Next Article in Journal
Pipeline Transport Performance of Paste Backfill Slurry in Long-Distance Underground Backfilling: A Review
Previous Article in Journal
Targeting High-Grade Mineralization via a Synthesis of Compositional Profiles of Alluvial Gold with Structural and Paragenetic Models
Previous Article in Special Issue
Extraction Potential of Lolium perenne L. (Perennial Rye Grass) for Metals in Landfill Soil: Its Tolerance and Defense Strategies
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Uncovering the Relationship Between Soil Bacterial Community and Heavy Metals in a Copper Waste Pile

1
National Research Center for Geoanalysis, Beijing 100037, China
2
Key Laboratory of Eco-Geochemistry, Ministry of Natural Resources, Beijing 100037, China
3
Land Consolidation and Rehabilitation Center, Ministry of Natural Resources, Beijing 100035, China
*
Authors to whom correspondence should be addressed.
Minerals 2024, 14(12), 1237; https://doi.org/10.3390/min14121237
Submission received: 7 August 2024 / Revised: 12 October 2024 / Accepted: 3 December 2024 / Published: 4 December 2024

Abstract

:
In the present study, the relationship between the microbial community and heavy metal content of soil was analyzed based on 16S rRNA gene high-throughput sequencing, in order to screen the corresponding heavy metal-resistant bacteria in a copper mine waste dump and adjacent shrubbery. Approximately 22 phyla, 57 classes, 128 orders, 173 families, 263 genera, 433 species, and 954 OUTs obtained from soil sample species annotation indicated the Spearman relevance analysis at the phylum level. Specifically, Gemmatimonadota is positively correlated with arsenic (As); Patescibacteria is positively correlated with arsenic (As), copper (Cu), and cadmium (Cd); Proteobacteria is positively correlated with chromium (Cr); and Acidobacteriota is positively correlated with cadmium (Cd), respectively. Meanwhile, at the genus level, Acidibacter is positively correlated with arsenic (As); norank_f__LWQ8, norank_f__Gemmataceae, and Bryobacter are positively correlated with cadmium (Cd); Acidiphilium and Conexiactor are positively correlated with Zinc (Zn); norank_f__norank_o__IMCC26256 is positively correlated with nickel (Ni); norank_f__norank_o__norank_c__AD3 is positively correlated with manganese (Mn), and nickel (Ni); and Alicyclobacillus and unclassified_f__Acidiferobactereae are positively correlated with chromium (Cr). These bacterial flora are significantly and positively related to the resistance of heavy metals, which provides a promising reference for the development of in situ remediation of heavy metal pollution in mines.

1. Introduction

Soil heavy metal pollution in the surrounding areas of mining and metallurgy sites has become a worldwide ecological problem [1], and most countries have increased their investment in mine ecological restoration [2]. The opportunistic weathering of sulfidic and metalliferous minerals in mining areas releases high concentrations of heavy metals, contaminating surface/ground water and failing ecological rehabilitation. For example, the waste rocks and tailings from mining can transfer heavy metals to the soil and water through the weathering and leaching process, which not only introduces a certain toxicity to the terrestrial ecosystem, but also concentrates in plants and consequently threatens human health through the food chain [3].
Unlike organic pollutants, heavy metals do not generally undergo microbial or chemical degradation. These metals usually remain in the soil for a long time and are difficult to remove [4]. Various soil heavy metal remediation methods, including physical, chemical, and biological amendments, have been reported [5]. Bioremediation, especially microbial remediation, is cost-effective and environmentally friendly compared with other methods. Although they do not degrade heavy metals directly, bioremediation approaches demonstrate a high potential to transform toxic metals by modifying their physical and chemical properties into non-toxic types [6,7]. In recent years, microbial remediation has attracted much attention and has become a research hotspot [8,9,10].
When contaminated by heavy metals, soils often concentrate diverse heavy metal-tolerant microorganisms [11]. Pacwa-Płociniczak et al. [12] confirmed that microorganisms with specific functions can alter the chemical form of heavy metals in the soil through biological metabolites, thus regulating the mobility and bioavailability of heavy metals. During the bioweathering or biodegrading processes, the geochemical conditions (e.g., pH and redox) in the mining wastes may be altered, which restricts the migration and transformation of heavy metals [13]. In addition, owing to the secondary metabolites of microorganisms, the microenvironment surrounding a root system can also be changed by adjusting the types and characteristics of microorganisms around the plant’s rhizosphere [14]. This bio-geochemical cycling can enhance the absorption and immobilization of heavy metals in contaminated soil. Chen et al. [15] showed that soil microorganisms are sensitive to heavy metal stress, while the alteration of the microbial community’s structure can reflect soil health, which is considered as a critical potential evaluation index [16,17,18]. These sensitive microorganisms also have a high potential for use in heavy metal remediation, which can provide sustainable bioremediation approaches for pollution control [19]. As a result, investigating the relationship between soil heavy metal pollution and the microbial community can uncover the sensitivity of soil microorganisms to heavy metal stress and shifts in their diversity, thus providing a theoretical basis for finding effective remediation microorganisms.
Together with the characterization of heavy metals chromium (Cr), manganese (Mn), nickel (Ni), copper (Cu), zinc (Zn), arsenic (As), cadmium (Cd), and lead (Pb) in the soil of a copper mine waste dump, this study explores in detail the relationship between soil microorganisms and the content of heavy metals in the soil based on 16S rRNA gene high-throughput sequencing, in order to provide evidence for the selection of excellent strains resistant to heavy metals. The outcomes of this research will benefit the microbial remediation of heavy metal contaminated soil of copper mine waste dump.

2. Materials and Methods

2.1. The General Situation of the Studying Area

The study area is located at the foot of the Huaiyu Mountains in Shangrao City, Jiangxi Province, China, which is a low hilly landform. The climatic conditions are warm and humid, with abundant rainfall across the four seasons. The average annual temperature is 17.4 °C, and the maximum temperature is 39.3 °C; the average annual rainfall is 1996.6 mm, and the maximum annual rainfall is 2803.6 mm. The outcropping beds are the Neoproterozoic Shuangqiaoshan Group shallow metamorphic rock series, and their mineralogical properties are closely related to the early Yanshanian granodiorite porphyry, quartz diorite porphyrite, fine crystalline rock, and lamprophyre. Due to weathering and leaching effects, clay-sand mixtures are generally distributed on the surface of the low-lying terrain [20].
The study area is one of the largest porphyry copper (molybdenum) deposits in China. There are more than 90 kinds of ore minerals, including more than 50 kinds of metal minerals, most of which are pyrite and chalcopyrite. Sulfide is the most abundant mineral, which accounts for generally 5% of the total mineral composition. Gangue minerals account for about 95% of the total ore, including quartz, mica, chlorite, and illite, with a small amount of carbonate, oxides, etc. [20]; shallow-buried copper deposits are large and concentrated, with small stripping ratio, uniform copper grade, good ore washability, and containing various comprehensive utilization elements such as sulfur (S), iron (Fe), lead (Pb), zinc (Zn), nickel (Ni), cadmium (Cd), molybdenum (Mo), cobalt (Co), arsenic (As), manganese (Mn), antimony (Sb), tellurium (Te), aurum (Au), argentum (Ag), etc. These elements are usually enriched in the deposit and surrounding rocks. Some elements demonstrate high bioavailability, such as mercury (Hg), selenium (Se), cadmium (Cd), and arsenic (As), which may pose a serious threat to the surrounding environment. Since the mine was built in 1965, two major sources of pollution have gradually formed after more than 50 years of mining: waste piles and a tailings reservoir.

2.2. Sample Collection and Processing

The sampling range in the studying area is 117°40′–117°47′ E and 28°57′–29°04′ N. The sampling points are selected from the waste rock dump and its adjacent natural forest sites in the mining area (patchy distribution within the waste rock dump area). In detail, 4 waste rock dump sites (fsk1, fsk2, fsk3, fsk4) and 1 shrub forest site adjacent to the waste rock dump (fske1) (See Figure 1 for specific location) were selected. Mixed soil samples of 0–20 cm soil layers were divided into three sub-samples. One was taken back in an ice bag and stored in a 4 °C refrigerator for environmental microbial sequencing. The other one was air-dried at room temperature (25 °C), and the plant residues in the soil were picked out, ground, sieved (200 mesh, 75 μm), and mixed for the next experimental step [21].
Three replicates were performed for each dried sample, which weighed 50.00mg each and were digested in Teflon pressure vessels. The dried powders were dissolved with ultrapure concentrated acids, initially with 1.0 ml of hydrofluoric acid (HF) and 0.5 ml of nitric acid (HNO3) and heated at 190 °C for 24 h. After cooling, samples were evaporated at 150 °C to incipient dryness, redissolved with 0.5 ml of HNO3 and heated again to incipient dryness to drive off HF remains. Then, the residues were dissolved again with 5.0 ml of 50% (volume fraction) HNO3 and heated at 130 °C for 3 h in the Teflon pressure vessels. After cooling, the residues were transferred into a clean plastic bottle, and finally diluted to 50 ml with water for analysis.

2.3. Sample Testing

2.3.1. Soil Chemistry

The testing of soil samples was conducted by the National Research Center for Geoanalysis within the list of qualification certifications of the testing laboratory.
The pH value was detected by the glass electrode method (soil: water = 1:2.5) [22]; the total amount of heavy metals, including Cr, Mn, Ni, Cu, Zn, As, Cd, and Pb, was determined by inductively coupled plasma mass spectrometer (ICP MS, American Thermo Fisher Company, Waltham, MA, USA) and AFS 820 atomic fluorescence photometer (AFS, Beijing Jitian Instrument Co., Ltd., Beijing, China). Specifically, Cu, Pb, Zn, Cr, Ni, Cd, and Mn were determined by the ICP MS, while As was determined by the AFS. The soil reference materials used in the analysis process were GBW07429 and GBW07450, and the rock reference material was GBW07103. These reference materials were developed by the Institute of Geophysics and Geochemistry, Chinese Academy of Geological Sciences [23].

2.3.2. DNA Extraction, PCR Amplification and Sequencing of Environmental Microorganisms

DNA was extracted from each sample using an EZNA™ Soil DNA Kit (OMEGA bio-tek, Norcross, GA, USA) following the manufacturer’s protocol. The V3–V4 region of bacterial 16S-rRNA genes was amplified using the universal primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) [24]. The PCR analysis was carried out in the following order: initial denaturation at 98 °C for 2 min, 30 cycles of denaturation at 98 °C for 15 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min. Libraries were sequenced by a sequencing platform (HiSeq 2500) at Personalbio-Shanghai, Shanghai, China.

2.4. Data Analysis

2.4.1. Assessment Method of Heavy Metal Pollution in Soil

The single factor index method ( P i ) and the Nemerow pollution index method ( P c ) were used for the assessment of soil heavy metal pollution [25,26].
The calculation formula is listed as follows:
P i = C i S i
P c = C i S i 2 m a x + C i S i 2 a v e 2
In the formula, P i is the environmental quality index of metal i in soil; C i is the actual measured value of metal i (mg·kg−1); S i is the evaluation standard value of metal i in soil (mg·kg−1) (GB15618-2018) [27]; ( C i S i )max is the maximum value of soil pollution index; ( C i S i )ave is the average value of the soil pollution index.

2.4.2. Bioinformatics Analysis

The operational taxonomic units (OTUs) were defined as units with 97 percent similarity levels [28], and the most abundant sequence in each OTU was clustered using Use arch [29]. Representative sequences were taxonomically classified using a Bayesian classifier [30], and then the representative sequences were assigned against the Silva database to gain the taxonomic information of the bacterial communities [31]. Bacteria were classified at the level of phylum, class, order, family, and genus. The species community composition and correlation heat maps of environmental factors were analyzed on the online platform of Majorbio Cloud Platform (www.majorbio.com) [32]. Accuracy of the percentage of community composition calculated by the platform was 0.1%.

3. Results

3.1. Heavy Metals in Soil

Table 1 demonstrates the results of pH value and total concentrations of 8 heavy metals in 5 samples of the waste rock heap and adjacent forest soil.
The pH value ranged from 2.00 to 6.75. Except for fsk4 (6.75), the waste rock dump was in acidic condition, with a pH value between 2.00 and 2.75. The soil in the adjacent forest land was 6.50 (fske1).
It can be seen from Table 1 that the content range of Cr was 136–232 mg/kg, with an average of 188 mg/kg; the content range of Mn was 293–1159 mg/kg, with an average of 555 mg/kg; the content range of Ni was 33.6–66.9 mg/kg, with an average of 52.5 mg/kg; the content range of Cu was 631–3284 mg/kg, with an average of 1782 mg/kg; the content range of Zn was 63.2–187 mg/kg, with an average of 121 mg/kg; the content range of As was 20.5–434 mg/kg, with an average of 263 mg/kg; the content of Cd ranged from 0.09 mg/kg to 0.82 mg/kg, with an average of 0.43 mg/kg; the content range of Pb was 58.3–362 mg/kg, with an average of 170 mg/kg; the average content of Cu, Cr, and As were higher than the background value of Jiangxi soil (Cu, 23.7 mg/kg; Cr, 45.8 mg/kg; As, 14.3 mg/kg) [27,33].

3.2. Microbial Community Structure

Based on 16S rRNA gene high-throughput sequencing analysis: 22 phyla, 57 classes, 128 orders, 173 families, 263 genera, 433 species and 954 OTUs were obtained from the annotation of soil sample species in the waste rock dump (fsk) and adjacent shrubbery area (fske) of the mining area. A total of 22 phylum-level bacterial groups were detected in different soil samples. The dominant phylum-level groups and their relative abundance were composed of Actinobacteriota (7.1%–59.0%), Chloroflexi (0.1%–48.0%), Proteobacteria (8.0%–23.0%), Firmicutes (0.0%–39.0%), Nitrospirota (0.0%–25.0%), Acidobacteriota (0.0%–14.0%), Cyano-bacteria (0.0%–7.3%), WPS-2 (0.0%–3.0%), Planctomycetota (0.0%–2.6%), Patescibacte-ria (0.0%–2.0%), etc. (Figure 2a).
In addition, 263 bacterial genera were detected in different soil samples. The dominant bacteria in soil samples mainly included Sulfobacillus, unclassified_p_Actinobacteriota, Leptospirillum, norank_f_norank_o_B12-WMSP1, Delftia, unclassified_c__Acidimicrobiia, norank_f__norank_o__norank_c__AD3, norank_f__norank_o__IMCC26256, norank_f_Ktedonobacteraceae, Conexibacter, Acidiferrobacter, etc. (Figure 2b).
Through the analysis of the species’ Wayne diagram, the microbial composition structure of soil samples from the mining waste rock dump (fsk) and the adjacent natural forest area (fske) both suggested significant differences. A total of 18 phyla and 112 genera of the coexisting bacterial communities were detected in the soil samples. There were 4 exclusive flora and 145 genera in the waste rock heap (fsk) in the mining area (Figure 3), and the main exclusive flora were Gemmatimonadota (57.5%), Elusimicrobiota (23.4%), Abditibacteriota (17.0%), and Desulfobacterota (2.1%). The main exclusive genera and groups of bacteria were Leptospirillum (56.0%), Acidiferrobacter (17.5%), Alicyclobacillus (4.5%), Mucilaginibacter (3.7%), Acidithiobacillus (3.6%), Acidibacillus (3.5%), norank_f__Babeliaceae (1.4%), Candidatus_Ovatusbacter (1.1%), and others (8.7%) (Figure 4).

3.3. Relationship Between Microbial Community and Environmental Factors

Correlation analysis suggested that microbial communities in soil samples were regulated by different environmental factors. It was conducted by calculating the correlation coefficient (Spearman rank correlation coefficient) between environmental factors and selected species and visually displaying the obtained numerical matrix through a heatmap. The heatmap results indicated that the response relationship between the relative abundance of bacterial communities at different phylum levels and different environmental factors was distinct (Figure 5). Gemmatimonadota was positively correlated with heavy metal As; Patescibacteria was positively correlated with As, Cu, and Cd; Proteobacteria was positively correlated with Cr; Acidobacteriota was significantly positively correlated with Cd; Dependentiae was extremely significantly negatively correlated with Ni and negatively correlated with Mn; Firmicutes was significantly negatively correlated with Zn; RCP2-54 was positively correlated with pH; Myxococota, Bdellovibrionota, Planctomycota, WPS-2, and Cyanobacterium were significantly positively correlated with pH; Nitrospirota was significantly negatively correlated with pH and Cd.
Accordingly, Figure 6 indicates that, at the genus level, there was a significant positive correlation between Acidibacter and As; norank_f__LWQ8 was significantly positively correlated with Cd; norank_f__Gemmataceae and Bryobacter were positively correlated with Cd; Acidiphilium was significantly positively correlated with Zn, while Conexiactor was positively correlated with Zn; norank_f__norank_o__IMCC26256 was positively correlated with Ni; norank_f__norank_o__norank_c__AD3 was significantly positively correlated with Mn, positively correlated with Ni, and negatively correlated with Cr; Alicyclobacillus and unclassified_f__Acidiferobactereae were significantly positively correlated with Cr; Ferrimicrobium was negatively correlated with Cd; Delftia was negatively correlated with Cu and Cd; norank_f__Babeliaceae was negatively correlated with Mn and Ni; Acidothermus was negatively correlated with Cr; Bradyrhizobium, norank_f__norank_o__Elsterales, norank_f__Gemmataceae, unclassified_f__Acidobacteriaceae_Subgroup_1, norank_f__norank_o__norank_c__norank_p__WPS-2, Bryobacter, norank_f__norank_o__Chloroplast, and norank_f__norank_o__B12-WMSP1 were significantly positively correlated with pH; norank_f__norank_o__norank_c__JG30-KF-CM66, norank_f__norank_o__0319-7L14, norank_f__LWQ8, norank_f__JG30-KF-AS9, G12-WMSP1, JG30a-KF-32, and unclassified_f__Ktedonobacterceae were significantly positively correlated with pH; Ferrimicrobium was significantly negatively correlated with pH, while Leptospirillum and Sulfobacillus were significantly negatively correlated with pH.

4. Discussion

Soil microorganisms play a key role in soil ecosystems with the functions of material circulation, nutrient transformation, and organic matter decomposition [34,35]. More attention should be paid to the in-depth study of the microbial community structure and changes in community structure should be taken as biological indicators of environmental pollution [36]. Janssen [37] and Monica et al. [38] showed that microbial diversity and community structure in non-polluted soils could be used as benchmarks to evaluate the degree of pollution interference in tailing soils. The microbial community structure and diversity of the copper mine waste rock dump site in this study were significantly different from those of the healthy soil sample benchmark. For example, Chloroflexi was not among the dominant bacteria in healthy soil, however, Chloroflexi (0.1%–48.0%) was the dominant bacteria in this study, indicating that the waste rock dump site soil might be in an unhealthy state, which was directly proved by the data of heavy metal Pi in Table 1. Previous studies found that Proteobasteria, Actinobacia, Firmicutes, and Chloroflexi played a crucial role in the tolerance of heavy metal ions in metal-contaminated soil [39,40,41]. In this study, the top four dominant bacterial groups in the soil samples were these four groups.
Frey et al. [42] and Guo et al. [43] confirmed that heavy metal pollution could significantly alter the soil microbial community structure. Correspondingly, the adaptation strategy of the microbial community was changing their own microbial community’s composition and structure under heavy metal stress [44]. Luo et al. [35] suggested that heavy metals might reduce the amount of sensitive bacteria, thereby reducing microbial diversity. Heavy metals might also enrich a variety of tolerant microorganisms, and, correspondingly, the abundance of tolerant microorganisms could be increased as well [45]. In this study, the relative abundance of Nitrospirota and Firmicutes in the soil microflora horizontal groups were increased. Similarly, the relative abundance of Sulfobacillus in the genus-level groups was significantly increased at sampling points fsk3 and fsk4 compared with that at sampling point fske1. Consistent with Keiblinger et al. [46], the high abundance of Firmicutes resulted from the high abundance of Sulfobacillus. Firmicutes are usually not a dominant group of bacteria in highly heavy metal-contaminated soil, but it was high in high EC value and low pH value soil. The subgroups of Firmicutes had a variety of heavy metal resistance genes, which might support them adapting to high levels of heavy metal pollution [47]. In addition, heavy metal-tolerant microbial communities in the four exclusive microbial communities of Gemmatimonadota, Elusimicrobiota, Abditibacteriota, and Desulfobacterota and 145 genera (the first six were Leptospirillum, Acidiferobacter, Alicyclobacillus, Mucilaginibacter, Acidithiobacillus, and Acidibacillus) in the soil of the waste rock heap (fsk) sampling site might be verified by the significant positive correlation between Gemmatimonadota and the heavy metal As (Figure 5).
The pH was the main regulator of bacterial composition. Spearman correlation analysis showed that the majority of the bacterial groups and genera were positively correlated with pH value (2.00–6.75), while a few bacterial groups suggested a negative correlation with pH. At the phylum level, the relative abundance of Nitrospirota was significantly negatively correlated with pH. Meanwhile, at the genus level, Ferrimicrobium, Leptospirium, and Sulfobacillus were significantly negatively correlated with pH. Previous research demonstrated that Sulfobacillus was a common flora in low pH and high heavy metal environments, which was an indicator flora [48]. All of these results indicated that pH value was a critical environmental factor affecting the structure of the soil’s microbial community. In addition, the study area was a porphyry copper (molybdenum) mine, possibly leading to acidic mine pollution. Due to the low pH and high heavy metal levels, acidic mine tailings suggested a typical extreme environment on earth [49,50]. The bacteria within the tailings were significantly negatively related to the pH value, improving the environmental quality through the biogeochemical releasement of metal(loid)s and mineral nutrients. Wu et al. [49] found that Gemmatimonas was negatively correlated with soil pH, and plant–microbe interactions were important for ecological restoration and succession in mine tailings. Therefore, those bacteria were negatively related to the soil pH and might have great potential for ecological restoration.
In general, if there was no correlation between the bacterial community and the heavy metal shown in the analytical results, this community might be a tolerant bacteria group resistant to heavy metal pollution; when there was a significant positive correlation shown, it indicated that this community was likely to be a tolerant bacteria group resistant to heavy metal. When contaminated by heavy metals, soils often concentrate diverse tolerant microorganisms.
This study showed that at the phylum level, Gemmatimonadota was significantly positively correlated with the heavy metal As, and, correspondingly, Gemmatimonadota was an As-tolerant bacterium; Patescibateria was significantly positively correlated with As, Cu, and Cd, and, correspondingly, Patescibateria was a tolerant bacterium of As, Cu, and Cd; Gemmatimonadota was a ubiquitous resident of various environments. Despite previous research showing the metabolic potential and ecology of Gemmatimonadota, their ecological patterns and metabolic diversity remain unclear [51,52]. Patescibacteria are a diverse group of bacteria that constitute a disproportionately large fraction of microbial dark matter. Due to a lack of suitable analytical tools, the unique features of Patescibacteira remain unexplored [53]. Nevertheless, our study provided new information and research perspectives for dealing with the issue. In this study, Proteobateria was significantly positively correlated with the heavy metal Cr, and it was a tolerant bacterium to Cr; Acidobacteriota was significantly positively correlated with the heavy metal Cd, and, correspondingly, Acidobacteriota was a Cd-tolerant bacterium. Previous research indicated that Proteobacteria, Gemmatimonadetes, and Acidobacteria were the most common phyla in the Cd-contamination soil samples [54]. The prevalence of Cr-resistant bacteria in Proteobacteria was also evident in some previous investigations [55,56].
On the other hand, at the genus level, Acidibacter was an As-resistant bacterium; norank_f__LWQ8, norank_f__Gemmataceae, and Bryobacter were Cd-resistant bacteria; Acidiphilium and Conexibacter were Zn-tolerant bacteria; norank_f__norank_o__IMCC26256 was a Ni-resistant bacterium; norank_f__norank_o__norank_c__AD3 was a tolerant bacterium to the heavy metals Mn and Ni; Alicyclobacillus and unclassified_f__Acidiferrobacteraceae were Cr-tolerant bacteria. Many of those tolerant bacteria have been found at other heavy metal contaminated sites. Chen et al. [57] found that Cd had a significant impact on the dominant bacterial species. With the application of Cd, the relative abundance of LWQ8, Acidibacter, and Acidiphilium with extreme tolerances increased significantly and gradually became the dominant taxa. In some arsenic-contaminated sites, Acinetobacter, Agrobacterium, Bacillus, and Pseudomonas genera were commonly found [58,59,60]. To our knowledge, Acidibacter and norank_f__norank_o__norank_c__AD3 were novel resistant bacteria detected in this study. Conexibacter and IMCC26256 were members of the class Actinobacteria. It is widely well-documented that bacteria belonging to the Actinobacteria phyla demonstrate a good tolerance to heavy metals [61]. The family Acidiferrobacteraceae is currently described as harboring acidophilic Fe and S oxidizers [62]; Meier et al. [63] identified 16S rRNA gene sequences related to Acidiferrobacteraceae as being potentially involved in soil formation at a site selected to be free from the influence of sulfides at circumneutral pH condition.
In addition, Subdivision 3 Acidobacteria such as Bryobacter are typical aerobe chemoorganotrophic bacteria which could accommodate acidic environments. Acidobacteria are generally oligotrophic and can survive on various sources of organic acids [64]. Researchers have isolated Acidiphilium (an acidophilic chemoorganotrophic bacterium) from acidic environments previously [65]. Similarly, Alicyclobacillus are resistant to low pH conditions [66]. The results showed that the study area was acidic, with pH values ranging from 2.00 to 6.75. Bryobacter, Acidiphilium, and Alicyclobacillus are all acidophilic or acid tolerant.
Therefore, these tolerant bacteria could provide sustainable bioremediation approaches for pollution control, as they indicated a good match to harsh environmental characteristics.

5. Conclusions

The present study reveals the relationship between the soil bacterial community and heavy metals in a copper waste pile. The main conclusions are as follows:
Acidibacter is an As-resistant bacterium; norank_f__LWQ8, norank_f__Gemmataceae, and Bryobacter are Cd-resistant bacteria; Acidiphilium and Conexibacter are Zn-resistant bacteria; norank_f__norank_o__IMCC26256 is a Ni-resistant bacterium; norank_f__norank_o__norank_c__AD3 is a resistant bacterium to the heavy metals Mn and Ni; Alicyclobacillus and unclassified_f__Acidiferrobacteracea are Cr-resistant bacteria.
Additionally, it provides substantial evidence for the selection of heavy metal repair strains. These findings may provide a promising reference for carrying out in situ remediation of acid copper mines. Nevertheless, it is crucial to screen and validate the functional bacteria that are suitable for acid mine remediation. By utilizing the biogeochemical cycling effects of functional microbes, phytoremediation approaches can play a critical role in controlling heavy metal pollution, enhancing the value of tailings ecological services and ultimately achieving the nature-based ecological restoration of acidic copper ore mines.

Author Contributions

Conceptualization, L.G., X.Y. and X.Z.; methodology, L.G.; software, H.L.; formal analysis, L.G.; investigation, L.Z.; resources, X.Z.; data curation, X.L.; writing—original draft preparation, L.G.; project administration, L.G.; funding acquisition, X.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Basic Research Funds of Chinese Academy of Geological Sciences (grant No. CSJ-2021-10) and National Key Technology R&D Program of China (grant No. 2019YFC1805104).

Data Availability Statement

The original contributions presented in this study are included in the article; further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wang, Q.; Zhou, D.; Cang, L.; Li, L.; Zhu, H. Indication of soil heavy metal pollution with earthworms and soil microbial biomass carbon in the vicinity of an abandoned copper mine in Eastern Nanjing, China. Eur. J. Soil Biol. 2009, 45, 229–234. [Google Scholar] [CrossRef]
  2. Shui, X.F.; Zhao, Y.Y.; Wang, Q. Progress and prospect of remediation technology of heavy-metal-contaminated soil in mines. Geol. Rev. 2021, 67, 752–766. (In Chinese) [Google Scholar]
  3. Mahar, A.; Wang, P.; Ali, A.; Awasthi, M.K.; Lahori, A.H.; Wang, Q.; Li, R.H.; Zhang, Z.Q. Challenges and opportunities in the phytoremediation of heavy metals contaminated soils: A review. Ecotoxicol. Environ. Saf. 2016, 126, 111–121. [Google Scholar] [CrossRef] [PubMed]
  4. Adriano, D.C.; Wenzel, W.W.; Vangronsveld, J.; Bolan, N.S. Role of assisted natural remediation in environmental cleanup. Geoderma 2004, 122, 121–142. [Google Scholar] [CrossRef]
  5. Sarwar, N.; Imran, M.; Shaheen, M.R.; Ishaq, W.; Kamran, A.; Matloob, A.; Rehim, A.; Hussain, S. Phytoremediation strategies for soils contaminated with heavy metals: Modifications and future perspectives. Chemosphere 2017, 171, 710–721. [Google Scholar] [CrossRef]
  6. Dhaliwal, S.S.; Singh, J.; Taneja, P.K.; Mandal, A. Remediation techniques for removal of heavy metals from the soil contaminated through different sources: A review. Environ. Sci. Pollut. Res. 2020, 27, 1319–1333. [Google Scholar] [CrossRef]
  7. Kang, C.H.; Kwon, Y.J.; So, J.S. Bioremediation of heavy metals by using bacterial mixtures. Ecol. Eng. 2016, 89, 64–69. [Google Scholar] [CrossRef]
  8. Liu, L.; Li, W.; Song, W.; Guo, M. Remediation techniques for heavy metal-contaminated soils: Principles and applicability. Sci. Total Environ. 2018, 633, 206–219. [Google Scholar] [CrossRef]
  9. Yin, K.; Wang, Q.; Lv, M.; Chen, L. Microorganism remediation strategies towards heavy metals. Chem. Eng. J. 2019, 360, 1553–1563. [Google Scholar] [CrossRef]
  10. Li, S.; Yan, X.; Zhang, M.; Sun, Q.; Zhu, X. Microbial remediation technology for heavy metal contamination of mine soil. Chemoecology 2024, 34, 47–59. [Google Scholar] [CrossRef]
  11. Gupta, S.; Singh, D. Role of Genetically Modified Microorganisms in Heavy Metal Bioremediation; Springer: Singapore, 2017; pp. 197–214. [Google Scholar]
  12. Pacwa-Płociniczak, M.; Płociniczak, T.; Yu, D.; Kurola, J.M.; Sinkkonen, A.; Piotrowska-Seget, Z.; Romantschuk, M. Effect of silene vulgarisand heavy metal pollution on soil microbial diversity in long-term contaminated soil. Water Air Soil Pollut. 2018, 229, 13. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, T.; Wu, Z.; Ge, L.; Shang, J.; Huang, Y.; Liu, Y.; Huang, L. Acidithiobacillus species mediated mineral weathering promotes lead immobilization in ferric-silica microstructures at sulfidic tailings. Environ. Pollut. 2024, 358, 124492. [Google Scholar] [CrossRef]
  14. Vangronsveld, J.; Herzig, R.; Weyens, N.; Boulet, J.; Adriaensen, K.; Ruttens, A.; Thewys, T.; Vassilev, A.; Meers, E.; Nehnevajova, E.; et al. Phytoremediation of contaminated soils and groundwater: Lessons from the field. Environ. Sci. Pollut. Res. 2009, 16, 765–794. [Google Scholar] [CrossRef] [PubMed]
  15. Chen, X.Y.; Yang, H.Z.; Chen, Q.J.; Wang, L.N.; Wang, G.X.; Zhang, Y. Correlation between microbial community structure and soil ecosystem functional stability under heavy metal stress. Environ. Chem. 2017, 36, 356–364. (In Chinese) [Google Scholar]
  16. Azarbad, H.; Niklińska, M.; Laskowski, R.; Straalen, N.M.V.; Gestel, C.A.M.V.; Zhou, J.Z.; He, Z.L.; Wen, C.Q.; Röling, W.F.M. Microbial community composition and functions are resilient to metal pollution along two forest soil gradients. FEMS Microbiol. Ecol. 2015, 91, 1–11. [Google Scholar] [CrossRef]
  17. Khan, S.; Hesham, A.E.L.; Qiao, M.; Rehman, S.; He, J.Z. Effects of Cd and Pb on soil microbial community structure and activities. Environ. Sci. Pollut. Res. 2010, 17, 288–296. [Google Scholar] [CrossRef]
  18. Zhang, J.; Qin, J.; Zhao, C.; Liu, C.; Xie, H.; Liang, S. Response of bacteria and fungi in soil microcosm under the presence of pesticide endosulfan. Water Air Soil Pollut. 2015, 226, 109. [Google Scholar] [CrossRef]
  19. Limcharoensuk, T.; Sooksawat, N.; Sumarnrote, A.; Awutpet, T.; Kruatrachue, M.; Pokethitiyook, P.; Auesukaree, C. Bioaccumulation and biosorption of Cd2+ and Zn2+ by bacteria isolated from a zinc mine in Thailand. Ecotoxicol. Environ. Saf. 2015, 122, 322–330. [Google Scholar] [CrossRef]
  20. Gao, Z.; Zhao, Y.; Cao, C.; Chang, Y. Ore mineralogy of the heap leaching field of the Dexing copper deposit and geochemistry of Cu and associated elements. Acta Petrol. Mineral. 2017, 36, 785–799. (In Chinese) [Google Scholar]
  21. GB 36197-2018; National Standardization Administration of the People’s Republic of China. Soil Quality-Guidance on Sampling Techniques. China Standards Press: Beijing, China, 2018; pp. 1–11. (In Chinese)
  22. Abollino, O.; Aceto, M.; Malandrino, M.; Mentasti, E.; Sarzanini, C.; Petrella, F. Heavy metals in agricultural soils from Piedmont, Italy. Distribution, speciation and chemometric data treatment. Chemosphere 2002, 49, 545–557. [Google Scholar] [CrossRef]
  23. Wang, Y.; Gu, T.; Wang, X.; Gao, Y.; Jochum, K.P.; Muller, W.E.G. Practical Handbook of Reference Materials for Geoanalysis, 2nd ed.; Geological Publishing House: Beijing, China, 2014; pp. 39–67. [Google Scholar]
  24. Xu, N.; Tan, G.; Wang, H.; Gai, X. Effect of biochar additions to soil on nitrogen leaching, microbial biomass and bacterial community structure. Eur. J. Soil Biol. 2016, 74, 1–8. [Google Scholar] [CrossRef]
  25. Brady, J.P.; Ayoko, G.A.; Martens, W.N.; Goonetilleke, A. Enrichment, distribution and sources of heavy metals in the sediments of Deception Bay, Queensland, Australia. Mar. Pollut. Bull. 2014, 81, 248–255. [Google Scholar] [CrossRef] [PubMed]
  26. Islam, M.S.; Ahmed, M.K.; Habibullah-Al-Mamun, M.; Masunaga, S. Potential ecological risk of hazardous elements in different land-use urban soils of Bangladesh. Sci. Total Environ. 2015, 512–513, 94–102. [Google Scholar] [CrossRef] [PubMed]
  27. GB 15618-2018; Ministry of Ecology and Environment of the People’s Republic of China. Soil Environmental Quality-Risk Control Standard for Soil Contamination of Agricultural Land. China Standards Press: Beijing, China, 2018; pp. 1–4. (In Chinese)
  28. Stackebrandt, E.; Goebel, B.M. Taxonomic note: A place for DNA-DNA reassociation and 16S r RNA sequence analysis in the present species definition in bacteriology. Int. J. Syst. Bacteriol. 1994, 44, 846–849. [Google Scholar] [CrossRef]
  29. Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
  30. Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [PubMed]
  31. Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, 590–596. [Google Scholar] [CrossRef]
  32. Ren, Y.; Yu, G.; Shi, C.; Liu, L.; Guo, Q.; Han, C.; Zhang, D.; Zhang, L.; Liu, B.; Gao, H. Majorbio Cloud: A one-stop, comprehensive bioinformatic platform for multiomics analyses. iMeta 2022, 1, e12. [Google Scholar] [CrossRef]
  33. China’s State Environmental Protection Administration. Background Values of Soil Elements in China; China Environmental Science Press: Beijing, China, 1990. (In Chinese) [Google Scholar]
  34. Logares, R.; Lindström, E.S.; Langenheder, S.; Logue, J.B.; Paterson, H.; Laybourn-Parry, J.; Rengefors, K.; Tranvik, L.; Bertilsson, S. Biogeography of bacterial communities exposed to progressive long-term environmental change. ISME J. 2013, 7, 937–948. [Google Scholar] [CrossRef]
  35. Luo, L.Y.; Xie, L.L.; Jin, D.C.; Mi, B.B.; Wang, D.H.; Li, X.F.; Dai, X.Z.; Zou, X.X.; Zhang, Z.; Ma, Y.Q. Bacterial community response to cadmium contamination of agricultural paddy soil. Appl. Soil Ecol. 2019, 139, 100–106. [Google Scholar] [CrossRef]
  36. Giller, K.E.; WiRer, E.; McGrath, S.R. Heavy metals and soil microbes. Soil Biol. Biochem. 2009, 41, 2031–2037. [Google Scholar] [CrossRef]
  37. Janssen, P.H. Identifying the dominant soil bacterial taxa in libraries of 16S rRNA and 16S rRNA genes. Appl. Environ. Microbiol. 2006, 72, 1719–1728. [Google Scholar] [CrossRef] [PubMed]
  38. Monica, O.M.; Julia, W.N.; Raina, M.M. Characterization of a Bacterial Community in an Abandoned Semiarid Lead-Zinc Mine Tailing Site. Appl. Environ. Microbiol. 2008, 74, 3899–3907. [Google Scholar]
  39. Zeng, P.; Guo, Z.; Xiao, X.; Peng, C. Effects of tree-herb co-planting on the bacterial community composition and the relationship between specific microorganisms and enzymatic activities in metal(loid)-contaminated soil. Chemosphere 2019, 220, 237–248. [Google Scholar] [CrossRef] [PubMed]
  40. Zhang, H.; Wan, Z.; Ding, M.; Wang, P.; Xu, X.; Jiang, Y. Inherent bacterial community response to multiple heavy metals in sediment from river-lake systems in the Poyang Lake, China. Ecotoxicol. Environ. Saf. 2018, 165, 314–324. [Google Scholar] [CrossRef]
  41. Jacquiod, S.; Cyriaque, V.; Riber, L.; Al-soud, W.A.; Gillan, D.C.; Wattiez, R.; Sørensen, S.J. Long-term industrial metal contamination unexpectedly shaped diversity and activity response of sediment microbiome. J. Hazard. Mater. 2018, 344, 299–307. [Google Scholar] [CrossRef]
  42. Frey, B.; Stemmer, M.; Widmer, F.; Luster, J.; Sperisen, C. Microbial activity and community structure of a soil after heavy metal contamination in a model forest ecosystem. Soil Biol. Biochem. 2006, 38, 1745–1756. [Google Scholar] [CrossRef]
  43. Guo, H.H.; Nasir, M.; Lv, J.L.; Dai, Y.C.; Gao, J.K. Understanding the variation of microbial community in heavy metals contaminated soil using high throughput sequencing. Ecotoxicol. Environ. Saf. 2017, 144, 300–306. [Google Scholar] [CrossRef]
  44. Li, X.Q.; Meng, D.L.; Li, J.; Yin, H.Q.; Liu, H.W.; Liu, X.D.; Cheng, C.; Xiao, Y.H.; Liu, Z.H.; Yan, M.L. Response of soil microbial communities and microbial interactions to long-term heavy metal contamination. Environ. Pollut. 2017, 231, 908–917. [Google Scholar] [CrossRef]
  45. Xu, Y.L.; Seshadri, B.; Sarkar, B.; Wang, H.L.; Rumpel, C.; Sparks, D.; Farrell, M.; Hall, T.; Yang, X.D.; Bolan, N. Biochar modulates heavy metal toxicity and improves microbial carbon use efficiency in soil. Sci. Total Environ. 2018, 621, 148–159. [Google Scholar] [CrossRef]
  46. Keiblinger, K.M.; Schneider, M.; Gorfer, M.; Paumann, M.; Deltedesco, E.; Berger, H.; Jöchlinger, L.; Mentler, A.; Zechmeister-Boltenstern, S.; Soja, G.; et al. Assessment of Cu applications in two contrasting soils effects on soil microbial activity and the fungal community structure. Ecotoxicology 2018, 27, 217–233. [Google Scholar] [CrossRef] [PubMed]
  47. Chen, Y.; Jiang, Y.M.; Huang, H.Y.; Mou, L.C.; Ru, J.L.; Zhao, J.H.; Xiao, S. Long term and high concentration heavy metal contamination strongly influences the microbiome and functional genes in Yellow River sediments. Sci. Total Environ. 2018, 637–638, 1400–1412. [Google Scholar] [CrossRef]
  48. Panyushkina, A.E.; Babenko, V.V.; Nikitina, A.S.; Selezneva, O.V.; Tsaplina, I.A.; Letarova, M.A.; Kostryukova, E.S.; Letarov, A.V. Sulfobacillus thermotolerans:new insights into resistance and metabolic capacities of acidophilic chemolithotrophs. Sci. Rep. 2019, 9, 15069. [Google Scholar] [CrossRef]
  49. Wu, Z.; Yu, F.; Sun, X.; Wu, S.; Li, X.; Liu, T.; Li, Y. Long term effects of Lespedeza bicolor revegetation on soil bacterial communities in Dexing copper mine tailings in Jiangxi Province, China. Appl. Soil Ecol. 2018, 125, 192–201. [Google Scholar] [CrossRef]
  50. Macdonald, S.J.; Jordan, G.J.; Bailey, T.G.; Davidson, N. Early seedling establishment on aged Tasmanian tin mine tailings constrained by nutrient deficiency and soil structure, not toxicity. Soil Res. 2017, 55, 692–703. [Google Scholar] [CrossRef]
  51. Gong, X.; Xu, L.; Langwig, M.V.; Chen, Z.; Huang, S.; Zhao, D.; Su, L.; Zhang, Y.; Francis, C.A.; Liu, J.; et al. Globally distributed marine Gemmatimonadota have unique genomic potentials. Microbiome 2024, 12, 149. [Google Scholar] [CrossRef]
  52. Crits-Christoph, A.; Diamond, S.; Butterfield, C.N.; Thomas, B.C.; Banfield, J.F. Novel soil bacteria possess diverse genes for secondary metabolite biosynthesis. Nature 2018, 558, 440–444. [Google Scholar] [CrossRef]
  53. Wang, Y.; Gallagher, L.A.; Andrade, P.A.; Liu, A.; Humphreys, I.R.; Turkarslan, S.; Cutler, K.J.; Arrieta-Ortiz, M.L.; Li, Y.; Radey, M.C.; et al. Genetic manipulation of Patescibacteria provides mechanistic insights into microbial dark matter and the epibiotic lifestyle. Cell 2023, 186, 4803–4817.e13. [Google Scholar] [CrossRef]
  54. Feng, G.; Xie, T.; Wang, X.; Bai, J.; Tang, L.; Zhao, H.; Wei, W.; Wang, M.; Zhao, Y. Metagenomic analysis of microbial community and function involved in cd-contaminated soil. BMC Microbiol. 2018, 18, 11. [Google Scholar] [CrossRef]
  55. Katsaveli, K.; Vayenas, D.; Tsiamis, G.; Bourtzis, K. Bacterial diversity in Cr(VI) and Cr(III)-contaminated industrial wastewaters. Extremophiles 2012, 16, 285–296. [Google Scholar] [CrossRef]
  56. Huang, Y.; Feng, H.; Lu, H.; Zeng, Y. A thorough survey for Cr-resistant and/or -reducing bacteria identified comprehensive and pivotal taxa. Int. Biodeterior. Biodegrad. 2017, 117, 22–30. [Google Scholar] [CrossRef]
  57. Chen, S.; Li, J.; Zhuang, Q.; Hu, Z.; Wang, Z. Cadmium alters the rhizosphere bacterial community structure in blueberry roots and increases the content of lipids in the soil. Rhizosphere 2023, 27, 100755. [Google Scholar] [CrossRef]
  58. Cai, L.; Liu, G.; Rensing, C.; Wang, G. Genes involved in arsenic transformation and resistance associated with different levels of arsenic-contaminated soils. BMC Microbiol. 2009, 9, 4. [Google Scholar] [CrossRef] [PubMed]
  59. Taran, M.; Fateh, R.; Rezaei, S.; Gholi, M.K. Isolation of arsenic accumulating bacteria from garbage leachates for possible application in bioremediation. Iran J. Microbiol. 2019, 11, 60–66. [Google Scholar] [CrossRef]
  60. Kepel, B.; Bodhi, W.; Fatimawali; Tallei, T.E. Isolation and Identification of Arsenic-resistant Bacteria for Possible Application in Arsenic Bioremediation. Pak J. Biol. Sci. 2020, 23, 63–67. [Google Scholar] [CrossRef]
  61. Yin, H.; Niu, J.; Ren, Y.; Cong, J.; Zhang, X.; Fan, F.; Xiao, Y.; Zhang, X.; Deng, J.; Xie, M.; et al. An integrated insight into the response of sedimentary microbial communities to heavy metal contamination. Sci. Rep. 2015, 5, 14266. [Google Scholar] [CrossRef]
  62. Issotta, F.; Moya-Beltran, A.; Mena, C.; Covarrubias, P.C.; Thyssen, C.; Bellenberg, S.; Sand, W.; Quatrini, R.; Vera, M. Insights into the biology of acidophilic members of the Acidiferrobacteraceae family derived from comparative genomic analyses. Res. Microbiol. 2018, 169, 608–617. [Google Scholar] [CrossRef]
  63. Meier, L.A.; Krauze, P.; Prater, I.; Horn, F.; Schaefer, C.E.G.R.; Scholten, T.; Wagner, D.; Mueller, C.W.; Kühn, P. Pedogenic and microbial interrelation in initial soils under semiarid climate on James Ross Island, Antarctic Peninsula region. Biogeosciences 2019, 16, 2481–2499. [Google Scholar] [CrossRef]
  64. Kulichevskaya, I.S.; Suzina, N.E.; Liesack, W.; Dedysh, S.N. Bryobacter aggregatus gen. nov., sp. nov., a peat-inhabiting, aerobic chemo-organotroph from subdivision 3 of the Acidobacteria. Int. J. Syst. Evol. Microb. 2010, 60, 301–306. [Google Scholar] [CrossRef]
  65. Kishimoto, N.; Kosako, Y.; Tano, T. Acidiphilium aminolytica sp. nov.: An Acidophilic Chemoorganotrophic Bacterium Isolated from Acidic Mineral Environment. Curr. Microbiol. 1993, 27, 131–136. [Google Scholar] [CrossRef]
  66. Smit, Y.; Cameron, M.; Venter, P.; Witthuhn, R.C. Alicyclobacillus spoilage and isolation—A review. Food Microbiol. 2011, 28, 331–349. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Distribution of sampling points in the studying area.
Figure 1. Distribution of sampling points in the studying area.
Minerals 14 01237 g001
Figure 2. Microbial community composition of soil samples. (a) Bacterial community composition (phylum level); (b) Bacterial community composition (genus level).
Figure 2. Microbial community composition of soil samples. (a) Bacterial community composition (phylum level); (b) Bacterial community composition (genus level).
Minerals 14 01237 g002
Figure 3. Venn analysis chart of soil sample microbial community species (a) Phylum level; (b) genus level.
Figure 3. Venn analysis chart of soil sample microbial community species (a) Phylum level; (b) genus level.
Minerals 14 01237 g003
Figure 4. Microbial community pie plot (fsk only). (a) Phylum level; (b) genus level.
Figure 4. Microbial community pie plot (fsk only). (a) Phylum level; (b) genus level.
Minerals 14 01237 g004
Figure 5. The heatmap of Spearman correlation analysis of phylum-level bacterial groups with heavy metals and pH. (Note: * 0.01 ≤ p ≤ 0.05, ** 0.001 ≤ p ≤ 0.01, *** p ≤ 0.001).
Figure 5. The heatmap of Spearman correlation analysis of phylum-level bacterial groups with heavy metals and pH. (Note: * 0.01 ≤ p ≤ 0.05, ** 0.001 ≤ p ≤ 0.01, *** p ≤ 0.001).
Minerals 14 01237 g005
Figure 6. The Heatmap of Spearman correlation analysis of genus-level bacterial groups with heavy metals and pH. (Note: * 0.01 ≤ p ≤ 0.05, ** 0.001 ≤ p ≤ 0.01, *** p ≤ 0.001).
Figure 6. The Heatmap of Spearman correlation analysis of genus-level bacterial groups with heavy metals and pH. (Note: * 0.01 ≤ p ≤ 0.05, ** 0.001 ≤ p ≤ 0.01, *** p ≤ 0.001).
Minerals 14 01237 g006
Table 1. Soil pH value, heavy metal content (mg/kg), and environmental quality index of heavy metals in soil *.
Table 1. Soil pH value, heavy metal content (mg/kg), and environmental quality index of heavy metals in soil *.
Itemfsk1fsk2fsk3fsk4fske1Average P i
pH2.75 ± 0.052.00 ± 0.052.00 ± 0.056.75 ± 0.156.50 ± 0.104.00-
Cr193 ± 3191 ± 7232 ± 4191 ± 6136 ± 21881.40
Mn398± 4600 ± 5293 ± 3327± 31159 ± 855517.2
Ni54.6 ± 2.466.9 ± 3.133.6 ± 2.346.2 ± 3.161.1 ± 3.152.54.00
Cu3284 ± 281612 ± 15631 ± 92727 ± 24658 ± 7178217.5
Zn151 ± 593.1 ± 363.2 ± 2115 ± 2187 ± 91212.05
As252 ± 9390 ± 420.5 ± 2434 ± 3220 ± 4263 8.41
Cd0.72 ± 0.120.23 ± 0.020.09 ± 0.010.82 ± 0.060.27 ± 0.020.438.12
Pb362 ± 758.3 ± 2128 ± 4180 ± 6122 ± 3170 4.05
* “-”: No data; The “+/−” indicated the “standard deviation”.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ge, L.; Yuan, X.; Zhang, L.; Li, H.; Liu, X.; Zhu, X. Uncovering the Relationship Between Soil Bacterial Community and Heavy Metals in a Copper Waste Pile. Minerals 2024, 14, 1237. https://doi.org/10.3390/min14121237

AMA Style

Ge L, Yuan X, Zhang L, Li H, Liu X, Zhu X. Uncovering the Relationship Between Soil Bacterial Community and Heavy Metals in a Copper Waste Pile. Minerals. 2024; 14(12):1237. https://doi.org/10.3390/min14121237

Chicago/Turabian Style

Ge, Liqiang, Xin Yuan, Longlong Zhang, Hang Li, Xiaoyu Liu, and Xiaohua Zhu. 2024. "Uncovering the Relationship Between Soil Bacterial Community and Heavy Metals in a Copper Waste Pile" Minerals 14, no. 12: 1237. https://doi.org/10.3390/min14121237

APA Style

Ge, L., Yuan, X., Zhang, L., Li, H., Liu, X., & Zhu, X. (2024). Uncovering the Relationship Between Soil Bacterial Community and Heavy Metals in a Copper Waste Pile. Minerals, 14(12), 1237. https://doi.org/10.3390/min14121237

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop