The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish Inspection and Samples’ Collection
2.2. Collection of the Plant Extract
2.3. Chemical Composition of Illicium verum Extract
2.4. HPLC Phenolic Profiling of Star Anise Extract
2.5. Volatile Compounds in Star Anise Essential Oil by GC-Mass
2.6. LC50 of Illicium verum on L. cyprinacea
2.7. Demonstration of the Effect of the Illicium verum on L. cyprinacea by SEM
2.8. In Vivo Parasiticidal Efficacy of the Illicium verum
2.9. Evaluation of Biological Parameters
2.10. Extraction of mRNA
2.11. Determination of Cytokines
2.12. Total Protein Evaluation in Fish
2.13. Statistical Evaluation
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Goodwin, A.E. Massive Lernaea cyprinacea infestations damaging the gills of channel catfish polycultured with bighead carp. J. Aquat. Anim. Health 1999, 11, 406–408. [Google Scholar] [CrossRef]
- Hassan, M.; Beatty, S.; Morgan, D.; Doupé, R.; Lymbery, A. An introduced parasite, Lernaea cyprinacea L., found on native freshwater fishes in the south west of Western Australia. J. R. Soc. West. Aust. 2008, 91, 149–153. [Google Scholar]
- Avenant-Oldewage, A. 21 Lernaea cyprinacea and related species. In Fish Diseases: Pathobiology and Protection; Patrick, T., Woo, K., Buchmann, K., Eds.; CABI: Wallingford, UK, 2012; 337p. [Google Scholar]
- Koyun, M.; Ulupinar, M.; Mart, A. First Record of Lernaea cyprinacea L. 1758 (Copepoda: Cyclopoida) on Cyprinion macrostomus Heckel, 1843 from Eastern Anatolia, Turkey. Biharean Biol. 2015, 9, 44–46. [Google Scholar]
- Piasecki, W.; Goodwin, A.E.; Eiras, J.C.; Nowak, B.F. Importance of Copepoda in freshwater aquaculture. Zool. Stud. 2004, 43, 193–205. [Google Scholar]
- Raissy, M.; Sohrabi, H.; Rashedi, M.; Ansari, M. Investigation of a parasitic outbreak of Lernaea cyprinacea Linnaeus (Crustacea: Copepoda) in cyprinid fish from choghakhor lagoon. Afr. Zool. 2013, 12, 680–688. [Google Scholar]
- Abbas, F.; Ashraf, M.; Hafeez-ur-Rehman, M.; Iqbal, K.J.; Abbas, S.; Javid, A. Lernaea susceptibility, infestation and its treatment in indigenous major and exotic Chinese carps under polyculture system. Pak. J. Zool. 2014, 46, 1215–1222. [Google Scholar]
- Hossain, M.; Rahman, M.; Islam, M.; Alam, M.; Rahman, H. Lernaea (anchor worm) investigations in fish. Int. J. Anim. Fish Sci. 2013, 1, 12–19. [Google Scholar]
- Singh, R.; Raghavendra, A.; Sridhar, N.; Raghunath, M.; Eknath, A. Comparative susceptibility of carp fingerlings to Lernaea cyprinacea infection. Vet. Parasitol. 2011, 178, 156–162. [Google Scholar]
- Cruz-Lacierda, E.R.; De la Peña, L.; Lumanlan-Mayo, S. The use of chemicals in aquaculture in the Philippines. In Use of Chemicals in Aquaculture in Asia, Proceedings of the Meeting on the Use of Chemicals in Aquaculture in Asia, Tigbauan, Iloilo, Philippines, 20–22 May 1996; Aquaculture Department, Southeast Asian Fisheries Development Center: Iloilo, Philippines, 2000; pp. 155–184. [Google Scholar]
- Idris, H.; Amba, M. A note on Lernaea cyprinacea parasitizing the cultured marble goby Oxyeleotris marmorata and their control with salinity modification. Adv. Environ. Biol. 2011, 5, 817–820. [Google Scholar]
- Abumelha, H.M.; Alkhatib, F.; Alzahrani, S.; Abualnaja, M.; Alsaigh, S.; Alfaifi, M.Y.; Althagafi, I.; El-Metwaly, N. Synthesis and characterization for pharmaceutical models from Co (II), Ni (II) and Cu (II)-thiophene complexes; apoptosis, various theoretical studies and pharmacophore modeling. J. Mol. Liq. 2021, 328, 115483. [Google Scholar] [CrossRef]
- Abou-Kassem, D.E.; Mahrose, K.M.; El-Samahy, R.A.; Shafi, M.E.; El-Saadony, M.T.; El-Hack, M.E.A.; Emam, M.; El-Sharnouby, M.; Taha, A.E.; Ashour, E.A. Influences of dietary herbal blend and feed restriction on growth, carcass characteristics and gut microbiota of growing rabbits. Ital. J. Anim. Sci. 2021, 20, 896–910. [Google Scholar] [CrossRef]
- Tóro, R.M.; Gessner, A.d.A.; Furtado, N.A.; Ceccarelli, P.S.; de Albuquerque, S.; Bastos, J.K. Activity of the Pinus elliottii resin compounds against Lernaea cyprinacea in vitro. Vet. Parasitol. 2003, 118, 143–149. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Hack, M.E.; El-Saadony, M.T.; Saad, A.M.; Salem, H.M.; Ashry, N.M.; Ghanima, M.M.A.; Shukry, M.; Swelum, A.A.; Taha, A.E.; El-Tahan, A.M. Essential oils and their nanoemulsions as green alternatives to antibiotics in poultry nutrition: A comprehensive review. Poult. Sci. 2021, 101, 101584. [Google Scholar] [CrossRef]
- Reda, F.M.; El-Saadony, M.T.; El-Rayes, T.K.; Farahat, M.; Attia, G.; Alagawany, M. Dietary effect of licorice (Glycyrrhiza glabra) on quail performance, carcass, blood metabolites and intestinal microbiota. Poult. Sci. 2021, 100, 101266. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Yang, C.; Wang, P.; Yang, Z.; Ren, X. Effects of star anise (Illicium verum Hook. f) and its extractions on carcass traits, relative organ weight, intestinal development, and meat quality of broiler chickens. Poult. Sci. 2020, 99, 5673–5680. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Yang, C.; Yang, Z. Effects of star anise (Illicium verum Hook. f.), essential oil, and leavings on growth performance, serum, and liver antioxidant status of broiler chickens. J. Appl. Poult. Res. 2017, 26, 459–466. [Google Scholar] [CrossRef]
- Patra, J.K.; Das, G.; Bose, S.; Banerjee, S.; Vishnuprasad, C.N.; del Pilar Rodriguez-Torres, M.; Shin, H.S. Star anise (Illicium verum): Chemical compounds, antiviral properties, and clinical relevance. Phytother. Res. 2020, 34, 1248–1267. [Google Scholar] [CrossRef]
- Wang, G.-W.; Hu, W.-T.; Huang, B.-K.; Qin, L.-P. Illicium verum: A review on its botany, traditional use, chemistry and pharmacology. J. Ethnopharmacol. 2011, 136, 10–20. [Google Scholar] [CrossRef] [PubMed]
- Abu-Elala, N.M.; Attia, M.M.; Abd-Elsalam, R.M. Chitosan-silver nanocomposites in goldfish aquaria: A new perspective in Lernaea cyprinacea control. Int. J. Biol. Macromol. 2018, 111, 614–622. [Google Scholar] [CrossRef]
- Politeo, O.; Jukić, M.; Miloš, M. Chemical composition and antioxidant activity of essential oils of twelve spice plants. Croat. Chem. Acta 2006, 79, 545–552. [Google Scholar]
- Li, H.; Wu, X.; Li, X.; Cao, X.; Li, Y.; Cao, H.; Men, Y. Multistage extraction of star anise and black pepper derivatives for antibacterial, antioxidant, and anticancer activity. Front. Chem. 2021, 9, 660138. [Google Scholar] [CrossRef] [PubMed]
- Obaid, R.J. Synthesis and biological evaluation of some new imidazo[1,2-c]pyrimido [5,4-e]pyrimidin-5-amine derivatives. J. Umm Al Qura Uni. Appl. Sci. 2021, 7, 16–22. [Google Scholar]
- AOAC. Official Methods of Analysis of AOAC International, 19th ed.; AOAC54 International: Gaithersburg, MA, USA, 2012. [Google Scholar]
- Singh, G.; Kapoor, I.; Panday, S.K. Studies on Essential Oils Part 7 Natural Sprout Inhibitors for Potatoes. Pestic. Res. J. 1997, 9, 121–124. [Google Scholar]
- Singleton, V.L. Lamuela-Raventos: Analysis of total phenoles and other oxidation substartes and antioxidants by means of folin-ciocalteu reagent. Methods Enzymol. 1999, 299, 152. [Google Scholar]
- El-Beeh, M.E.; El-Badawi, A.A.; Amin, A.H.; Qari, S.H.; Ramadan, M.F.; Filfilan, W.M.; El-Sayyad, H.I. Anti-aging trait of whey protein against brain damage of senile rats. J.Umm Al Qura Univ. Appl.Sci. 2022, 1–13. [Google Scholar] [CrossRef]
- Merrill, A.L.; Watt, B.K. Energy Value of Foods: Basis and Derivation; Human Nutrition Research Branch, Agricultural Research Service, US: San Francisco, CA, USA, 1955. [Google Scholar]
- Al Bratty, M.; Makeen, H.A.; Alhazmi, H.A.; Syame, S.M.; Abdalla, A.N.; Homeida, H.E.; Sultana, S.; Ahsan, W.; Khalid, A. Phytochemical, cytotoxic, and antimicrobial evaluation of the fruits of miswak plant, Salvadora persica L. J. Chem. 2020, 2020, 4521951. [Google Scholar] [CrossRef]
- Kim, D.-O.; Chun, O.K.; Kim, Y.J.; Moon, H.-Y.; Lee, C.Y. Quantification of polyphenolics and their antioxidant capacity in fresh plums. J. Agric.Food Chem. 2003, 51, 6509–6515. [Google Scholar] [CrossRef]
- Kirk, S.; Sawyer, R. Pearson’s Composition and Analysis of Foods; Longman Group Ltd.: London, UK, 1991. [Google Scholar]
- Hassanin, A.A.; Saad, A.M.; Bardisi, E.A.; Salama, A.; Sitohy, M.Z. Transfer of anthocyanin accumulating delila and rosea1 genes from the transgenic tomato micro-tom cultivar to moneymaker cultivar by conventional breeding. J. Agric. Food Chem. 2020, 68, 10741–10749. [Google Scholar] [CrossRef]
- Saad, A.M.; Sitohy, M.Z.; Ahmed, A.I.; Rabie, N.A.; Amin, S.A.; Aboelenin, S.M.; Soliman, M.; El-Saadony, M.T. Biochemical and functional characterization of kidney bean protein alcalase-hydrolysates and their preservative action on stored chicken meat. Molecules 2021, 26, 4690. [Google Scholar] [CrossRef]
- Abu-Dief, A.M.; El-Metwaly, N.M.; Alzahrani, S.O.; Alkhatib, F.; Abumelha, H.M.; El-Dabea, T.; Ali El-Remaily, M.A.E.A.A. Structural, conformational and therapeutic studies on new thiazole complexes: Drug-likeness and MOE-simulation assessments. Res. Chem. Int. 2021, 47, 1979–2002. [Google Scholar] [CrossRef]
- Rahman, M.M.; Rahaman, M.S.; Islam, M.R.; Rahman, F.; Mithi, F.M.; Alqahtani, T.; Almikhlafi, M.A.; Alghamdi, S.Q.; Alruwaili, A.S.; Hossain, M.S. Role of phenolic compounds in human disease: Current knowledge and future prospects. Molecules 2021, 27, 233. [Google Scholar] [CrossRef] [PubMed]
- Elshafie, H.S.; Racioppi, R.; Bufo, S.A.; Camele, I. In vitro study of biological activity of four strains of Burkholderia gladioli pv. agaricicola and identification of their bioactive metabolites using GC–MS. Saudi J. Biol. Sci. 2017, 24, 295–301. [Google Scholar] [CrossRef] [PubMed]
- Abu-Rayyan, A.; Al Jahdaly, B.A.; AlSalem, H.S.; Alhadhrami, N.A.; Hajri, A.K.; Bukhari, A.A.H.; Waly, M.M.; Salem, A.M. A Study of the Synthesis and Characterization of New Acrylamide Derivatives for Use as Corrosion Inhibitors in Nitric Acid Solutions of Copper. Nanomaterials 2022, 12, 3685. [Google Scholar] [CrossRef] [PubMed]
- Bouyahya, A.; Assemian, I.C.C.; Mouzount, H.; Bourais, I.; Et-Touys, A.; Fellah, H.; Benjouad, A.; Dakka, N.; Bakri, Y. Could volatile compounds from leaves and fruits of Pistacia lentiscus constitute a novel source of anticancer, antioxidant, antiparasitic and antibacterial drugs? Ind. Crops Prod. 2019, 128, 62–69. [Google Scholar] [CrossRef]
- Chang, K.S.; Ahn, Y.J. Fumigant activity of (E)-anethole identified in Illicium verum fruit against Blattella germanica. Pest Manag. Sci. 2002, 58, 161–166. [Google Scholar] [CrossRef] [PubMed]
- Freitas, J.P.; de Jesus, I.L.R.; Chaves, J.K.d.O.; Gijsen, I.S.; Campos, D.R.; Baptista, D.P.; Ferreira, T.P.; Alves, M.C.C.; Coumendouros, K.; Cid, Y.P. Efficacy and residual effect of Illicium verum (star anise) and Pelargonium graveolens (rose geranium) essential oil on cat fleas Ctenocephalides felis felis. Rev. Bras. Parasitol. Vet. 2021, 30, e009321. [Google Scholar] [CrossRef]
- Pallavi, B.; Shankar, K.; Abhiman, P.; Ahmed, I. Molecular identification of the fish parasite Lernaea. Indian J. Fish 2017, 64, 76–82. [Google Scholar] [CrossRef]
- Tu, X.; Qi, X.; Huang, A.; Ling, F.; Wang, G. Cytokine gene expression profiles in goldfish (Carassius auratus) during Gyrodactylus kobayashii infection. Fish Shellfish Immunol. 2019, 86, 116–124. [Google Scholar] [CrossRef]
- Younis, N.A.; Laban, S.E.; Al-Mokaddem, A.K.; Attia, M.M. Immunological status and histopathological appraisal of farmed Oreochromis niloticus exposed to parasitic infections and heavy metal toxicity. Aquac. Int. 2020, 28, 2247–2262. [Google Scholar] [CrossRef]
- Attia, M.M.; Abdelsalam, M.; Korany, R.; Mahdy, O.A. Characterization of digenetic trematodes infecting African catfish (Clarias gariepinus) based on integrated morphological, molecular, histopathological, and immunological examination. Parasitol. Res. 2021, 120, 3149–3162. [Google Scholar] [CrossRef]
- Attia, M.M.; Elgendy, M.Y.; Abdelsalam, M.; Hassan, A.; Prince, A.; Salaeh, N.M.; Younis, N.A. Morpho-molecular identification of Heterophyes heterophyes encysted metacercariae and its immunological and histopathological effects on farmed Mugil cephalus in Egypt. Aquac. Int. 2021, 29, 1393–1407. [Google Scholar] [CrossRef]
- Attia, M.M.; Elgendy, M.Y.; Prince, A.; El-Adawy, M.M.; Abdelsalam, M. Morphomolecular identification of two trichodinid coinfections (Ciliophora: Trichodinidae) and their immunological impacts on farmed Nile Tilapia. Aquac. Res. 2021, 52, 4425–4433. [Google Scholar] [CrossRef]
- Bradford, N. A rapid and sensitive method for the quantitation microgram quantities of a protein isolated from red cell membranes. Anal. Biochem. 1976, 72, e254. [Google Scholar] [CrossRef]
- Wojciechowska, M.; Stepnowski, P.; Gołębiowski, M. Identification and quantitative analysis of lipids and other organic compounds contained in eggs of Colorado potato beetle (Leptinotarsa decemlineata). J. Plant Dis. Prot. 2019, 126, 379–384. [Google Scholar] [CrossRef]
- Kirthi, A.V.; Rahuman, A.A.; Rajakumar, G.; Marimuthu, S.; Santhoshkumar, T.; Jayaseelan, C.; Velayutham, K. Acaricidal, pediculocidal and larvicidal activity of synthesized ZnO nanoparticles using wet chemical route against blood feeding parasites. Parasitol. Res. 2011, 109, 461–472. [Google Scholar] [CrossRef]
- Verghese, J. The world of spices and herbs. Spice India 1988, 11, 15–18. [Google Scholar]
- Furtado, W.E.; Cardoso, L.; de Medeiros, P.B.; Lehmann, N.B.; de Aguiar, E.B.; da Costa, N.M.; Bertoldi, F.C.; Martins, M.L. Antiparasitic potential of alternative treatments against larval stages of Lernaea cyprinacea. J. Parasit. Dis. 2021, 45, 1096–1105. [Google Scholar] [CrossRef]
- Valladao, G.M.R.; Gallani, S.U.; De Padua, S.B.; LATERÇA, M.; Pilarski, F. Trichodina heterodentata (Ciliophora) infestation on Prochilodus lineatus larvae: A host–parasite relationship study. Parasitology 2014, 141, 662–669. [Google Scholar] [CrossRef]
- Medeiros, E.S.; Maltchik, L. The effects of hydrological disturbance on the intensity of infestation of Lernaea cyprinacea in an intermittent stream fish community. J. Arid Environ. 1999, 43, 351–356. [Google Scholar] [CrossRef]
- El-Shall, N.A.; El-Hack, M.E.A.; Albaqami, N.M.; Khafaga, A.F.; Taha, A.E.; Swelum, A.A.; El-Saadony, M.T.; Salem, H.M.; El-Tahan, A.M.; AbuQamar, S.F.; et al. Phytochemical control of poultry coccidiosis: A review. Poult. Sci. 2022, 101, 101542. [Google Scholar] [CrossRef]
- Kabata, Z. Parasites and Diseases of Fish Cultured in the Tropics; Taylor & Francis Ltd.: Abingdon, UK, 1985. [Google Scholar]
- Tavares-Dias, M.; Martins, M.L. An overall estimation of losses caused by diseases in the Brazilian fish farms. J. J. Parasit. Dis. 2017, 41, 913–918. [Google Scholar] [CrossRef] [PubMed]
- Miyazawa, M.; Ota, H.; Ishikawa, Y.; Kameoka, H. An Insecticidal compound from Illicium Verum. ChemInform 1993, 24, 44. [Google Scholar]
- Chaubey, M.K. Fumigant toxicity of essential oils from some common spices against pulse beetle, Callosobruchus chinensis (Coleoptera: Bruchidae). J. Oleo Sci. 2008, 57, 171–179. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-O.; Park, I.-K.; Choi, G.-J.; Lim, H.-K.; Jang, K.-S.; Cho, K.-Y.; Shin, S.-C.; Kim, J.-C. Fumigant activity of essential oils and components of Illicium verum and Schizonepeta tenuifolia against Botrytis cinerea and Colletotrichum gloeosporioides. J. Microbiol. Biotechnol. 2007, 17, 1568–1572. [Google Scholar] [PubMed]
- Shukla, J.; Tripathi, S.; Chaubey, M. Toxicity of Myristica fragrans and Illicium verum essential oils against flour beetle Tribolium castaneum Herbst (Coleoptera: Tenebrionidae). Elec. J. Env. Agricult. Food Chem. 2009, 8, 403–407. [Google Scholar]
- Maini, P.; Rejesus, B. Toxicity of some volatile oils against golden snail (Pomacea spp.). Philipp. J. Crop Sci. 1992, 17, 27. [Google Scholar]
- Abd El-Hack, M.E.; El-Saadony, M.T.; Shafi, M.E.; Alshahrani, O.A.; Saghir, S.A.; Al-Wajeeh, A.S.; Al-Shargi, O.Y.; Taha, A.E.; Mesalam, N.M.; Abdel-Moneim, A.M.E. Prebiotics can restrict Salmonella populations in poultry: A review. Anim. Biotechnol. 2021, 19, 1–10. [Google Scholar] [CrossRef]
- Zhang, R.; Wang, X.; Liu, L.; Cao, Y.; Zhu, H. Dietary oregano essential oil improved the immune response, activity of digestive enzymes, and intestinal microbiota of the koi carp, Cyprinus carpio. Aquaculture 2020, 518, 734781. [Google Scholar] [CrossRef]
- Sarhadi, I.; Alizadeh, E.; Ahmadifar, E.; Adineh, H.; Dawood, M.A. Skin mucosal, serum immunity and antioxidant capacity of common carp (Cyprinus carpio) fed artemisia (Artemisia annua). Ann. Anim. Sci. 2020, 20, 1011–1027. [Google Scholar] [CrossRef]
- Mossa, A. Green pesticides: Essential oils as biopesticides in insect-pest management. J. Environ. Sci. Technol. 2016, 9, 354–378. [Google Scholar] [CrossRef]
- Pavela, R.; Benelli, G. Essential oils as ecofriendly biopesticides? Challenges and constraints. Trends Plant Sci. 2016, 21, 1000–1007. [Google Scholar] [CrossRef] [PubMed]
- Raveau, R.; Fontaine, J.; Lounès-Hadj, S. Essential oils as potential alternative biocontrol products against plant pathogens and weeds: A Review. Foods 2020, 9, 365. [Google Scholar] [CrossRef] [PubMed]








| Chemical Composition | Content (mg/L) |
|---|---|
| Approximate analysis | |
| Protein | 6.5 ± 0.1 |
| Fat | 3.76 ± 0.2 |
| Fiber | 28.12 ± 0.5 |
| Carbohydrates | 59.33 ± 0.6 |
| Ash | 4.08 ± 0.1 |
| Dry matter | 86.65 ± 0.3 |
| Antioxidant content | |
| Total phenols (mg/L) | 33.36 ± 0.9 |
| Total flavonoids (mg/L) | 15.66 ± 0.2 |
| Antioxidant activity (%) | 96.22 ± 1.1 |
| Minerals (mg/L) | |
| Zn | 14.2 ± 0.2 |
| Fe | 58.3 ± 0.1 |
| Cu | 15.3 ± 0.3 |
| Mn | 115.3 ± 1.3 |
| Co | ND |
| Ni | ND |
| P | 912.30 ± 1.8 |
| K | 5651.96 ± 1.1 |
| Na | 860.61 ± 0.9 |
| Phenolic Compound | Concentration (mg/L) |
|---|---|
| Vanillic | 5704.35 ± 0.1 |
| 3.4.5. methoxy cinnamic | 1448.9 ± 0.9 |
| Catechin | 2525.8 ± 0.5 |
| Protocatechuic | 6052.15 ± 0.1 |
| Ferulic | 4071.41 ± 0.6 |
| Coumarin | 18,384.35 ± 0.1 |
| P-OH benzoic | 2148.85 ± 0.6 |
| Gallic | 1750.3 ± 0.8 |
| Caffeine | 4094.1 ± 0.4 |
| P-Coumaric | 325.8 ± 0.7 |
| Catechol | 2501 ± 0.3 |
| Caffeic | 2711.5 ± 0.5 |
| Cinnamic | 4457.35 ± 0.3 |
| Chlorogenic | 11,932.1 ± 0.8 |
| Iso ferulic | 5592.05 ± 0.9 |
| Benzoic | 4575.5 ± 0.7 |
| 4-amino benzoic acid | 4228.05 ± 0.6 |
| alpha Coumaric | 6583.44 ± 0.1 |
| Salicylic | 4873.23 ± 0.3 |
| Rutin | 1524.685 ± 0.8 |
| Naringin | 4424.44 ± 0.3 |
| Apigenin | 531.975 ± 0.2 |
| Naringenin | 1097.1415 ± 0.1 |
| Acacetin neo. rutinoside | 3802.675 ± 0.3 |
| Luteolin 7 glucose | 5151.4 ± 0.1 |
| Apigenin 6-rhamose 8-glucose | 5333.25 ± 0.9 |
| Apigenin 6-arabinose 8-glactose | 1473.28 ± 0.7 |
| Hesperetin | 588.35 ± 0.8 |
| Kaempferol | 1277.9 ± 0.3 |
| Quercetin | 3753.705 ± 0.5 |
| Quercitrin | 2427.615 ± 0.6 |
| Apigenin-7-0-neohes | 15,271 ± 0.4 |
| Kaempferol 3-2-p-coumaroylglucose | 3578.7 ± 0.1 |
| Rt | Volatile Compounds | Area% |
|---|---|---|
| 2.19 | Furfural | 0.01 ± 0.001 |
| 3.24 | α-Thujene | 0.01 ± 0.0002 |
| 3.34 | α-Pinene | 0.26 ± 0.005 |
| 3.63 | Camphene | 0.01 ± 0.00 |
| 4.12 | β-Pinene | 0.03 ± 0.01 |
| 4.40 | Myrcene | 0.12 ± 0.08 |
| 4.67 | α-Phellandrene | 0.51 ± 0.007 |
| 4.86 | α-Terpinene | 0.08 ± 0.004 |
| 5.10 | Limonene | 2.60 ± 0.1 |
| 5.15 | 1,8-Cineole | 0.15 ± 0.02 |
| 5.27 | cis-β-Ocimene | 0.01 ± 0.001 |
| 5.45 | trans-β-Ocimene | 0.05 ± 0.002 |
| 5.64 | γ-Terpinene | 0.11 ± 0.004 |
| 5.94 | cis-Linalool oxide (fur.) | 0.01 ± 0.009 |
| 6.11 | Terpinolene | 0.12 ± 0.001 |
| 6.25 | trans-Linalool oxide (fur.) | 0.05 ± 0.006 |
| 6.33 | para-Cymene | 0.02 ± 0.001 |
| 6.64 | Linalool | 0.61 ± 0.002 |
| 7.98 | para-Vinyl anisole | 0.01 ± 0.007 |
| 8.68 | Terpinen-4-ol | 0.19 ± 0.003 |
| 9.37 | α-Terpineol | 2.18 ± 0.2 |
| 11.63 | (Z)-Anethole | 0.28 ± 0.004 |
| 11.85 | Geraniol | 0.02 ± 0.001 |
| 12.30 | para-Anisaldehyde | 0.30 ± 0.002 |
| 14.00 | (E)-Anethole | 89.24 ± 0.1 |
| 17.40 | α-Copaene | 0.08 ± 0.002 |
| 19.10 | para-Methyl anisate | 0.04 ± 0.003 |
| 19.40 | Geranyl acetate | 0.05 ± 0.002 |
| 19.85 | para-Acetonyl anisole | 0.12 ± 0.001 |
| 20.24 | cis-α-Bergamotene | 0.41 ± 0.004 |
| 21.78 | trans-α-Bergamotene | 0.33 ± 0.02 |
| 22.99 | α-Humulene | 0.02 ± 0.001 |
| 25.98 | Viridiflorene | 0.03 ± 0.001 |
| 28.40 | γ-Cadinene | 0.10 ± 0.02 |
| 28.87 | δ-Cadinene | 0.03 ± 0.001 |
| 29.60 | Methyl (E)-isoeugenol | 0.03 ± 0.005 |
| 33.66 | (E)-Nerolidol | 0.07 ± 0.004 |
| 34.08 | Globulol | 0.02 ± 0.002 |
| 35.85 | para-Methoxyphenyl-1,2- | 0.02 ± 0.001 |
| propanediol epimer | ||
| 37.91 | τ-Cadinol | 0.30 ± 0.01 |
| 39.24 | (Z)-Foeniculin | 0.79 ± 0.02 |
| Genes | Sequence (5′->3′) | Accession No. |
|---|---|---|
| IL-1β | F: GATGCGCTGCTCAGCTTCT | AJ249137 |
| R: AGTGGGTGCTACATTAACCATACG | ||
| IL-6 | F-CTGGCCAGACCATATCGCAG | DQ861993 |
| R-TTCTGTTCTTGAACTGCTTGACT | ||
| TNF-α | F: CATTCCTACGGATGGCATTTACTT | EU069817 |
| R: CCTCAGGAATGTCAGTCTTGCAT | ||
| β-Actin | F: GATGCGGAAACTGGAAAGGG | AB039726 |
| R: ATGAGGGCAGAGTGGTAGACG |
| Tested Concentration | L. cyprinacea Mortality | ||||
|---|---|---|---|---|---|
| M.M. % ± S.E | |||||
| 15 min | 1 h | 2 h | 4 h | 8 h | |
| 25 μg/mL | 20.9 ± 0.56 | 50 ± 0.55 | 30.0 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 |
| 12.5 μg/mL | 10 ± 0.56 | 40.00 ± 0.94 | 50 ± 0.50 | 00 ± 0.00 | 00 ± 0.00 |
| 6.25 μg/mL | 05 ± 0.36 | 20 ± 0.48 | 40 ± 0.47 | 30 ± 0.77 | 05 ± 0.50 |
| 3 μg/mL | 00 ± 0.00 | 10.0 ± 0.76 | 20.0 ± 0.59 | 25.0 ± 0.50 | 30.0 ± 0.57 |
| 2 μg/mL | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 | 20.5 ± 0.36 | 30.98 ± 1.50 |
| 1 μg/mL | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 |
| Control treatment with Deltamethrin | 100 + 0.00 | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 |
| Negative Control group with no treatment | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 | 00 ± 0.00 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Attia, M.M.; Alzahrani, A.M.; Hanna, M.I.; Salem, H.M.; Abourehab, M.A.S.; El-Saadony, M.T.; Thabit, H. The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study. Life 2022, 12, 2054. https://doi.org/10.3390/life12122054
Attia MM, Alzahrani AM, Hanna MI, Salem HM, Abourehab MAS, El-Saadony MT, Thabit H. The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study. Life. 2022; 12(12):2054. https://doi.org/10.3390/life12122054
Chicago/Turabian StyleAttia, Marwa M., Amal M. Alzahrani, Magdy I. Hanna, Heba M. Salem, Mohammed A. S. Abourehab, Mohamed T. El-Saadony, and Hasnaa Thabit. 2022. "The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study" Life 12, no. 12: 2054. https://doi.org/10.3390/life12122054
APA StyleAttia, M. M., Alzahrani, A. M., Hanna, M. I., Salem, H. M., Abourehab, M. A. S., El-Saadony, M. T., & Thabit, H. (2022). The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study. Life, 12(12), 2054. https://doi.org/10.3390/life12122054

