Next Article in Journal
Volume-Mediated Lake-Ice Phenology in Southwest Alaska Revealed through Remote Sensing and Survival Analysis
Next Article in Special Issue
Chironomid Pupal Exuviae Technique in Ecological Research of Man-Made Water Bodies
Previous Article in Journal
Evaluation of a Desalination System Combining Photovoltaic and Membrane Technology: A Case Study on the Benefit Analysis of an Apple Orchard
Previous Article in Special Issue
Assessment of the Divergent Influence of Natural and Non-Seasonal Hydrological Fluctuations on Functional Traits and Niche Characteristics of Plant Guilds along the Xiangxi River, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Diversity and Ecological Functions of Fungal Communities in Tangchi Hot Spring in Lujiang (China)

1
College of Biological and Environmental Engineering, Chaohu University, Chaohu 238000, China
2
School of Food and Biological Engineering, Hefei University of Technology, Hefei 230601, China
*
Author to whom correspondence should be addressed.
Water 2024, 16(16), 2308; https://doi.org/10.3390/w16162308
Submission received: 23 July 2024 / Revised: 9 August 2024 / Accepted: 13 August 2024 / Published: 16 August 2024
(This article belongs to the Special Issue Aquatic Ecosystems: Biodiversity and Conservation)

Abstract

Hot springs contain many microorganisms, and a great deal of research has been conducted on the bacteria in hot springs but less on the fungi. Microbial diversity research in hot springs will help to further develop and utilize the microbial resources from hot springs. This is the first study to analyze the fungal diversity and ecological functions in Tangchi hot spring (China). In this paper, the fungal ITS sequences in the water samples of Tangchi hot spring were sequenced by Illumina MiSeq high-throughput sequencing technology and bioinformatically analyzed to explore the fungal diversity and ecological functions in the hot spring. The results revealed that the dominant fungal phylum was Ascomycota, followed by Basidiomycota, Chytridiomycota, and Olpidiomycota, and the dominant fungal genera were Rhizophydium, Aureobasidium, Rhodotorula, and Sclerotinia in Tangchi hot spring. The FUNGuild functional analysis results revealed that the dominant guilds in Tangchi hot spring were plant pathogens followed by the undefined saprotroph and the animal endosymbiont–animal pathogen–endophyte–plant pathogen–undefined saprotroph. This study can fill the gap in people’s understanding of fungal resources and offer theoretical support for understanding the fungal diversity and fungal resource development and utilization in Tangchi hot spring.

1. Introduction

Tangchi hot spring is located in Lujiang County, Hefei City, China. The Tangchi hot spring water is mainly used for seismic monitoring, and the hot water flowing from the well is supplied to the local people and tourists for bathing. The water chemistry type of Tangchi hot spring is HCO3 Ca·Mg [1].
In this study, we used high-throughput sequencing technology to analyze the diversity of the fungi in Tangchi hot spring. High-throughput sequencing is widely used in many fields of scientific research and precision medical testing, such as genome sequencing [2], transcriptome sequencing [3], metagenomic sequencing [4], epigenetic sequencing [5], exon capture sequencing [6], and target region sequencing [7]. In recent years, high-throughput sequencing has been used for analyzing the community structure of microbes due to its low cost, high throughput, and rapid generation of large amounts of data, avoiding the limitation of the culture conditions and the objective reflection of the microbial diversity [8,9,10]. Illumina MiSeq runs PE300 mode and can undertake microbial taxonomic sequencing, amplicon sequencing, and nucleic acid aptamer sequencing. The bacterial communities of Tangchi hot spring have already been analyzed by Illumina MiSeq PE300 (Illumina, CA, USA) in the early stage [11]. In this study, Illumina MiSeq PE300 (Illumina, CA, USA) was also used to classify and sequence the fungi from Tangchi hot spring.
The products produced by fungi have characteristics comparable to or even better than classically derived products, and their enormous potential has been recognized [12]. Thermophilic fungi have more advantages and more significant potential regarding the production processes. Thermophiles are a class of microorganisms that live in high-temperature environments, belong to the category of extremophiles, and are essential microbial resources that can be developed and utilized. In addition to thermophilic bacteria, thermophilic fungi are also found in hot springs [13,14,15]. Moreover, thermophilic fungi producing cellulase were isolated and identified from Sungai Pinang hot spring, Riau Province, Indonesia [16]. Twenty-eight out of the thirty-five thermophilic fungi isolated in caves and hot springs (Cardonal region of Hidalgo, Mexico) can produce proteases [17].
FUNGuild (Fungi Functional Guild) can classify and analyze fungal communities through microecological guild [18]. Guild is a concept in microecology. It involves a class of species (regardless of their close genetic relationship) that can similarly use the same kinds of environmental resources. The functional categorization of fungi can be accomplished by combining fungal species categorization with functional guild categorization through bioinformatics methods. According to FUNGuild, the ecological functions (pathotroph, saprotroph, and symbiotroph) of the fungi in the Tangchi hot spring water can be predicted. The ecological function analysis of the fungi in hot springs can provide reference value for the development and utilization of hot springs.
This is the first analysis of the fungal communities and ecological functions in Tangchi hot spring. This study can fill the gap in people’s understanding of fungal resources and provide theoretical support for developing and utilizing the fungal resources in Tangchi hot spring.

