Next Article in Journal
The Effect of Environment on the Evolution and Proliferation of Protocells of Increasing Complexity
Next Article in Special Issue
Comprehensive Transcriptome Analysis Reveals Sex-Specific Alternative Splicing Events in Zebrafish Gonads
Previous Article in Journal
A High-Pressure, High-Temperature Flow Reactor Simulating the Hadean Earth Environment, with Application to the Pressure Dependence of the Cleavage of Avocado Viroid Hammerhead Ribozyme
Previous Article in Special Issue
DNA Methylation Difference between Female and Male Ussuri Catfish (Pseudobagrus ussuriensis) in Brain and Gonad Tissues
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Spinyhead Croaker Germ Cells Gene dnd Visualizes Primordial Germ Cells in Medaka

1
Key Laboratory of Integrated Rice-Fish Farming, Ministry of Agriculture and Rural Affairs, Shanghai Ocean University, Shanghai 201306, China
2
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai 201306, China
3
Main Building, QiLu Innovalley Incubator, High-Tech Industry Development Zone, Jinan 250101, China
4
Zhejiang Provincial Engineering Technology Research Center of Marine Biomedical Products, School of Food Science and Pharmaceutics, Zhejiang Ocean University, Zhoushan 316022, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Life 2022, 12(8), 1226; https://doi.org/10.3390/life12081226
Submission received: 6 July 2022 / Revised: 5 August 2022 / Accepted: 8 August 2022 / Published: 12 August 2022

Abstract

Highlights

  • Cldnd was specifically expressed in adult gonads.
  • Cldnd RNA was enriched in spermatogonia and early oocytes and decreased with gametogenesis.
  • Gfp-Cldnd 3′ UTR mRNA could identify primordial germ cells in medaka.

Abstract

Spinyhead croaker (Collichthys lucidus) is an economically important fish suffering from population decline caused by overfishing and habitat destruction. Researches on the development of primordial germ cell (PGC) and reproduction biology were an emergency for the long-term conservation of the involved species. Dead end (dnd) gene plays an indispensable role in PGC specification, maintenance, and development. In the current study, we report the cloning and expression patterns of dnd in C. lucidus (Cldnd). RT-PCR analysis revealed that Cldnd was specifically expressed in both sexual gonads. In the ovary, Cldnd RNA was uniformly distributed in the oocytes and abundant in oogonia, and gradually decreased with oogenesis. A similar expression pattern was also detected in testis. Dual fluorescent in situ hybridization of Cldnd and Clvasa demonstrated that they almost had the same distribution except in oocytes at stage I, in which the vasa RNA aggregated into some particles. Furthermore, Cldnd 3′ UTR was sufficient to guide the Green Fluorescent Protein (GFP) specifically and stably expressed in the PGCs of medaka. These findings offer insight into that Cldnd is an evolutionarily conserved germline-specific gene and even a potential candidate for PGC manipulation in C. lucidus.

Graphical Abstract

1. Introduction

Primordial germ cells (PGCs) are the germline precursor which are specified from somatic cells and migrate into the genital ridges, ensuring population and intergenerational inheritance of genetic information. The specification, migration, proliferation, and differentiation of PGCs are precisely regulated by a sophisticated molecular network. As well, it has been demonstrated that a number of functional genes play critical roles in the development of PGCs [1,2]. Among these, dead end (dnd) gene attaches attention not only for its indispensable role in PGC development, but also for its successful application to prepare germ cell-deficient recipients for germ cell transplantation [3].
Dnd was initially identified in zebrafish as an RNA-binding protein that is specifically expressed in germ cells causing aberrant PGC migration and germ cell-deficient when blocked by specific antisense morpholinos [4]. Additionally, homologous dnd genes are characterized in diverse vertebrates, such as mice (Mus musculus) [5], frog (Xenopus laevis) [6], chickens (Gallus gallus) [7], medaka (Oryzias latipes) [8], Chinese sturgeon (Acipenser sinensis) [9], gibel carp (Carassius Gibelio) [10], orange-spotted grouper (Epinephelus coioides) [11] and Celebes medaka (Oryzias celebensis) [12]. All these studies suggest that dnd is primarily expressed in PGCs during embryogenesis, but it is shown sexually dimorphic in adult gonads across species. In mice, dnd is only detectable in testis [5], whereas it is restricted to the ovary in frog [6]. Dnd occurs in germ cells of both sexes in medaka [8], zebrafish (Danio rerio) [4], carp (Carassius gibelio) [10], turbot (Scophthalmus maximus) [13] and starry flounder (Platichthys stellatus) [14].
It is proven that dnd is essential for primordial germ cell (PGC) specification, maintenance, and development. In mice, dnd mutation causes germ cell loss or testicular germ cell tumors [5]. Dnd knockdown leads to abnormal migration and loss of PGCs in frogs [6] and zebrafish [4,15,16]. Especially in medaka, dnd is a specifier that can abolish or increase the PGC in a dosage-dependent manner [1]. Dnd is of great importance in the capability of the PGCs fate protection from somatic differentiation [16,17]. Dnd has been broadly used to produce PGC-deficiency individuals for the application of surrogate broodstock technology (SBT) in some teleosts, such as medaka [18], Atlantic cod (Gadus morhua) [19], olive flounder (Paralichthys olivaceus) [20], carp [21,22], grouper [11], salmon (Salmo salar) [23] and rainbow trout (Oncorhynchus mykiss) [24]. The SBT [18,25,26,27] is recognized as a promising approach for preventing endangered species or expanding valuable fish species from suffering population decline. Furthermore, the fact that rescue of dnd crispant embryos enables inherited sterile offspring production benefits the actual application of sterile fish as an approach to avoid genetic introgression in the aquaculture industry [28].
Spinyhead croaker (Collichthys lucidus) is an economically important fish in the east coastal areas and estuaries of China. Due to its delicious taste and high nutritional value, it is popular among other fish species [29]. The market-oriented demand that ascends gradually pushes up the price of C. lucidus and leads to its population decline due to overfishing [30]. Therefore, large-scale artificial reproduction is imperative to compensate for the limited natural reproductive rate. Nevertheless, research on C. lucidus is mainly limited to morphology, immune-related gene identification, population genetics, genome assembly, and transcriptome assembly with few reports on sex determination [29,31,32,33,34,35,36]. In the previous study, C. lucidus germ cells marker gene vasa was isolated by us [37]. In the present study, another gem cells gene dnd(Cldnd) was cloned, and ClDnd protein was highly conserved across species. Cldnd was only expressed in the germ cells of both sexual. Furthermore, Cldnd 3′ UTR was sufficient to guide the Green Fluorescent Protein (GFP) specifically and stably expressed in the PGCs in medaka, suggesting that Cldnd is an evolutionarily conserved germline-specific gene and even a potential candidate for PGC manipulation in C. lucidus.

2. Materials and Methods

2.1. Fish and Sampling

C. lucidus were sampled from the East China Sea in Ningde, Fujian province, China. For the total RNA extraction, tissue samples from the kidney, gill, intestines, brain, heart, ovary and testis were immediately collected and flash-frozen in liquid nitrogen. Gonad tissues were fixed for the frozen section. The O. latipes was kept at 26 °C in a 14-h light/10-h dark cycle and its embryos were maintained and staged as described [38]. All experiments were conducted in strict accordance with the guidance of the Committee for Laboratory Animal Research at Shanghai Ocean University.

2.2. RNA Isolation and cDNA Synthesis

Total RNA was isolated from the adult tissues mentioned above by using TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA), and the integrity of the RNA was detected by 1% agarose gel electrophoresis with ethidium bromide (EB) staining. The first-strand cDNA was synthesized with 1 μg total RNA and oligo dT18 primers following the manufacturer’s manual for the M-MLV reverse transcription kit (Takara, Shiga, Japan). Additionally, using BD SMART® RACEs kit (Clontech, Beijing, China), two cDNA libraries from the ovary and testis were constructed for the full-length sequence amplification.

2.3. Molecular Cloning and Analysis of C. lucidus dnd Gene

To identify the full-length sequence of Cldnd, the classic RACEs approach was performed. Briefly, according to the conserved amino acid sequences (WEFRLMM and MAKKVLVE) of Dnd protein, a pair of degenerate primers were designed to explore the corresponding fragment of Cldnd (Figure 1A). Subsequently, specific RACEs primers were designed based on the above fragment to amplify the 5′ and 3′ cDNA ends of Cldnd by using BD SMART® RACEs kit (Clontech). All the primers used in the present research were listed in Table 1. Finally, the full-length mRNA sequence of Cldnd was assembled via DNAMAN and aligned to the Dnd protein across the examined species by Vector NTI Suite 11.0 (Invitrogen). Dnd proteins in vertebrates, from teleosts, amphibians to mammals, were achieved from NCBI (https://www.ncbi.nlm.nih.gov/protein) to investigate ClDnd conservatism in evolution. Afterwards, the phylogenetic tree was constructed by the neighbor-joining method based on Mega 7.0 package.

2.4. RT-PCR

To confirm the tissue distribution of Cldnd, a pair of gene-specific primers targeting to its coding sequence (CDS) together with β-actin as an internal control was designed and RT-PCR was carried out by using Ex-Taq® (Takara, Beijing, China). PCR program was performed in a 25 μL reaction system for 28 cycles: denaturation at 95 °C for 20 s, annealing at 58 °C for 20 s, and extension at 72 °C for 1 min.

2.5. Cryosection and In Situ Hybridization

Spinyhead croaker gonads were fixed with 4% paraformaldehyde, and then were sliced into 6 μm. To investigate the subcellular location of Cldnd RNA, in situ hybridization (SISH) and dual fluorescence in situ hybridization (FISH), which could hybridize labeled probes with nucleic acids in cells or tissues, were performed as described [39,40]. Plasmid (pT-Cldnd) was constructed by inserting CDS of Cldnd into the pGEM-T vector. Then, pT-Cldnd was linearized for sense and antisense RNA probes from SP6 polymerase by using FITC RNA Labeling Kit (Roche, Basel, Switzerland). Clvasa probe labeled by digoxigenin (DIG) was prepared as described previously [37].

2.6. Preparation of Chimeric mRNAs and Microinjection

The recombinant plasmid of pCSpfCldnd 3′ UTR (gfp-Cldnd 3′ UTR) was constructed by replacing the Clvasa 3′ UTR (amplified by primers Clu-dnd 3UF and 3UR) with Cldnd 3′ UTR in pCSpfClvasa 3′ UTR (gfp-Clvasa 3′ UTR) [37]. The plasmid, pCSchDrnos1 3′ UTR (rfp-Drnos1 3′ UTR), was described [12]. Capped mRNAs used for microinjection were synthesized by using the mMessage Machine kit (Amibtion) from linearized gfp-Cldnd 3′ UTR and rfp-Drnos1 3′ UTR. Two chimeric mRNAs were co-injected at 100 ng/μL concentration into one-cell stage embryos from medaka for PGCs visualization.

2.7. Microscopy

Observation and photography were carried out on Nikon SMZ25 and Ni-E microscope with Nikon Ds-Ri2 camera (Nikon, Tokyo, Japan) as described [39].

3. Results

3.1. Cloning and Characterization of Cldnd

By the approach combining degenerate PCR with RACEs, a 1377 bp Cldnd complementary (c) DNA (GenBank accession No. MK547285) in full-length containing a 32 bp 5′ UTR, a 244 bp 3′ UTR and a 1098 bp CDS that encodes 366 amino acids was obtained (Figure S1). Multiple alignment analysis showed that ClDnd had a high identity with Dnd orthologs across species, ranging from 97.2% in large yellow croaker to 79.6% in medaka (Figure 1A). In addition, by the blast to the Conserved Domain Database (CDD) (https://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml), it was found that the deduced ClDnd protein carried six conserved domains or motifs, including N-terminal region (NR), RNA recognition motif (RRM) and four C-terminal regions (CR1-4), which were typically present in Dnd protein (Figure 1A and Figure S1).
The molecular phylogenetic tree demonstrated that Dnd proteins formed two distinct clades, which were the fish clade and the other vertebrates’, and ClDnd was the closest with that of the large yellow croaker in the fish sub-clade (Figure 1B).

3.2. Cldnd RNA Is Specifically Expressed in Germ Cells

As described above, dnd is a gene which is specifically expressed in germ cells [41]. The RT-PCR analysis of seven distinct organs in C. lucidus revealed that only in the testis and ovary, bands corresponding to Cldnd RNA were shown, but absent in other somatic tissues such as the brain, kidney, liver, gill, and intestines (Figure 2A). Furthermore, SISH was carried out to investigate the subcellular localization of Cldnd RNA in the gonads. In the ovary, Cldnd signals were intensely expressed in oocyte I and were easily detected in oocyte II. As oogenesis progressed, the signals in stage III oocytes weakened and eventually vanished (Figure 2B). In the testis, Cldnd RNA was abundant in spermatogonia, then reduced markedly in primary spermatocytes and was faint in secondary spermatocytes, and finally disappeared in spermatozoon and sperm (Figure 2C and Figure 3A). On the contrary, the sense probe was unable to detect any signal (data not shown). According to the findings, Cldnd RNA was only found in male and female germ cells.
In several species, including C. lucidus, vasa is referred to as the best-characterized germ cell marker [37,42]. In this study, Clvasa was selected to explore the Cldnd RNA expression patterns. By FISH, Cldnd and Clvasa RNA showed the same expression pattern in the testis (Figure 3A–F). In the ovary, Cldnd RNA was as weak as Clvasa in oogonia, but it was uniformly distributed in the cytoplasm of oocyte I, while Clvasa aggregated into some particles (Figure 4A–C).

3.3. Cldnd 3′ UTR Enables GFP to Express in the PGCs of Medaka Stably

There is a potential mechanism that enables foreign proteins to be stably and specifically expressed in germ cells under the protection of the 3′ UTR that is isolated from some germplasm-specific genes, of which the 3′ UTR of nanos1 from zebrafish is the first candidate in fish, and has been widely verified and used for PGCs visualization in diverse species [43]. In order to confirm whether Cldnd 3′ UTR was responsible for the localization of mRNA and labeled PGCs, gfp-Cldnd 3′ UTR mRNA was injected into fertilized medaka embryos with rfp-Drnos1 3′ UTR mRNA which could effectively visualize PGCs [43]. At the early stage of embryogenesis, the GFP signals were distributed all over the cells (data not shown). Until the mid-gastrula stage, it turned into some intense particles and accumulated on the peripheral margin on both sides of the embryonic shield (body) (Figure 5B). At the somitogenesis stage, cells with positive GFP signal migrated dorsally aligned bilaterally along the trunk at the two sides of the embryonic body (Figure 5F,J). Finally, these cells migrated along the embryo body to the genital ridge, the position where gonads formed under the interaction of germ cells and mesoderm (Figure 5N). Meanwhile, the RFP signal (Figure 5C,G,K,O) displayed a similar expression pattern as GFP, suggesting that gfp-Cldnd 3′ UTR mRNA could label the PGCs of medaka (Figure 5D,H,L,P). When observed at high magnification, most of the PGCs with GFP signal was positive for RFP expression as well (Figure 5M′–P′).

4. Discussion

In this study, we obtain full-length of Cldnd cDNA and analyze its RNA expression in adult gonads. In addition, SISH and dual-color FISH demonstrate that Cldnd RNA is exclusively expressed in the germ cells of both sexes and shows a similar expression pattern with Clvasa. Surprisingly, medaka PGCs can be visualized by the injection of gfp-Cldnd 3′ UTR mRNA and dnd is identified as the second germline marker gene in C. lucidus.
Dnd protein multiple alignment analysis manifests that ClDnd protein shows high identity to others, especially large yellow croaker. Moreover, ClDnd protein possesses the conserved motifs and domains (NR, RRM and CR1-4) similar to many examined fishes. RRM has been reported to be able to determine the subcellular localization of Dnd [44]. In zebrafish, the active site of Dnd protein exists in the C terminal domain which is required for the survival of PGCs [45]. Based on phylogenetic tree analysis of the Dnd protein, two main clades are found in vertebrates, and C. lucidus Dnd homologue is the closest to that of large yellow croaker in the fish sub-clade.
In most vertebrates, dnd homologues are expressed only in both ovary and testis, except frog dnd, which is specific to the ovary [6]. Notably, in some teleost fish, the expression levels of dnd are higher in the ovary than testis [46,47,48]. However, in adults, the results of RT-PCR demonstrate that Cldnd RNA is exclusive and displays a similar expression level in both sexual gonads, which is consistent with the expression pattern in medaka [8] and zebrafish [4].
Dnd RNA as a marker for germ cells of both sexes has been identified in many teleost fish. Based on our previous reports in C. lucidus, we have identified germ cells marker gene vasa which is significant for germ cell development during gamogenesis. In the present study, SISH was performed to reveal the subcellular localization of Cldnd RNA, whose phenomenon is in keeping with zebrafish [4], medaka [8], turbot [13] and carp [21,22], suggesting that the Cldnd RNA expression is germ cell-specific. Moreover, dual color FISH is used to compare precisely the RNA expression patterns between Cldnd and Clvasa. The results of co-localization show that there is almost no difference between Cldnd and Clvasa in the testis, which is in line with the expression pattern in summer flounder (Paralichthys dentatus) [49]. In the ovary, Cldnd RNA is always uniformly distributed in the cytoplasm of germ cells, which differs from the specific expression of Clvasa in oocytes of stage I. These results indicate that Cldnd plays an important role in germ cell development.
Numerous studies have reported that the fusion of the gfp/rfp reporter gene and 3′ UTR of several germline-specific genes is very stable in PGCs but gradually degradative in somatic cells [50]. What more convincing explanation made for this biological characteristic is that the Dnd protein interacts with microRNA (miR-430) to protect gonadal-specific genes from degradation [1,13,51]. For example, hub 3′ UTR contains four noncanonical binding sites of miR-430 which is also a target of global miRNA-mediate repression. Interestingly, the function of germ-plasm specific genes is conserved widely across fish species. For instance, 3′ UTR of zebrafish nanos1 can not only visualize its own PGCs but most of the examined fish, such as medaka, Chinese sturgeon, and salmon [1,9,39,52]. In this study, gfp-Cldnd 3′ UTR mRNA and rfp-Drnos1 3′ UTR mRNA are co-injected into medaka embryos and show a similar expression pattern in the PGCs during embryogenesis, which means that gfp-Cldnd 3′ UTR mRNA successfully marks medaka PGCs. Cldnd 3′ UTR is found in existence of several noncanonical miR-430 binding sites (-UCGUGAAA-) which may be responsible for the characteristic that eliminates the gfp-Cldnd 3′ UTR mRNA from somatic cells. Thus, Cldnd 3′ UTR is conserved for PGCs specific visualization.
In summary, these results manifest that dnd is an evolutionarily conserved germ cells marker and plays a vital role in the reproductive development of C. lucidus. The sequence structure, expression pattern, and function of 3′ UTR of Cldnd are highly similar to that in the examined species. These findings not only provide another germ cell maker but also benefit the functional and practical research on Cldnd and conservation of the C. lucidus population.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/life12081226/s1, Figure S1: Nucleotide and deduced amino acid sequence of Cldnd; Figure S2: gfp-dnd 3′ UTR reporter.

Author Contributions

Conceptualization, Experimental designing, and Project administration: M.L., C.X. and Y.L.; Methodology: C.X. and Y.L.; Supervision: M.L. and C.X.; Writing—original draft: C.X. and Z.W.; Writing—review and editing: C.X., M.L., L.G. and M.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key R&D Program of China (2018YFD0901205) and the National Natural Science Foundation of China (31672700).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and it was approved by the Shanghai Ocean University Animal Care and Use Committee, with approval number SHOU-2021-118, which was approved in March 2021.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest. The company had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

References

  1. Hong, N.; Li, M.; Yuan, Y.; Wang, T.; Yi, M.; Xu, H.; Zeng, H.; Song, J.; Hong, Y. Dnd Is a Critical Specifier of Primordial Germ Cells in the Medaka Fish. Stem Cell Rep. 2016, 6, 411–421. [Google Scholar] [CrossRef] [PubMed]
  2. Bleckwehl, T.; Rada-Iglesias, A. Transcriptional and epigenetic control of germline competence and specification. Curr. Opin. Cell Biol. 2019, 61, 1–8. [Google Scholar] [CrossRef] [PubMed]
  3. Yoshizaki, G.; Takashiba, K.; Shimamori, S.; Fujinuma, K.; Shikina, S.; Okutsu, T.; Kume, S.; Hayashi, M. Production of germ cell-deficient salmonids by dead end gene knockdown, and their use as recipients for germ cell transplantation. Mol. Reprod. Dev. 2016, 83, 298–311. [Google Scholar] [CrossRef] [PubMed]
  4. Weidinger, G.; Stebler, J.; Slanchev, K.; Dumstrei, K.; Wise, C.; Lovell-Badge, R.; Thisse, C.; Thisse, B.; Raz, E. dead end, a novel vertebrate germ plasm component, is required for zebrafish primordial germ cell migration and survival. Curr. Biol. 2003, 13, 1429–1434. [Google Scholar] [CrossRef]
  5. Youngren, K.K.; Coveney, D.; Peng, X.; Bhattacharya, C.; Schmidt, L.S.; Nickerson, M.L.; Lamb, B.T.; Deng, J.M.; Behringer, R.R.; Capel, B.; et al. The Ter mutation in the dead end gene causes germ cell loss and testicular germ cell tumours. Nature 2005, 435, 360–364. [Google Scholar] [CrossRef] [PubMed]
  6. Horvay, K.; Claussen, M.; Katzer, M.; Landgrebe, J.; Pieler, T. Xenopus Dead end mRNA is a localized maternal determinant that serves a conserved function in germ cell development. Dev. Biol. 2006, 291, 1–11. [Google Scholar] [CrossRef]
  7. Aramaki, S.; Sato, F.; Kato, T.; Soh, T.; Kato, Y.; Hattori, M.A. Molecular cloning and expression of dead end homologue in chicken primordial germ cells. Cell Tissue Res. 2007, 330, 45–52. [Google Scholar] [CrossRef]
  8. Liu, L.; Hong, N.; Xu, H.; Li, M.; Yan, Y.; Purwanti, Y.; Yi, M.; Li, Z.; Wang, L.; Hong, Y. Medaka dead end encodes a cytoplasmic protein and identifies embryonic and adult germ cells. Gene Expr. Patterns 2009, 9, 541–548. [Google Scholar] [CrossRef]
  9. Yang, X.; Yue, H.; Ye, H.; Li, C.; Wei, Q. Identification of a germ cell marker gene, the dead end homologue, in Chinese sturgeon Acipenser sinensis. Gene 2015, 558, 118–125. [Google Scholar] [CrossRef]
  10. Li, S.Z.; Liu, W.; Li, Z.; Wang, Y.; Zhou, L.; Yi, M.S.; Gui, J.F. Molecular characterization and expression pattern of a germ cell marker gene dnd in gibel carp (Carassius gibelio). Gene 2016, 591, 183–190. [Google Scholar] [CrossRef]
  11. Sun, Z.H.; Zhou, L.; Li, Z.; Liu, X.C.; Li, S.S.; Wang, Y.; Gui, J.F. Sexual dimorphic expression of dnd in germ cells during sex reversal and its requirement for primordial germ cell survival in protogynous hermaphroditic grouper. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2017, 208–209, 47–57. [Google Scholar] [CrossRef] [PubMed]
  12. Zhu, T.; Gui, L.; Zhu, Y.; Li, Y.; Li, M. Dnd is required for primordial germ cell specification in Oryzias celebensis. Gene 2018, 679, 36–43. [Google Scholar] [CrossRef] [PubMed]
  13. Lin, F.; Zhao, C.Y.; Xu, S.H.; Ma, D.Y.; Xiao, Z.Z.; Xiao, Y.S.; Xu, C.A.; Liu, Q.H.; Li, J. Germline-specific and sexually dimorphic expression of a dead end gene homologue in turbot (Scophthalmus maximus). Theriogenology 2013, 80, 665–672. [Google Scholar] [CrossRef] [PubMed]
  14. Yoon, J.H.; Cho, Y.S.; Lee, H.B.; Park, J.Y.; Lim, H.K. Dead-End (dnd) Gene Cloning and Gonad-Specific Expression Pattern in Starry Flounder (Platichthys stellatus). Animals 2021, 11, 2256. [Google Scholar] [CrossRef] [PubMed]
  15. Hashimoto, Y.; Maegawa, S.; Nagai, T.; Yamaha, E.; Suzuki, H.; Yasuda, K.; Inoue, K. Localized maternal factors are required for zebrafish germ cell formation. Dev. Biol. 2004, 268, 152–161. [Google Scholar] [CrossRef]
  16. Gross-Thebing, T.; Yigit, S.; Pfeiffer, J.; Reichman-Fried, M.; Bandemer, J.; Ruckert, C.; Rathmer, C.; Goudarzi, M.; Stehling, M.; Tarbashevich, K.; et al. The Vertebrate Protein Dead End Maintains Primordial Germ Cell Fate by Inhibiting Somatic Differentiation. Dev. Cell. 2017, 43, 704–715.e5. [Google Scholar] [CrossRef]
  17. Hou, M.; Feng, K.; Luo, H.; Jiang, Y.; Xu, W.; Li, Y.; Song, Y.; Chen, J.; Tao, B.; Zhu, Z.; et al. Complete Depletion of Primordial Germ Cells Results in Masculinization of Monopterus albus, a Protogynous Hermaphroditic Fish. Mar. Biotechnol. 2022, 24, 320–334. [Google Scholar] [CrossRef]
  18. Li, M.; Hong, N.; Xu, H.; Song, J.; Hong, Y. Germline replacement by blastula cell transplantation in the fish medaka. Sci. Rep. 2016, 6, 29658. [Google Scholar] [CrossRef]
  19. Skugor, A.; Tveiten, H.; Krasnov, A.; Andersen, O. Knockdown of the germ cell factor Dead end induces multiple transcriptional changes in Atlantic cod (Gadus morhua) hatchlings. Anim. Reprod. Sci. 2014, 144, 129–137. [Google Scholar] [CrossRef]
  20. Wang, X.; Liu, Q.; Xiao, Y.; Yang, Y.; Wang, Y.; Song, Z.; You, F.; An, H.; Xiao, Z.; Xu, S.; et al. The dnd RNA Identifies Germ Cell Origin and Migration in Olive Flounder (Paralichthys olivaceus). Biomed. Res. Int. 2015, 2015, 428591. [Google Scholar]
  21. Li, M.; Zhu, F.; Li, Z.; Hong, N.; Hong, Y. Dazl is a critical player for primordial germ cell formation in medaka. Sci. Rep. 2016, 6, 28317. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, W.; Li, S.Z.; Li, Z.; Wang, Y.; Li, X.Y.; Zhong, J.X.; Zhang, X.J.; Zhang, J.; Zhou, L.; Gui, J.F. Complete depletion of primordial germ cells in an All-female fish leads to Sex-biased gene expression alteration and sterile All-male occurrence. BMC Genom. 2015, 16, 971. [Google Scholar] [CrossRef] [PubMed]
  23. Wargelius, A.; Leininger, S.; Skaftnesmo, K.O.; Kleppe, L.; Andersson, E.; Taranger, G.L.; Schulz, R.W.; Edvardsen, R.B. Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon. Sci. Rep. 2016, 6, 21284. [Google Scholar] [CrossRef]
  24. Fujihara, R.; Katayama, N.; Sadaie, S.; Miwa, M.; Sanchez Matias, G.A.; Ichida, K.; Fujii, W.; Naito, K.; Hayashi, M.; Yoshizaki, G. Production of Germ Cell-Less Rainbow Trout by dead end Gene Knockout and their Use as Recipients for Germ Cell Transplantation. Mar. Biotechnol. 2022, 24, 417–429. [Google Scholar] [CrossRef]
  25. Takeuchi, Y.; Yoshizaki, G.; Takeuchi, T. Biotechnology: Surrogate broodstock produces salmonids. Nature 2004, 430, 629–630. [Google Scholar] [CrossRef] [PubMed]
  26. Yoshizaki, G.; Fujinuma, K.; Iwasaki, Y.; Okutsu, T.; Shikina, S.; Yazawa, R.; Takeuchi, Y. Spermatogonial transplantation in fish: A novel method for the preservation of genetic resources. Comp. Biochem. Physiol. Part D Genom. Proteom. 2011, 6, 55–61. [Google Scholar] [CrossRef]
  27. Ye, H.; Li, C.J.; Yue, H.M.; Du, H.; Yang, X.G.; Yoshino, T.; Hayashida, T.; Takeuchi, Y.; Wei, Q.W. Establishment of intraperitoneal germ cell transplantation for critically endangered Chinese sturgeon Acipenser sinensis. Theriogenology 2017, 94, 37–47. [Google Scholar] [CrossRef]
  28. Guralp, H.; Skaftnesmo, K.O.; Kjaerner-Semb, E.; Straume, A.H.; Kleppe, L.; Schulz, R.W.; Edvardsen, R.B.; Wargelius, A. Rescue of germ cells in dnd crispant embryos opens the possibility to produce inherited sterility in Atlantic salmon. Sci. Rep. 2020, 10, 18042. [Google Scholar] [CrossRef] [PubMed]
  29. Cheng, J.; Ma, G.Q.; Miao, Z.Q.; Shui, B.N.; Gao, T.X. Complete mitochondrial genome sequence of the spinyhead croaker Collichthys lucidus (Perciformes, Sciaenidae) with phylogenetic considerations. Mol. Biol. Rep. 2012, 39, 4249–4259. [Google Scholar] [CrossRef] [PubMed]
  30. Cheng, Y.; Wang, R.; Xu, T. The mitochondrial genome of the spinyhead croaker Collichthys lucida: Genome organization and phylogenetic consideration. Mar. Genom. 2011, 4, 17–23. [Google Scholar] [CrossRef]
  31. Sang, C.; Lin, Y.; Jiang, K.; Zhang, F.; Ma, C.; Ma, L.; Song, W. Molecular cloning and expression analysis of MyD88 in spiny head croaker, Collichthys lucidus. Genet. Mol. Res. 2015, 14, 4666–4676. [Google Scholar] [CrossRef] [PubMed]
  32. Song, W.; Jiang, K.J.; Zhang, F.Y.; Wang, J.; Ma, L.B. Characterization, molecular cloning, and expression analysis of Ecsit in the spinyhead croaker, Collichthys lucidus. Genet. Mol. Res. 2016, 15, gmr7193. [Google Scholar] [CrossRef] [PubMed]
  33. Cai, M.; Zou, Y.; Xiao, S.; Li, W.; Han, Z.; Han, F.; Xiao, J.; Liu, F.; Wang, Z. Chromosome assembly of Collichthys lucidus, a fish of Sciaenidae with a multiple sex chromosome system. Sci. Data 2019, 6, 132. [Google Scholar] [CrossRef] [PubMed]
  34. Song, W.; Zhang, Y.; Zhang, X.; Gui, J. De novo transcriptome assembly of four organs of Collichthys lucidus and identification of genes involved in sex determination and reproduction. PLoS ONE 2020, 15, e0230580. [Google Scholar] [CrossRef]
  35. Xiao, J.; Zou, Y.; Xiao, S.; Chen, J.; Wang, Z.; Wang, Y.; Jie, X.; Cai, M. Development of a PCR-based genetic sex identification method in spinyhead croaker (Collichthys lucidus). Aquaculture 2020, 522, 735130. [Google Scholar] [CrossRef]
  36. Liu, F.; Zhou, L.; Zhang, J.; Wang, Y.; Wang, Z.; Liu, X.; Cai, M. Genome-wide identification and transcriptome-based expression profiling of the Sox gene family in the spinyhead croaker (Collichthys lucidus). J. Fish Biol. 2022, 100, 15–24. [Google Scholar] [CrossRef]
  37. Li, Y.; Song, W.; Zhu, Y.F.; Zhu, T.Y.; Ma, L.B.; Li, M.Y. Evolutionarily conserved vasa identifies embryonic and gonadal germ cells in spinyhead croaker Collichthys lucidus. J. Fish Biol. 2019, 94, 772–780. [Google Scholar] [CrossRef]
  38. Iwamatsu, T. Stages of normal development in the medaka Oryzias latipes. Mech. Dev. 2004, 121, 605–618. [Google Scholar] [CrossRef]
  39. Li, M.; Hong, N.; Gui, J.; Hong, Y. Medaka piwi is essential for primordial germ cell migration. Curr. Mol. Med. 2012, 12, 1040–1049. [Google Scholar] [CrossRef]
  40. Yuan, C.; Chen, K.; Zhu, Y.; Yuan, Y.; Li, M. Medaka igf1 identifies somatic cells and meiotic germ cells of both sexes. Gene 2018, 642, 423–429. [Google Scholar] [CrossRef]
  41. Baloch, A.R.; Franek, R.; Saito, T.; Psenicka, M. Dead-end (dnd) protein in fish-a review. Fish Physiol. Biochem. 2021, 47, 777–784. [Google Scholar] [CrossRef] [PubMed]
  42. Chen, X.; Zhu, Y.; Zhu, T.; Song, P.; Guo, J.; Zhong, Y.; Gui, L.; Li, M. Vasa identifies germ cells in embryos and gonads of Oryzias celebensis. Gene 2022, 823, 146369. [Google Scholar] [CrossRef] [PubMed]
  43. Saito, T.; Fujimoto, T.; Maegawa, S.; Inoue, K.; Tanaka, M.; Arai, K.; Yamaha, E. Visualization of primordial germ cells in vivo using GFP-nos1 3′UTR mRNA. Int. J. Dev. Biol. 2006, 50, 691–699. [Google Scholar] [CrossRef] [PubMed]
  44. Maris, C.; Dominguez, C.; Allain, F.H. The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression. FEBS J. 2005, 272, 2118–2131. [Google Scholar] [CrossRef]
  45. Liu, W.; Collodi, P. Zebrafish dead end possesses ATPase activity that is required for primordial germ cell development. FASEB J. 2010, 24, 2641–2650. [Google Scholar] [CrossRef]
  46. Krovel, A.V.; Olsen, L.C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 2004, 271, 190–197. [Google Scholar] [CrossRef][Green Version]
  47. Xue, T.; Yu, M.; Pan, Q.; Wang, Y.; Fang, J.; Li, L.; Deng, Y.; Chen, K.; Wang, Q.; Chen, T. Black carp vasa identifies embryonic and gonadal germ cells. Dev. Genes Evol. 2017, 227, 231–243. [Google Scholar] [CrossRef]
  48. Ricci, J.M.B.; Martinez, E.R.M.; Butzge, A.J.; Doretto, L.B.; Oliveira, M.A.; Bombardelli, R.A.; Bogerd, J.; Nobrega, R.H. Characterization of vasa homolog in a neotropical catfish, Jundia (Rhamdia quelen): Molecular cloning and expression analysis during embryonic and larval development. Gene 2018, 654, 116–126. [Google Scholar] [CrossRef]
  49. Du, S.; Zhou, L.; Wang, X.; Xu, S.; Li, J.; Song, Z.; Liu, Q. Characterization of vasa and dnd homologs in summer flounder, Paralichthys dentatus: Expression analysis and colocalization of PGCs during embryogenesis. Theriogenology 2022, 181, 180–189. [Google Scholar] [CrossRef]
  50. Giraldez, A.J.; Mishima, Y.; Rihel, J.; Grocock, R.J.; Van Dongen, S.; Inoue, K.; Enright, A.J.; Schier, A.F. Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science 2006, 312, 75–79. [Google Scholar] [CrossRef]
  51. Kedde, M.; Strasser, M.J.; Boldajipour, B.; Oude Vrielink, J.A.; Slanchev, K.; le Sage, C.; Nagel, R.; Voorhoeve, P.M.; van Duijse, J.; Orom, U.A.; et al. RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. Cell 2007, 131, 1273–1286. [Google Scholar] [CrossRef] [PubMed]
  52. Nagasawa, K.; Fernandes, J.M.; Yoshizaki, G.; Miwa, M.; Babiak, I. Identification and migration of primordial germ cells in Atlantic salmon, Salmo salar: Characterization of vasa, dead end, and lymphocyte antigen 75 genes. Mol. Reprod. Dev. 2013, 80, 118–131. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Multiple alignment and phylogenetic tree of Dnd proteins. (A) Multiple alignment of Dnd proteins. Species and overall sequence identity values compared to the ClDnd protein were at the end of the alignment. RNA recognition motif (RRM) and five conserved regions were indicated in the frame (black). (B) Phylogenetic tree of Dnd proteins. Bootstrap values were given. Accession numbers followed organism.
Figure 1. Multiple alignment and phylogenetic tree of Dnd proteins. (A) Multiple alignment of Dnd proteins. Species and overall sequence identity values compared to the ClDnd protein were at the end of the alignment. RNA recognition motif (RRM) and five conserved regions were indicated in the frame (black). (B) Phylogenetic tree of Dnd proteins. Bootstrap values were given. Accession numbers followed organism.
Life 12 01226 g001
Figure 2. Cldnd RNA expression. (A) RT-PCR analysis of Cldnd in adult tissues. (B,C) Ovarian and testicular cryosections using antisense Cldnd probe and the signals were visualized by chromogenic staining. sc1 and sc2, primary and secondary spermatocytes; st, spermatid; I–III, stages of oocytes. Scale bar, 200 μm.
Figure 2. Cldnd RNA expression. (A) RT-PCR analysis of Cldnd in adult tissues. (B,C) Ovarian and testicular cryosections using antisense Cldnd probe and the signals were visualized by chromogenic staining. sc1 and sc2, primary and secondary spermatocytes; st, spermatid; I–III, stages of oocytes. Scale bar, 200 μm.
Life 12 01226 g002
Figure 3. Co-localization of Cldnd and Clvasa mRNA in testis. Dual color FISH with Cldnd and Clvasa antisense RNA probes on testis and the signals were visualized by fluorescence staining. Nuclei were stained with DAPI (blue). (A) The signals were stained for the dnd RNA (green) by FISH. (B) The vasa signals were stained red. (C) The merges of vasa with dnd and DAPI. (DF) Larger Magnification of panels C (white frame), highlighting the different cells. sg, spermatogonia; sc1 and sc2, primary and secondary spermatocytes; st, spermatid. Scale bar, 200 μm.
Figure 3. Co-localization of Cldnd and Clvasa mRNA in testis. Dual color FISH with Cldnd and Clvasa antisense RNA probes on testis and the signals were visualized by fluorescence staining. Nuclei were stained with DAPI (blue). (A) The signals were stained for the dnd RNA (green) by FISH. (B) The vasa signals were stained red. (C) The merges of vasa with dnd and DAPI. (DF) Larger Magnification of panels C (white frame), highlighting the different cells. sg, spermatogonia; sc1 and sc2, primary and secondary spermatocytes; st, spermatid. Scale bar, 200 μm.
Life 12 01226 g003
Figure 4. Co-localization of Cldnd and Clvasa mRNA in ovary. Dual color FISH with Cldnd and Clvasa antisense RNA probes on ovary and the signals were visualized by fluorescence staining. Nuclei were stained with DAPI (blue). (A) The signals were stained for the dnd RNA (green) by FISH. (B) The vasa signals were stained red. (C) The merges of vasa with dnd and DAPI. og, oogonia; I–II, stages of oocytes. Scale bar, 200 μm.
Figure 4. Co-localization of Cldnd and Clvasa mRNA in ovary. Dual color FISH with Cldnd and Clvasa antisense RNA probes on ovary and the signals were visualized by fluorescence staining. Nuclei were stained with DAPI (blue). (A) The signals were stained for the dnd RNA (green) by FISH. (B) The vasa signals were stained red. (C) The merges of vasa with dnd and DAPI. og, oogonia; I–II, stages of oocytes. Scale bar, 200 μm.
Life 12 01226 g004
Figure 5. Visualization of PGCs by Cldnd 3′ UTR. (AP) Medaka PGCs were visualized by co-injection of gfp-Cldnd 3′ UTR mRNA and rfp-Drnos 3′ UTR mRNA during embryogenesis. The merged images are shown on the right (D,H,L,P). (M’P’) An isolated gonad was squashed and visualized at high magnification. Concentrations of injected mRNA are all 100 ng/μL. Scale bar, 200 μm.
Figure 5. Visualization of PGCs by Cldnd 3′ UTR. (AP) Medaka PGCs were visualized by co-injection of gfp-Cldnd 3′ UTR mRNA and rfp-Drnos 3′ UTR mRNA during embryogenesis. The merged images are shown on the right (D,H,L,P). (M’P’) An isolated gonad was squashed and visualized at high magnification. Concentrations of injected mRNA are all 100 ng/μL. Scale bar, 200 μm.
Life 12 01226 g005
Table 1. Sequences of primers used in the present study.
Table 1. Sequences of primers used in the present study.
PrimerSequence (5′ to 3′ Direction)Purpose
Clu-dnd DFTGGGAGTTCAGGCTCATGATGDegenerate primer
Clu-dnd DRTCNACNARNACYTTYTTNGCCAT
Clu-dnd 3NFACGCTGGAGGAAGCTTGGCAGGC3′ RACE
Clu-dnd 3FGAGATTCACTACAGCCACACCGAG
Clu-dnd 5NRCTTGAGTCAGCTTTGTATTGG5′ RACE
Clu-dnd 5RTGGTCCTCCATACTTCCTCTG
Clu-dnd FATGATGGACCCCAAGCAGAGCCRT-PCR
Clu-dnd RGTTGGTGAACCGACTGTT
β-actin FTTTCAACAGCCCTGCCAT GTACInternal control
β-actin RCCTCCAATCCAGACAGAGTATT
Clu-dnd 3UFctcgagCTTGGGTTCAGAGGATATG3′ UTR
Clu-dnd 3URggtaccCCTTTTAAATCTCATTTA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Xu, C.; Li, Y.; Wen, Z.; Jawad, M.; Gui, L.; Li, M. Spinyhead Croaker Germ Cells Gene dnd Visualizes Primordial Germ Cells in Medaka. Life 2022, 12, 1226. https://doi.org/10.3390/life12081226

AMA Style

Xu C, Li Y, Wen Z, Jawad M, Gui L, Li M. Spinyhead Croaker Germ Cells Gene dnd Visualizes Primordial Germ Cells in Medaka. Life. 2022; 12(8):1226. https://doi.org/10.3390/life12081226

Chicago/Turabian Style

Xu, Cong, Yu Li, Zhengshun Wen, Muhammad Jawad, Lang Gui, and Mingyou Li. 2022. "Spinyhead Croaker Germ Cells Gene dnd Visualizes Primordial Germ Cells in Medaka" Life 12, no. 8: 1226. https://doi.org/10.3390/life12081226

APA Style

Xu, C., Li, Y., Wen, Z., Jawad, M., Gui, L., & Li, M. (2022). Spinyhead Croaker Germ Cells Gene dnd Visualizes Primordial Germ Cells in Medaka. Life, 12(8), 1226. https://doi.org/10.3390/life12081226

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop