; Hsieh, T.-J.; Huang, C.-L.; Lane, H.-Y. Impact of genetic polymorphisms in ABCB1, CYP2B6, OPRM1, ANKK1 and DRD2 genes on methadone therapy in Han Chinese patients. Pharmacogenomics 2011, 12, 1525–1533. [Google Scholar] [CrossRef] [PubMed]
- Crettol, S.; Déglon, J.J.; Besson, J.; Croquette-Krokkar, M.; Gothuey, I.; Hämmig, R.; Monnat, M.; Hüttemann, H.; Baumann, P.; Eap, C.B. Methadone enantiomer plasma levels, CYP2B6, CYP2C19, and CYP2C9 genotypes, and response to treatment. Clin. Pharmacol. Ther. 2005, 78, 593–604. [Google Scholar] [CrossRef] [PubMed]
- Fonseca, F.; De La Torre, R.; Díaz, L.; Pastor, A.; Cuyàs, E.; Pizarro, N.; Khymenets, O.; Farré, M.; Torrens, M. Contribution of Cytochrome P450 and ABCB1 Genetic Variability on Methadone Pharmacokinetics, Dose Requirements, and Response. PLoS ONE 2011, 6, e19527. [Google Scholar] [CrossRef]
- Chen, C.-H.; Wang, S.-C.; Tsou, H.-H.; Ho, I.-K.; Tian, J.-N.; Yu, C.-J.; Hsiao, C.-F.; Chou, S.-Y.; Lin, Y.-F.; Fang, K.-C.; et al. Genetic polymorphisms in CYP3A4 are associated with withdrawal symptoms and adverse reactions in methadone maintenance patients. Pharmacogenomics 2011, 12, 1397–1406. [Google Scholar] [CrossRef]
- Chou, Y.-C.; Shih, S.-F.; Tsai, W.-D.; Li, C.-S.R.; Xu, K.; Lee, T.S.-H. Improvement of quality of life in methadone treatment patients in northern Taiwan: A follow-up study. BMC Psychiatry 2013, 13, 190–198. [Google Scholar] [CrossRef]
- Gottlieb, A.; Bakos-Block, C.; Langabeer, J.R.; Champagne-Langabeer, T. Sociodemographic and Clinical Characteristics Associated with Improvements in Quality of Life for Participants with Opioid Use Disorder. Healthcare 2022, 10, 167. [Google Scholar] [CrossRef]
- De Maeyer, J.; van Nieuwenhuizen, C.; Bongers, I.L.; Broekaert, E.; Vanderplasschen, W. Profiles of quality of life in opiate-dependent individuals after starting methadone treatment: A latent class analysis. Int. J. Drug Policy 2013, 24, 342–350. [Google Scholar] [CrossRef]
- Dobler-Mikola, A.; Hättenschwiler, J.; Meili, D.; Beck, T.; Böni, E.; Modestin, J. Patterns of heroin, cocaine, and alcohol abuse during long-term methadone maintenance treatment. J. Subst. Abus. Treat. 2005, 29, 259–265. [Google Scholar] [CrossRef]
- Tran, B.X.; Boggiano, V.L.; Thi Nguyen, H.L.; Nguyen, L.H.; Nguyen, H.V.; Hoang, C.D.; Le, H.T.; Tran, T.D.; Le, H.Q.; Latkin, C.A.; et al. Concurrent drug use among methadone maintenance patients in mountainous areas in northern Vietnam. BMJ Open 2018, 8, e015875. [Google Scholar] [CrossRef] [PubMed]
- Di Nunno, N.; Esposito, M.; Argo, A.; Salerno, M.; Sessa, F. Pharmacogenetics and Forensic Toxicology: A New Step towards a Multidisciplinary Approach. Toxics 2021, 9, 292. [Google Scholar] [CrossRef] [PubMed]
- Almeida-González, M.; Boada, L.D.; Burillo-Putze, G.; Henríquez-Hernández, L.A.; Luzardo, O.P.; Quintana-Montesdeoca, M.P.; Zumbado, M. Ethanol and Medical Psychotropics Co-Consumption in European Countries: Results from a Three-Year Retrospective Study of Forensic Samples in Spain. Toxics 2023, 11, 45. [Google Scholar] [CrossRef] [PubMed]
Gene | SNP | Forward (5′-3′) | Reverse (5′-3′) | SBE (5′-3′) |
---|---|---|---|---|
ABCB1 | rs1045642 | TATGTTGGCCTCCTTTGCTG | GCTGAGAACATTGCCTATGG | ATGACGTTGAGTGGCCAATCACCTGTTCA |
CYP2B6 | rs3745274 | TCGGTCTGCCCATCTATAAA | TGATTCTTCACATGTCTGCG | ATGACGTTGGATGACGTTGGATGGTTGGATTGTCTTGCTGGCACCCAAT |
OPRM1 | rs1799971 | GGGTCAACTTGTCCCACTTA | TGATGGCCGTGATCATGGAG | GATGACGTTGGATGACGTTGAGTGGACTTCGGGATGGGA |
Characteristic | Conventional Group (n = 34) | Pharmacogenetic Group (n = 38) | p-Value |
---|---|---|---|
Age (years) | 24.6 ± 5 | 23 ± 4 | 0.15 |
Gender (male/female) | 29/5 | 34/4 | 0.59 |
Body mass index | 20.4 ± 2.3 | 20.2 ± 2.1 | 0.61 |
Creatinine | 1.0 ± 0.15 | 1.0 ± 0.12 | 0.85 |
Transaminases: | |||
Glutamic-pyruvic | 31 ± 20 | 38 ± 32 | 0.32 |
Glutamic-oxaloacetic | 33 ± 20 | 38 ± 29 | 0.33 |
Schooling | |||
Low education | 1 | 2 | 0.57 |
Medium education | 30 | 30 | |
Higher education | 3 | 6 | |
Marital status | |||
Single or separated | 32 | 34 | 0.48 |
Married or cohabiting | 2 | 4 | |
Cohabitation | |||
Live alone | 2 | 2 | 0.91 |
Live with family | 32 | 36 | |
Employment (yes/no) | 10/24 | 12/36 | 0.84 |
Psychiatric history (yes/no) | 6/28 | 11/27 | 0.26 |
Current mental illness (yes/no) | 1/33 | 3/35 | 0.36 |
Anxiety at the start (yes/no) | 18/16 | 12/26 | 0.18 |
Criminal history (yes/no) | 26/8 | 29/9 | 0.99 |
Age of first heroin use (years) | 19.3 ± 4.9 | 18.1 ± 3.5 | 0.23 |
Route of administration of heroin: | |||
Inhaled | 19 | 20 | 0.78 |
Intravenous | 15 | 18 | |
Previous methadone treatments | 0.5 ± 0.7 | 0.6 ± 0.8 | 0.47 |
Family history of abuse (yes/no) | 29/5 | 27/11 | 0.15 |
Cocaine dependence (yes/no) | 15/19 | 12/26 | 0.27 |
Cannabis dependence (yes/no) | 25/9 | 26/12 | 0.63 |
Nicotine dependence (yes/no) | 31/3 | 34/4 | 0.81 |
Observation Times | Conventional Group (n = 34) | Pharmacogenetic Group (n = 38) | p-Value |
---|---|---|---|
Week 2 | 47.1 | 39.5 | 0.52 |
Week 3 | 45.2 | 34.4 | 0.38 |
Week 4 | 33.3 | 36.7 | 0.79 |
Week 5 | 28.6 | 17.9 | 0.34 |
Week 7 | 30.8 | 14.8 | 0.17 |
Week 9 | 34.6 | 14.8 | 0.09 |
Week 12 | 16.0 | 8.0 | 0.38 |
Observation Times | Conventional Group (n = 34) | Pharmacogenetic Group (n = 38) | p-Value |
---|---|---|---|
Week 0 | |||
Marijuana | 73.5 | 68.4 | 0.63 |
Cocaine/crack | 44.1 | 31.6 | 0.27 |
Week 2 | |||
Marijuana | 65.6 | 64.9 | 0.95 |
Cocaine/crack | 15.6 | 13.9 | 0.84 |
Week 5 | |||
Marijuana | 63.0 | 66.7 | 0.78 |
Cocaine/crack | 11.1 | 10.7 | 0.96 |
Week 7 | |||
Marijuana | 64.0 | 69.2 | 0.69 |
Cocaine/crack | 12.0 | 14.8 | 0.77 |
Week 9 | |||
Marijuana | 68.0 | 80.8 | 0.29 |
Cocaine/crack | 20.0 | 7.4 | 0.28 |
Observation Times | Homozygous | Allele Carrier T | p-Value |
---|---|---|---|
GG | GT + TT | ||
Week 2 | 63 ± 8 | 50 ± 12 | 0.001 |
Week 3 | 62 ± 9 | 49 ± 11 | 0.002 |
Week 4 | 62 ± 9 | 49 ± 12 | 0.005 |
Week 5 | 62 ± 9 | 54 ± 8 | 0.024 |
Week 7 | 63 ± 11 | 54 ± 8 | 0.022 |
Week 9 | 61 ± 13 | 52 ± 10 | 0.050 |
Week 12 | 61 ± 14 | 51 ± 10 | 0.050 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Isaza, C.; Castaño-Ramírez, O.M.; Vélez, J.P.; Henao, J.; Beltrán-Angarita, L.; Sepúlveda-Arias, J.C. Influence of CYP2B6 Genotype on Methadone Dosage in Patients from the Methadone Maintenance Treatment (MMT) Program in Pereira, Colombia. Life 2023, 13, 1038. https://doi.org/10.3390/life13041038
Isaza C, Castaño-Ramírez OM, Vélez JP, Henao J, Beltrán-Angarita L, Sepúlveda-Arias JC. Influence of CYP2B6 Genotype on Methadone Dosage in Patients from the Methadone Maintenance Treatment (MMT) Program in Pereira, Colombia. Life. 2023; 13(4):1038. https://doi.org/10.3390/life13041038
Chicago/Turabian StyleIsaza, Carlos, Oscar Mauricio Castaño-Ramírez, Juan Pablo Vélez, Julieta Henao, Leonardo Beltrán-Angarita, and Juan Carlos Sepúlveda-Arias. 2023. "Influence of CYP2B6 Genotype on Methadone Dosage in Patients from the Methadone Maintenance Treatment (MMT) Program in Pereira, Colombia" Life 13, no. 4: 1038. https://doi.org/10.3390/life13041038
APA StyleIsaza, C., Castaño-Ramírez, O. M., Vélez, J. P., Henao, J., Beltrán-Angarita, L., & Sepúlveda-Arias, J. C. (2023). Influence of CYP2B6 Genotype on Methadone Dosage in Patients from the Methadone Maintenance Treatment (MMT) Program in Pereira, Colombia. Life, 13(4), 1038. https://doi.org/10.3390/life13041038