2. Materials and Methods

2.1. Sampling

Water samples were taken from Tangchi hot spring in Lujiang (China). Samples collected were packed into sterilized containers. The pH and temperature of the samples were detected on site. Then, water samples were filtered in the laboratory with 0.22 μM sterile microporous filter membranes to concentrate the microorganisms, and the filtered membranes were stored at −80 °C for subsequent DNA extraction.

2.2. Fungal ITS High-Throughput Sequencing

Total genomic DNA of microbes was extracted from Tangchi hot spring samples with E.Z.N.A™ Mag-Bind Soil DNA Kit (OMEGA, Norcross, GA, USA). The integrity and concentration of DNA samples were detected by agarose gel electrophoresis and Qubit 4.0 (Thermo, Waltham, MA, USA), respectively. The endogenous transcriptional spacer ITS region was used as the target sequence and amplified with universal primers ITS1F (CTTGGTCATTTAGAGGAAGTAA)/ITS2R (GCTGCGTTCTTCATCGATGC) [19]. The PCR amplification products were purified and homogenized, and a small fragment sequencing library was constructed using Paired-End method. The constructed library underwent library quality inspection, and then the qualified library was sequenced three times using Illumina MiSeq PE300 (Illumina, CA, USA).
Following the barcode and amplification primer sequence, every sample’s data were split from the off-machine data, the barcode sequence and primer sequence were cut off, and the reads of the sample were spliced [20]. Raw tags obtained by splicing were filtered to remove low-quality tags and chimeras that did not meet the length required to generate clean tags [21].

2.3. Bioinformatics Analysis

Using the Usearch software (version 11.0.667) the obtained high-quality sequences were merged and clustered into Operational Taxonomic Units (OTUs) with a similarity higher than 97%. After chimeric sequences and singleton OTU were removed, the fungal OTU representative sequences were blasted to UNITE database [22] by Blast classification algorithm. Four α-diversity indices consisting of Ace, Chao1, Shannon, and Simpson indices were figured for each sample by Mothur software (version 3.8.31).

2.4. Function Prediction

The fungi in Tangchi hot spring were classified into ecological functional groups according to the different ways of absorbing and using environmental resources by FUNGuild (Version 1.0) [23].

2.5. Data Accession

ITS gene sequencing data were accepted at Sequence Read Archive (SRA) under accession No. SRR20831103.

3. Results

3.1. Water Sample Parameters of Tangchi Hot Spring

The temperature and pH of the water samples from Tangchi hot spring were detected on site as 63.9 °C and pH 8.2, respectively. It can be seen that Tangchi hot spring is alkaline.

3.2. Sequencing Results of Hot Spring Samples

There were 56,052 reads and 56,039 valid tags from Tangchi hot spring (Table 1). After splitting and removing redundancy, the hot spring sample sequences were clustered with OTUs under a similarity of 97%, and 541 OTUs were obtained from Tangchi hot spring. The OTU information of the fungi with relative abundance values above 1% is displayed in Figure 1 and Table 2.

3.3. Composition of Fungal Communities

The OTU representative sequences from Tangchi hot spring were aligned. There were 10 phyla, 35 classes, 83 orders, 180 families, 293 genera, and 414 species in Tangchi hot spring.
At the phylum level, the fungi with relative abundance below 1% were assigned to Other. The fungi communities of Tangchi hot spring were mainly classified into four phyla (Figure 2a). There were Ascomycota (43.82%), Basidiomycota (32.38%), Chytridiomycota (16.55%), and Olpidiomycota (4.51%).
At the genus level, the fungi with relative abundance below 1% were assigned to Other. The fungal communities of Tangchi hot spring were classified into 18 genera (Figure 2b), which were Rhizophydium (11.68%), Aureobasidium (8.71%), Rhodotorula (8.56%), Sclerotinia (8.26%), Tausonia (5.90%), unclassified_GS17 (4.51%), Sclerostagonospora (3.65%), Cladosporium (2.12%), Saccharomyces (2.04%), Alternaria (1.92%), Cystofilobasidium (1.63%), Mrakia (1.47%), Powellomyces (1.43%), Ruinenia (1.27%), Sporobolomyces (1.26%), Boothiomyces (1.16%), Aspergillus (1.05%), and unclassified_Chytridiomycota (1.04%). There were unclassified fungi in Tangchi hot spring, indicating that the fungal genera in the hot spring have certain genera novelty.
Based on the taxonomic comparison of the sample, the classification of dominant species (relative abundance ≥ 1%) was selected to understand the dominant microorganisms’ evolutionary relationships and abundance differences in the sequenced environmental samples in terms of the entire taxonomic system. The taxonomic systematic composition (including domain, phylum, class, order, family, genus, species, and OTU) of the fungi in Tangchi hot spring was analyzed (Figure 3).

3.4. Fungal Alpha Diversity Analysis

Alpha diversity can represent the richness, diversity, and evenness of a microbial community. The Shannon index, Simpson index, and Good’s coverage are used to estimate the community diversity. The Chao1 and ACE estimators can estimate the community richness, and the Shannon even index can assess the community evenness [24]. The alpha diversity indices of the fungi in Tangchi hot spring and single factor analysis of variance were calculated (Table 3). The results suggested that the Shannon, Chao1, and ACE indices of the fungi in Tangchi hot spring were high; in addition, the Simpson index of the fungi was small. They indicated that the fungi in Tangchi hot spring were rich and diverse. The coverage indices of Tangchi hot spring were close to 1, reflecting that the sequencing results represented the real conditions of the water samples.

3.5. Fungal Function Prediction

FUNGuild analyzed the ecological function category of the fungi in Tangchi hot spring. Only OTUs and taxons with credible levels of ‘Probable’ and ‘Highly Probable’ were selected for analysis.
According to the functional prediction of the utilization pathways of the same environmental resources based on the fungal community, the definable functional trophic modes can be detected, which can be classified into three trophic modes (pathotroph, saprotroph, and symbiotroph) and four mutual cross-trophic modes (pathotroph–saprotroph, pathotroph–symbiotroph, saprotroph–symbiotroph, and pathotroph–saprotroph–symbiotroph) according to the absorption and utilization of environmental resources (Figure 4). Pathotroph (35.4%) dominates in Tangchi hot spring, followed by pathotroph–saprotroph (29.3%) and saprotroph (28.7%).
The above seven trophic modes were further assigned, among which the guilds with the relative abundance of dominant OTUs greater than 1% belonged to 11 guilds, and the guilds with dominant OTUs less than 1% were combined into others (Figure 5). The dominant guilds in Tangchi hot spring were plant pathogen (27.3%), undefined saprotroph (22.2%), animal endosymbiont–animal pathogen–endophyte–plant pathogen–undefined saprotroph (17.7%), animal pathogen–undefined saprotroph (7.3%), animal pathogen (6.8%), wood saprotroph (2.8%), endophyte–litter saprotroph–soil saprotroph–undefined saprotroph (2.1%), soil saprotroph–undefined saprotroph (1.8%), animal pathogen–plant pathogen–undefined saprotroph (1.5%), endophyte (1.2%), and plant saprotroph (1.0%).

4. Discussion

In this study, the diversity of the fungi in Tangchi hot spring was studied by high-throughput sequencing technology, which broke the technical bottleneck that a large number of microorganisms could not be isolated and cultured. At the phylum taxonomic level, the prevalent fungal phyla in Tangchi hot spring were Ascomycota (43.82%), Basidiomycota (32.39%), and Chytridiomycota (16.5%). Ascomycota and Basidiomycota have also been found to be the dominant phyla in the hot springs of the soda lakes in the Kenyan rift valley (83.3% and 15.8%, respectively) [4], Boiling Springs Lake (63.9% and 8.20%) [25], and Haikou hot spring (43.88% and 18.37%, respectively) [26]. Ascomycota and Basidiomycota have a good heat-resistant mechanism. Further, 89 species of heat-resistant fungi are reported worldwide, of which more than half (49 species) belong to Ascomycota and Basidiomycota [27,28]. Ascomycota is the largest fungal phylum and an extremely diverse group, with an estimated global species richness of approximately 154,500 species [29]. Ascomycota has two types: saprophytic and parasitic. Saprophytic Ascomycetes grow on various substrates, such as soil, decaying wood, animal and plant residues, etc. Parasitic species can cause plant diseases, with a few parasitizing on humans, animals, or insects. Some Ascomycetes form lichens in symbiosis with algae, and mycorrhizal fungi in symbiosis with higher plants [30]. Ascomycetes are used for industrial applications, food production, and flavoring, and the sporophores of morels and truffles are precious edible mushrooms. Basidiomycota can degrade lignin and plant polysaccharides [31], and they also produce secondary metabolites such as terpenoids and meroterpenoids [32]. To our knowledge, Chytridiomycota, 16.55% in Tangchi hot spring, has not yet been found in any other hot springs. Chytridiomycota is the most abundant basal fungal phylum involved in the vital processes in both terrestrial and aquatic ecosystems. However, its diversity and richness remain mysterious [33]. Chytridiomycota is a low-level fungus that parasitizes the larvae stage of black flies, mosquitoes, scale insects, and ants [34].
At the genus taxonomic level, the dominant fungal genera in Tangchi hot spring were Rhizophydium, Aureobasidium, Rhodotorula, Sclerotinia, Tausonia, unclassified_GS17, Sclerostagonospora, Cladosporium, Saccharomyces, Alternaria, Cystofilobasidium, Mrakia, Powellomyces, Ruinenia, Sporobolomyces, Boothiomyces, Aspergillus, and unclassified_Chytridiomycota. We know that there were several unclassified fungi genera in Tangchi hot spring, demonstrating a certain novelty in the fungi of Tangchi hot spring. As far as we know, Rhizophydium has not been reported in other hot springs but was detected in Tangchi hot spring. So far, Aureobasidium, existing in Tangchi hot spring, has also been discovered in the hot springs of the soda lakes in the Kenyan rift valley [4]. Aureobasidium is a dimorphic fungal genus with both primary yeast and secondary filamentous cells and an extensive distribution. The Aureobasidium genus can utilize various waste products and synthesize natural products such as pullulan, fructooligosaccharides, and melanin [35]. Cystobasidium, discovered in Tangchi hot spring, is also found in the hot springs in Haikou (China) (4.15%) [26], while no other common genera were found.
This study predicted the ecological functions of Tangchi hot spring by FUNGuild. From the perspective of trophic type, pathotroph, pathotroph–saprotroph, and saprotroph are the major trophic types, which may be related to Ascomycota and Basidiomycota being the dominant fungal phyla. Some Ascomycota are saprotrophs, which are important decomposers and can decompose refractory material. They play an important role in nutrient cycling [36]. However, some Ascomycota are animal pathogens, plant pathogens, or animal–plant pathogens, which are a few parasites, poultry and insects, and many parasitic plants. These aspects are consistent with the analysis results that the dominant guilds of Tangchi hot spring are plant pathogens and undefined saprotrophs. The dominant fungal genera, Rhizophydium and Aureobasidium, in Tangchi hot spring are not annotated in FUNGuild, which indicates that the annotations in FUNGuild are not comprehensive and its database needs to be supplemented and improved [23]. Sclerotinia sclerotiorum is a plant pathogen that can cause disease in more than 400 broad-leaved plant species, including vegetable crops, resulting in major yield losses [37,38]. Rhodotorula, 8.54% in Tangchi hot spring, is a common saprophytic yeast and an opportunistic (when animal immune function is impaired) pathogen in animals (including humans). It can induce skin infections in chickens and marine animals, lung infections and otitis media in sheep and cattle [39], and infections such as folliculitis and keratitis in humans [40,41]. According to reports, Rhodotorula has also been found in the hot springs of the soda lakes in the Kenyan rift valley and Saudi springs [4,42]. This study demonstrates the potential pathogens in hot springs that pose safety risks to human health, and some populations are not suitable for soaking in these hot springs. It can be seen that the FUNGuild function prediction results are consistent with the composition of the fungal communities of Tangchi hot spring.

5. Conclusions

This paper analyzed the fungal diversity of Tangchi hot spring in Lujiang using high-throughput sequencing technology for the first time. The results showed that there are rich fungal resources in Tangchi hot spring. Moreover, there are unclassified fungi in this hot spring, which shows that the fungi in Tangchi hot spring have a certain novelty. Pathogenic fungi account for a large proportion in Tangchi hot spring. There are still a large number of unknown fungal functions in Tangchi hot spring, and further research will be conducted in this area in the future. This study offers support for understanding the fungal diversity, resource development, and utilization in Tangchi hot spring, and it provides health guidance for soaking in this hot spring.

Author Contributions

Conceptualization, F.-Q.Z.; data preparation, F.-Q.Z.; methodology, F.-Q.Z.; analysis, F.-Q.Z. and J.L.; writing—original draft preparation, F.-Q.Z.; writing—review and editing, F.-Q.Z. and J.L.; supervision, X.-J.C.; funding acquisition X.-J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Projects of Chaohu University (grant numbers XLZ202308, kj21fdzy02, kj21kctd03), Key Research and Development Program Project in Anhui Province (grant number 202204c06020059), the Project of Educational Commission in Anhui province (grant number kj2021A1019), the School Level Key Construction Discipline of Food Science and Engineering in Chaohu University (grant number kj16zdjsxk02) and Outstanding Youth Research Project of Anhui Educational Committee (grant number 2023AH030092).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors have no conflicts of interest.

References

  1. Xia, Q.; Zhang, C.L.; Gao, Y.; Hu, C.; Zha, S.X.; Ma, M.G. Status and reliability appraisal of geothermal resources in Hefei city. Geol. Anhui 2015, 25, 222–226. (In Chinese) [Google Scholar] [CrossRef]
  2. Heinze, B. Sequencing of complete Chloroplast genomes. Methods Mol. Biol. 2021, 2222, 89–105. [Google Scholar] [CrossRef] [Scilit]
  3. Lu, T.; Zou, X.; Yang, Z.; Lei, F.; Chen, Y.; Liu, G.; Sun, B.; Li, Y. Transcriptome analysis of goat ovaries and follicles based on high-throughput sequencing. J. South China Agric. Univ. 2020, 41, 23–32. [Google Scholar] [CrossRef]
  4. Won, K.H.; Kim, D.; Shin, D.; Hur, J.; Lee, H.; Heo, J.; Oh, J.D. High-throughput sequencing-based metagenomic and transcriptomic analysis of intestine in piglets infected with salmonella. J. Anim. Sci. Technol. 2022, 64, 1144–1172. [Google Scholar] [CrossRef] [Scilit]
  5. Zhang, T.; Huang, P.D.; Qiu, C. Progresses in epigenetic studies of asthma from the perspective of high-throughput analysis technologies: A narrative review. Ann. Transl. Med. 2022, 10, 493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Mengual, X.; Mayer, C.; Burt, T.O.; Moran, K.M.; Dietz, L.; Nottebrock, G.; Pauli, T.; Young, A.D.; Brasseur, M.V.; Kukowka, S.; et al. Systematics and evolution of predatory flower flies (Diptera: Syrphidae) based on exon-capture sequencing. Syst. Entomol. 2022, 48, 250–277. [Google Scholar] [CrossRef] [Scilit]
  7. Victorino, Í.M.M.; Berruti, A.; Orgiazzi, A.; Voyron, S.; Bianciotto, V.; Lumini, E. High-Throughput DNA Sequence-Based Analysis of AMF Communities. Methods Mol. Biol. 2020, 2146, 99–116. [Google Scholar] [CrossRef] [Scilit]
  8. Liu, Z.; Iqbal, M.; Zeng, Z.; Lian, Y.; Zheng, A.; Zhao, M.; Li, Z.; Wang, G.; Li, Z.; Xie, J. Comparative analysis of microbial community structure in the ponds with different aquaculture model and fish by high-throughput sequencing. Microb. Pathog. 2020, 142, 104101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Sadeepa, D.; Sirisena, K.; Manage, P.M. Diversity of microbial communities in hot springs of Sri Lanka as revealed by 16S rRNA gene high-throughput sequencing analysis. Gene 2022, 812, 146103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Kioroglou, D.; Mas, A.; Portillo, M.C. High-throughput sequencing approach to analyze the effect of aging time and barrel usage on the microbial community composition of red wines. Front. Microbiol. 2020, 11, 562560. [Google Scholar] [CrossRef] [Scilit]
  11. Zhang, F.Q.; Liu, J.; Chen, X.J. Comparative analysis of bacterial diversity in two hot springs in Hefei, China. Sci. Rep. 2023, 13, 5832. [Google Scholar] [CrossRef] [Scilit]
  12. Katharina, A.S.; Johannes, K.; Joachim, M.; Andreas, L. Effects of Environmental and Nutritional Conditions on Mycelium Growth of Three Basidiomycota. Mycobiology 2024, 52, 124–134. [Google Scholar] [CrossRef] [Scilit]
  13. Kumar, A.; Suman, R.; Sneha, K.; Anamika, K.; Puja, B.; Pammi, K. Potentials and applications of thermophilic fungi: A general review. Invertis J. Renew. Energy 2021, 11, 39–41. [Google Scholar] [CrossRef] [Scilit]
  14. Salano, O.A.; Makonde, H.M.; Kasili, R.W.; Wangai, L.N.; Nawiri, M.P.; Boga, H.I. Diversity and distribution of fungal communities within the hot springs of soda lakes in the Kenyan rift valley. Afr. J. Microb. Res. 2017, 11, 764–775. [Google Scholar] [CrossRef]
  15. Liu, K.H.; Ding, X.W.; Salam, N.; Zhang, B.; Tang, X.F.; Deng, B.W.; Li, W.J. Unexpected fungal communities in the Rehai thermal springs of Tengchong infuenced by abiotic factors. Extremophiles 2018, 22, 525–535. [Google Scholar] [CrossRef] [Scilit]
  16. Saryono, S.; Novianty, R.; Suraya, N.; Piska, F.; Devi, S.; Pratiwi, N.W.; Ardhi, A. Molecular identification of cellulase-producing thermophilic fungi isolated from Sungai Pinang hot spring, Riau Province, Indonesia. Biodiversitas 2022, 23, 1457–1465. [Google Scholar] [CrossRef] [Scilit]
  17. Jazmín, L.C.A.; Guadalupe, G.S.; Karina, G.G.; Rafael, O.H.D. Biotechnological insights into extracellular enzyme production by thermotolerant fungi from hot springs and caves: Morphology, pellets formation, and protease production. Biotechnol. Appl. Biochem. 2024, 71, 536–552. [Google Scholar] [CrossRef] [Scilit]
  18. Yan, K.; Pei, Z.H.; Meng, L.N.; Zheng, Y.; Wang, L.; Feng, R.Z.; Li, Q.Z.; Liu, Y.; Zhao, X.M.; Wei, Q.; et al. Determination of community structure and diversity of seed-vectored endophytic fungi in Alpinia zerumbet. Front. Microb. 2022, 13, 814864. [Google Scholar] [CrossRef] [Scilit]
  19. Wang, W.; Cai, T.; Yang, Y.T.; Guo, H.; Shang, Z.; Shahid, H.; Zhang, Y.R.; Qiu, S.R.; Zeng, X.N.; Xu, X.L.; et al. Diversity of fungal communities on diseased and healthy cinnamomum burmannii fruits and antibacterial activity of secondary metabolites. Microbiol. Spectr. 2023, 11, e0008023. [Google Scholar] [CrossRef] [Scilit]
  20. Zhu, A.M.; Wu, Q.; Liu, H.L.; Sun, H.L.; Han, G.D. Isolation of rhizosheath and analysis of microbial community structure around roots of Stipa grandis. Sci. Rep. 2022, 12, 2707. [Google Scholar] [CrossRef] [Scilit]
  21. Lu, J.J.; Mao, D.C.; Li, X.; Ma, Y.Q.; Luan, Y.Q.; Cao, Y.; Luan, Y.P. Changes of intestinal microflora diversity in diarrhea model of KM mice and effects of Psidium guajava L. as the treatment agent for diarrhea. J. Infect. Public Health 2020, 13, 16–26. [Google Scholar] [CrossRef] [Scilit]
  22. Kõljalg, U.; Nilsson, R.H.; Abarenkov, K.; Tedersoo, L.; Taylor, A.F.S.; Bahram, M.; Bahram, M.; Bates, S.T.; Bruns, T.D.; Bengtsson-Palme, J.; et al. Towards a unified paradigm for sequence-based identification of fungi. Mol. Ecol. 2013, 22, 5271–5277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Nguyen, N.H.; Song, Z.W.; Bates, S.T.; Branco, S.; Tedersoo, L.; Menke, J.; Schillinge, J.S.; Kennedy, P.G. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol. 2016, 20, 241–248. [Google Scholar] [CrossRef] [Scilit]
  24. Chen, D.Y.; Li, C.W.; Feng, L.; Zhang, Z.Z.; Zhang, H.M.; Cheng, G.Y.; Li, D.S.; Zhang, G.Q.; Wang, H.N.; Chen, Y.X. Analysis of the influence of living environment and age on vaginal fungal microbiome in giant pandas (Ailuropoda melanoleuca) by high throughput sequencing. Microb. Pathog. 2018, 115, 280–286. [Google Scholar] [CrossRef] [Scilit]
  25. Wilson, M.S.; Siering, P.L.; White, C.L.; Hauser, M.E.; Bartles, A.N. Novel archaea and bacteria dominate stable microbial communities in North America’s largest hot spring. Microb. Ecol. 2008, 56, 292–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Shu, W.; Tian, X.Y.; Zhao, H.W. Diversity of fungi and bacteria in hot springs in Haikou, Hainan Province. Acta Microbiol. Sin. 2020, 60, 1999–2011. (In Chinese) [Google Scholar] [CrossRef]
  27. Mouchacca, J. Heat tolerant fungi and applied research: Addition to the previously treated group of strictly thermotolerant species. World J. Microb. Biot. 2007, 23, 1755–1770. [Google Scholar] [CrossRef] [Scilit]
  28. Mouchacca, J. Thermotolerant fungi erroneously reported in applied research work as possessing thermophilic attributes. World J. Microb. Biot. 2000, 16, 869–880. [Google Scholar] [CrossRef] [Scilit]
  29. Bánki, O.; Roskov, Y.; Döring, M.; Ower, G.; Vandepitte, L.; Hobern, D.; Remsen, D.; Schalk, P.; DeWalt, R.E.; Ma, K.; et al. Catalogue of Life Checklist (Version 2023-01-12); Catalogue of Life: Leiden, The Netherlands, 2023. [Google Scholar] [CrossRef]
  30. Wanasinghe, D.N.; Nimalrathna, T.S.; Xian, L.Q.; Faraj, T.K.; Xu, J.C.; Mortimer, P.E. Taxonomic novelties and global biogeography of Montagnula (Ascomycota, Didymos- phaeriaceae). MycoKeys 2024, 101, 191–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Manici, L.M.; Caputo, F.; Sabata, D.D.; Fornasier, F. The enzyme patterns of Ascomycota and Basidiomycota fungi reveal their different functions in soil. Appl. Soil. Ecol. 2024, 196, 105323. [Google Scholar] [CrossRef] [Scilit]
  32. Sum, W.C.; Ebada, S.S.; Matasyoh, J.C.; Stadler, M. Recent progress in the evaluation of secondary metabolites from Basidiomycota. Curr. Res. Biotechnol. 2023, 6, 100155. [Google Scholar] [CrossRef] [Scilit]
  33. Blaalid, R.; Khomich, M. Current knowledge of Chytridiomycota diversity in Northern Europe and future research needs. Fungal Biol. Rev. 2021, 36, 42–51. [Google Scholar] [CrossRef] [Scilit]
  34. Kaczmarek, A.; Boguś, M.I. Fungi of entomopathogenic potential in Chytridiomycota and Blastocladiomycota, and in fungal allies of the Oomycota and Microsporidia. IMA Fungus 2021, 12, 29. [Google Scholar] [CrossRef] [Scilit]
  35. Wang, P.; Jia, S.L.; Liu, G.L.; Chi, Z.; Chi, Z.M. Aureobasidium spp. and their applications in biotechnology. Process Biochem. 2022, 116, 72–83. [Google Scholar] [CrossRef] [Scilit]
  36. Sun, Q.; Wu, H.L.; Chen, F.; Kang, J.H. Fungal community diversity and structure in rhizosphere soil of different crops in the arid zone of central Ningxia. Microbiology 2019, 46, 2963–2972. [Google Scholar] [CrossRef]
  37. Lu, G. Engineering Sclerotinia Sclerotiorum resistance in oilseed crops. Afr. J. Biotechnol. 2003, 2, 6. [Google Scholar] [CrossRef] [Scilit]
  38. Bueno, E.A.; Oliveira, M.B.; Andrade, R.V.; Petrofeza, L. Effect of different carbon sources on proteases secreted by the fungal pathogen Sclerotinia sclerotiorum during Phaseolus vulgaris infection. Genet. Mol. Res GMR 2012, 11, 2171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Wirth, F.; Goldani, L.Z. Epidemiology of Rhodotorula: An emerging pathogen. Interdiscip. Perspect. Infect. Dis. 2012, 2012, 465717–465723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Ring, J.; Jaeger, T.; Anliker, M.D. Rhodotorula mucilaginosa infection in Li-Fraumeni-like syndrome: A new pathogen in folliculitis. Brit. J. Dermatol. 2011, 164, 1120–1122. [Google Scholar] [CrossRef] [Scilit]
  41. Giovannini, J.; Lee, R.; Zhang, S.X.; Jun, A.S.; Bower, K.S. Rhodotorula keratitis: A rarely encountered ocular pathogen. Case Rep. Ophthalmol. 2014, 5, 302–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Selim, S.; Hassan, S.; Hagagy, N.; Kraková, L.; Grivalský, T.; Pangallo, D. Assessment of microbial diversity in Saudi springs by culture dependent and independent methods. Geomicrobiol. J. 2016, 34, 443–453. [Google Scholar] [CrossRef] [Scilit]
Figure 1. OTU relative abundance of fungal communities in Tangchi hot spring.
Figure 1. OTU relative abundance of fungal communities in Tangchi hot spring.
Water 16 02308 g001
Figure 2. Phylum and genus level distributions of fungal communities in Tangchi hot spring. (a) Phylum level; (b) genus level.
Figure 2. Phylum and genus level distributions of fungal communities in Tangchi hot spring. (a) Phylum level; (b) genus level.
Water 16 02308 g002
Figure 3. Taxonomic systematic compositional tree of fungi in Tangchi hot spring.
Figure 3. Taxonomic systematic compositional tree of fungi in Tangchi hot spring.
Water 16 02308 g003
Figure 4. Trophic modes of fungi in Tangchi hot spring.
Figure 4. Trophic modes of fungi in Tangchi hot spring.
Water 16 02308 g004
Figure 5. Guilds of fungi in Tangchi hot spring.
Figure 5. Guilds of fungi in Tangchi hot spring.
Water 16 02308 g005
Table 1. Raw and clean data of fungal communities in Tangchi hot spring.
Table 1. Raw and clean data of fungal communities in Tangchi hot spring.
BarcodeSeqNumBaseNumMeanLenMinLenMaxLen
Raw DataACGAGTG56,05218,071,057322.444493
Clean DataACGAGTG56,03915,711,131280.36101451
Table 2. OTU taxonomy information of fungal communities in Tangchi hot spring.
Table 2. OTU taxonomy information of fungal communities in Tangchi hot spring.
OTU IDTaxonomy
OTU1d__Fungi; p__Chytridiomycota; c__Rhizophydiomycetes; o__Rhizophydiales; f__Rhizophydiaceae; g__Rhizophydium; s__unclassified_Rhizophydium
OTU4d__Fungi; p__Ascomycota; c__Leotiomycetes; o__Helotiales; f__Sclerotiniaceae;
g__Sclerotinia; s__Sclerotinia_sclerotiorum_SH1152486.08FU
OTU6d__Fungi; p__Ascomycota; c__Dothideomycetes; o__Dothideales; f__Aureobasidiaceae; g__Aureobasidium; s__unclassified_Aureobasidium
OTU5d__Fungi; p__Basidiomycota; c__Tremellomycetes; o__Cystofilobasidiales;
f__Mrakiaceae; g__Tausonia; s__Tausonia_pullulans_SH1650607.08FU
OTU7d__Fungi; p__Olpidiomycota; c__GS17; o__GS17;
f__unclassified_GS17;g__unclassified_GS17; s__unclassified_GS17
OTU8d__Fungi; p__Basidiomycota; c__Microbotryomycetes; o__Sporidiobolales;
f__Sporidiobolaceae; g__Rhodotorula; s__Rhodotorula_babjevae_SH2272266.08FU
OTU9d__Fungi; p__Ascomycota; c__Dothideomycetes; o__Pleosporales; f__Phaeosphaeriaceae; g__Sclerostagonospora; s__Sclerostagonospora_lathyri_SH1525096.08FU
OTU10d__Fungi; p__Basidiomycota; c__Microbotryomycetes; o__Sporidiobolales; f__Sporidiobolaceae; g__Rhodotorula; s__Rhodotorula_mucilaginosa_SH1181860.08FU
OTU61d__Fungi; p__Ascomycota; c__Saccharomycetes; o__Saccharomycetales; f__Saccharomycetaceae; g__Saccharomyces; s__Saccharomyces_cerevisiae_SH1613178.08FU
OTU12d__Fungi; p__Ascomycota; c__Dothideomycetes; o__Pleosporales; f__Pleosporaceae; g__Alternaria; s__unclassified_Alternaria
OTU11d__Fungi; p__Ascomycota; c__Dothideomycetes; o__Capnodiales; f__Cladosporiaceae; g__Cladosporium; s__Cladosporium_exasperatum_SH2320217.08FU
OTU13d__Fungi;p__Basidiomycota; c__Tremellomycetes; o__Cystofilobasidiales; f__Mrakiaceae;g__Mrakia; s__unclassified_Mrakia
OTU33d__Fungi; p__Basidiomycota; c__Agaricostilbomycetes; o__Agaricostilbales; f__Ruineniaceae; g__Ruinenia; s__Ruinenia_clavata_SH1575142.08FU
OTU28d__Fungi; p__Ascomycota; c__Dothideomycetes; o__Dothideales; f__Aureobasidiaceae; g__Aureobasidium; s__Aureobasidium_pullulans_SH1515141.08FU
OTU26d__Fungi; p__Chytridiomycota; c__unclassified_Chytridiomycota; o__unclassified_Chytridiomycota; f__unclassified_Chytridiomycota; g__unclassified_Chytridiomycota; s__unclassified_Chytridiomycota
Table 3. Fungal alpha diversity indexes of Tangchi hot spring.
Table 3. Fungal alpha diversity indexes of Tangchi hot spring.
SampleShannonChaoAceSimpsonShannonevenCoverage
Tangchi4.339195541.965517542.709090.0371570.6894810.99976
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, F.-Q.; Liu, J.; Chen, X.-J. Diversity and Ecological Functions of Fungal Communities in Tangchi Hot Spring in Lujiang (China). Water 2024, 16, 2308. https://doi.org/10.3390/w16162308

AMA Style

Zhang F-Q, Liu J, Chen X-J. Diversity and Ecological Functions of Fungal Communities in Tangchi Hot Spring in Lujiang (China). Water. 2024; 16(16):2308. https://doi.org/10.3390/w16162308

Chicago/Turabian Style

Zhang, Feng-Qin, Jun Liu, and Xiao-Ju Chen. 2024. "Diversity and Ecological Functions of Fungal Communities in Tangchi Hot Spring in Lujiang (China)" Water 16, no. 16: 2308. https://doi.org/10.3390/w16162308

APA Style

Zhang, F.-Q., Liu, J., & Chen, X.-J. (2024). Diversity and Ecological Functions of Fungal Communities in Tangchi Hot Spring in Lujiang (China). Water, 16(16), 2308. https://doi.org/10.3390/w16162308

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop