DNA Aptamers for the Functionalisation of DNA Origami Nanostructures
Abstract
1. Introduction
2. Aptamers for Target Immobilization
3. Aptamers for Controlling DNA Origami Structural Changes
3.1. DNA Origamis with Potential as Biosensors
3.2. DNA Origami for Molecular Computing
4. Aptamers for Cell Targeting
5. Conclusions and Perspective
Author Contributions
Funding
Conflicts of Interest
References
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [PubMed]
- Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [PubMed]
- Bock, L.C.; Griffin, L.C.; Latham, J.A.; Vermaas, E.H.; Toole, J.J. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 1992, 355, 564–566. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Liu, G.; Kai, M. DNA Aptamers in the Diagnosis and Treatment of Human Diseases. Molecules 2015, 20, 20979–20997. [Google Scholar] [CrossRef] [PubMed]
- Morita, Y.; Leslie, M.; Kameyama, H.; Volk, D.; Tanaka, T. Aptamer Therapeutics in Cancer: Current and Future. Cancers 2018, 10, 80. [Google Scholar] [CrossRef] [PubMed]
- Pieken, W.A.; Olsen, D.B.; Benseler, F.; Aurup, H.; Eckstein, F. Kinetic characterization of ribonuclease-resistant 2′-modified hammerhead ribozymes. Science 1991, 253, 314–317. [Google Scholar] [CrossRef] [PubMed]
- Cummins, L.L.; Owens, S.R.; Risen, L.M.; Lesnik, E.A.; Freier, S.M.; McGee, D.; Guinosso, C.J.; Cook, P.D. Characterization of fully 2′-modified oligoribonucleotide hetero- and homoduplex hybridization and nuclease sensitivity. Nucleic Acids Res. 1995, 23, 2019–2024. [Google Scholar] [CrossRef] [PubMed]
- Rohloff, J.C.; Gelinas, A.D.; Jarvis, T.C.; Ochsner, U.A.; Schneider, D.J.; Gold, L.; Janjic, N. Nucleic Acid Ligands with Protein-like Side Chains: Modified Aptamers and Their Use as Diagnostic and Therapeutic Agents. Mol. Ther. 2014, 3, e201. [Google Scholar] [CrossRef] [PubMed]
- Jarvis, T.C.; Davies, D.R.; Hisaminato, A.; Resnicow, D.I.; Gupta, S.; Waugh, S.M.; Nagabukuro, A.; Wadatsu, T.; Hishigaki, H.; Gawande, B.; et al. Non-helical DNA Triplex Forms a Unique Aptamer Scaffold for High Affinity Recognition of Nerve Growth Factor. Structure 2015, 23, 1293–1304. [Google Scholar] [CrossRef] [PubMed]
- Ng, E.W.M.; Shima, D.T.; Calias, P.; Cunningham, E.T.; Guyer, D.R.; Adamis, A.P. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat. Rev. Drug Discov. 2006, 5, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Kourlas, H.; Schiller, D.S. Pegaptanib sodium for the treatment of neovascular age-related macular degeneration: A review. Clin. Ther. 2006, 28, 36–44. [Google Scholar] [CrossRef] [PubMed]
- Lao, Y.-H.; Phua, K.K.L.; Leong, K.W. Aptamer Nanomedicine for Cancer Therapeutics: Barriers and Potential for Translation. ACS Nano 2015, 9, 2235–2254. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2017, 16, 181–202. [Google Scholar] [CrossRef] [PubMed]
- Sundaram, P.; Kurniawan, H.; Byrne, M.E.; Wower, J. Therapeutic RNA aptamers in clinical trials. Eur. J. Pharm. Sci. 2013, 48, 259–271. [Google Scholar] [CrossRef] [PubMed]
- Rothemund, P.W.K. Folding DNA to create nanoscale shapes and patterns. Nature 2006, 440, 297–302. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Meyer, T.A.; Pan, V.; Dutta, P.K.; Ke, Y. The Beauty and Utility of DNA Origami. Chem 2017, 2, 359–382. [Google Scholar] [CrossRef]
- Andersen, E.S.; Dong, M.; Nielsen, M.M.; Jahn, K.; Lind-Thomsen, A.; Mamdouh, W.; Gothelf, K.V.; Besenbacher, F.; Kjems, J. DNA Origami Design of Dolphin-Shaped Structures with Flexible Tails. ACS Nano 2008, 2, 1213–1218. [Google Scholar] [CrossRef] [PubMed]
- Chhabra, R.; Sharma, J.; Ke, Y.; Liu, Y.; Rinker, S.; Lindsay, S.; Yan, H. Spatially Addressable Multiprotein Nanoarrays Templated by Aptamer-Tagged DNA Nanoarchitectures. J. Am. Chem. Soc. 2007, 129, 10304–10305. [Google Scholar] [CrossRef] [PubMed]
- Ke, Y.; Lindsay, S.; Chang, Y.; Liu, Y.; Yan, H. Self-assembled water-soluble nucleic acid probe tiles for label-free RNA hybridization assays. Science 2008, 319, 180–183. [Google Scholar] [CrossRef] [PubMed]
- Williams, B.A.R.; Lund, K.; Liu, Y.; Yan, H.; Chaput, J.C. Self-Assembled Peptide Nanoarrays: An Approach to Studying Protein–Protein Interactions. Angew. Chem. Int. Ed. 2007, 46, 3051–3054. [Google Scholar] [CrossRef] [PubMed]
- Sharma, J.; Chhabra, R.; Andersen, C.S.; Gothelf, K.V.; Yan, H.; Liu, Y. Toward reliable gold nanoparticle patterning on self-assembled DNA nanoscaffold. J. Am. Chem. Soc. 2008, 130, 7820–7821. [Google Scholar] [CrossRef] [PubMed]
- Schnitzbauer, J.; Strauss, M.T.; Schlichthaerle, T.; Schueder, F.; Jungmann, R. Super-resolution microscopy with DNA-PAINT. Nat. Protoc. 2017, 12, 1198–1228. [Google Scholar] [CrossRef] [PubMed]
- Steinhauer, C.; Jungmann, R.; Sobey, T.L.; Simmel, F.C.; Tinnefeld, P. DNA Origami as a Nanoscopic Ruler for Super-Resolution Microscopy. Angew. Chem. Int. Ed. 2009, 48, 8870–8873. [Google Scholar] [CrossRef] [PubMed]
- Yamazaki, T.; Heddle, J.G.; Kuzuya, A.; Komiyama, M. Orthogonal enzyme arrays on a DNA origami scaffold bearing size-tunable wells. Nanoscale 2014, 6, 9122–9126. [Google Scholar] [CrossRef] [PubMed]
- Hong, F.; Zhang, F.; Liu, Y.; Yan, H. DNA Origami: Scaffolds for Creating Higher Order Structures. Chem. Rev. 2017, 117, 12584–12640. [Google Scholar] [CrossRef] [PubMed]
- Andersen, E.S.; Dong, M.; Nielsen, M.M.; Jahn, K.; Subramani, R.; Mamdouh, W.; Golas, M.M.; Sander, B.; Stark, H.; Cristiano, L.P.O.; et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature 2009, 459, 73–76. [Google Scholar] [CrossRef] [PubMed]
- Schüller, V.J.; Heidegger, S.; Sandholzer, N.; Nickels, P.C.; Suhartha, N.A.; Endres, S.; Bourquin, C.; Liedl, T. Cellular Immunostimulation by CpG-Sequence-Coated DNA Origami Structures. ACS Nano 2011, 5, 9696–9702. [Google Scholar] [CrossRef] [PubMed]
- Kuzyk, A.; Schreiber, R.; Fan, Z.; Pardatscher, G.; Roller, E.-M.; Högele, A.; Simmel, F.C.; Govorov, A.O.; Liedl, T. DNA-based self-assembly of chiral plasmonic nanostructures with tailored optical response. Nature 2012, 483, 311–314. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Jiang, S.; Wu, S.; Li, Y.; Mao, C.; Liu, Y.; Yan, H. Complex wireframe DNA origami nanostructures with multi-arm junction vertices. Nat. Nanotechnol. 2015, 10, 779–784. [Google Scholar] [CrossRef] [PubMed]
- Veneziano, R.; Ratanalert, S.; Zhang, K.; Zhang, F.; Yan, H.; Chiu, W.; Bathe, M. Designer nanoscale DNA assemblies programmed from the top down. Science 2016, 352, 1534. [Google Scholar] [CrossRef] [PubMed]
- Benson, E.; Mohammed, A.; Gardell, J.; Masich, S.; Czeizler, E.; Orponen, P.; Högberg, B. DNA rendering of polyhedral meshes at the nanoscale. Nature 2015, 523, 441–444. [Google Scholar] [CrossRef] [PubMed]
- Yurke, B.; Turberfield, A.J.; Mills, A.P.; Simmel, F.C.; Neumann, J.L. A DNA-fuelled molecular machine made of DNA. Nature 2000, 406, 605–608. [Google Scholar] [CrossRef] [PubMed]
- Han, D.; Pal, S.; Liu, Y.; Yan, H. Folding and cutting DNA into reconfigurable topological nanostructures. Nat. Nanotechnol. 2010, 5, 712–717. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, H.K.K.; Chakraborty, B.; Sha, R.; Seeman, N.C. The label-free unambiguous detection and symbolic display of single nucleotide polymorphisms on DNA origami. Nano Lett. 2011, 11, 910–913. [Google Scholar] [CrossRef] [PubMed]
- Tan, L.H.; Xing, H.; Lu, Y. DNA as a powerful tool for morphology control, spatial positioning, and dynamic assembly of nanoparticles. Acc. Chem. Res. 2014, 47, 1881–1890. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Lee, J.H.; Lu, Y. Quantum Dot Encoding of Aptamer-Linked Nanostructures for One-Pot Simultaneous Detection of Multiple Analytes. Anal. Chem. 2007, 79, 4120–4125. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Lu, Y. Smart Nanomaterials Responsive to Multiple Chemical Stimuli with Controllable Cooperativity. Adv. Mater. 2006, 18, 1667–1671. [Google Scholar] [CrossRef]
- Mo, R.; Jiang, T.; DiSanto, R.; Tai, W.; Gu, Z. ATP-triggered anticancer drug delivery. Nat. Commun. 2014, 5, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Liao, W.-C.; Lu, C.-H.; Hartmann, R.; Wang, F.; Sohn, Y.S.; Parak, W.J.; Willner, I. Adenosine Triphosphate-Triggered Release of Macromolecular and Nanoparticle Loads from Aptamer/DNA-Cross-Linked Microcapsules. ACS Nano 2015, 9, 9078–9086. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Li, Q.; Wang, L.; Zhang, G.-J.; Fan, C. Framework-Nucleic-Acid-Enabled Biosensor Development. ACS Sens. 2018, 3, 903–919. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Green, A.A.; Yan, H.; Fan, C. Engineering nucleic acid structures for programmable molecular circuitry and intracellular biocomputation. Nat. Rev. Clin. Oncol. 2017, 9, 1056–1067. [Google Scholar] [CrossRef] [PubMed]
- Seeman, N.C.; Sleiman, H.F. DNA nanotechnology. Nat. Rev. Clin. Oncol. 2017, 3, 1–23. [Google Scholar] [CrossRef]
- Hu, Q.; Li, H.; Wang, L.; Gu, H.; Fan, C. DNA Nanotechnology-Enabled Drug Delivery Systems. Chem. Rev. 2018. [Google Scholar] [CrossRef] [PubMed]
- Chen, A.; Yan, M.; Yang, S. Split aptamers and their applications in sandwich aptasensors. Trends Anal. Chem. 2016, 80, 581–593. [Google Scholar] [CrossRef]
- Meng, H.-M.; Liu, H.; Kuai, H.; Peng, R.; Mo, L.; Zhang, X.-B. Aptamer-integrated DNA nanostructures for biosensing, bioimaging and cancer therapy. Chem. Soc. Rev. 2016, 45, 2583–2602. [Google Scholar] [CrossRef] [PubMed]
- Shiu, S.C.-C.; Kinghorn, A.B.; Sakai, Y.; Cheung, Y.-W.; Heddle, J.G.; Tanner, J.A. The Three S’s for Aptamer-Mediated Control of DNA Nanostructure Dynamics: Shape, Self-Complementarity, and Spatial Flexibility. Chem BioChem 2018, 19, 1900–1906. [Google Scholar] [CrossRef] [PubMed]
- Alivisatos, A.P.; Johnsson, K.P.; Peng, X.; Wilson, T.E.; Loweth, C.J.; Bruchez, M.P.; Schultz, P.G. Organization of ‘nanocrystal molecules’ using DNA. Nature 1996, 382, 609–611. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Park, S.H.; Finkelstein, G.; Reif, J.H.; LaBean, T.H. DNA-templated self-assembly of protein arrays and highly conductive nanowires. Science 2003, 301, 1882–1884. [Google Scholar] [CrossRef] [PubMed]
- Niemeyer, C.M.; Bürger, W.; Peplies, J. Covalent DNA–Streptavidin Conjugates as Building Blocks for Novel Biometallic Nanostructures. Angew. Chem. Int. Ed. 1998, 37, 2265–2268. [Google Scholar] [CrossRef]
- Liu, Y.; Lin, C.; Li, H.; Yan, H. Aptamer-Directed Self-Assembly of Protein Arrays on a DNA Nanostructure. Angew. Chem. Int. Ed. 2005, 44, 4333–4338. [Google Scholar] [CrossRef] [PubMed]
- Green, L.S.; Jellinek, D.; Jenison, R.; Ostman, A.; Heldin, C.H.; Janjic, N. Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry 1996, 35, 14413–14424. [Google Scholar] [CrossRef] [PubMed]
- Tasset, D.M.; Kubik, M.F.; Steiner, W. Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol. 1997, 272, 688–698. [Google Scholar] [CrossRef] [PubMed]
- Rinker, S.; Ke, Y.; Liu, Y.; Chhabra, R.; Yan, H. Self-assembled DNA nanostructures for distance-dependent multivalent ligand–protein binding. Nat. Nanotechnol. 2008, 3, 418–422. [Google Scholar] [CrossRef] [PubMed]
- Mei, Q.; Johnson, R.H.; Wei, X.; Su, F.; Liu, Y.; Kelbauskas, L.; Lindsay, S.; Meldrum, D.R.; Yan, H. On-chip isotachophoresis separation of functional DNA origami capture nanoarrays from cell lysate. Nano Res. 2013, 6, 712–719. [Google Scholar] [CrossRef]
- Diener, J.L.; Wagner-Whyte, J.; Fontana, D.; Corp, A. Aptamers That Bind Thrombin with High Affinity. US Patent 7,998,939B2, 16 August 2011. [Google Scholar]
- Kumar, N.; Seminario, J.M. Molecular dynamics study of thrombin capture by aptamers TBA26 and TBA29 coupled to a DNA origami. Mol. Simul. 2018, 44, 749–756. [Google Scholar] [CrossRef]
- Godonoga, M.; Lin, T.-Y.; Oshima, A.; Sumitomo, K.; Tang, M.S.L.; Cheung, Y.-W.; Kinghorn, A.B.; Dirkzwager, R.M.; Zhou, C.; Kuzuya, A.; et al. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly. Sci. Rep. 2016, 6, 21266. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Wang, Y.; Xu, D.; Pang, L. Aptamer-tagged DNA origami for spatially addressable detection of aflatoxin B1. Chem. Commun. 2017, 53, 941–944. [Google Scholar] [CrossRef] [PubMed]
- Tintoré, M.; Gállego, I.; Manning, B.; Eritja, R.; Fàbrega, C. DNA Origami as a DNA Repair Nanosensor at the Single-Molecule Level. Angew. Chem. Int. Ed. 2013, 52, 7747–7750. [Google Scholar] [CrossRef] [PubMed]
- Cheung, Y.-W.; Kwok, J.; Law, A.W.L.; Watt, R.M.; Kotaka, M.; Tanner, J.A. Structural basis for discriminatory recognition of Plasmodium lactate dehydrogenase by a DNA aptamer. Proc. Natl. Acad. Sci. USA 2013, 110, 15967–15972. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Chen, H.; Pan, J.; Cha, T.-G.; Medintz, I.L.; Choi, J.H. A DNAzyme-mediated logic gate for programming molecular capture and release on DNA origami. Chem. Commun. 2016, 52, 8369–8372. [Google Scholar] [CrossRef] [PubMed]
- Le, L.C.; Cruz-Aguado, J.A.; Penner, G.A.; Limited, N.B. DNA Ligands for Aflatoxin and Zearalenone. US Patent 13/391,426, 6 September 2012. [Google Scholar]
- Daems, D.; Pfeifer, W.; Rutten, I.; Saccà, B.; Spasic, D.; Lammertyn, J. Three-Dimensional DNA Origami as Programmable Anchoring Points for Bioreceptors in Fiber Optic Surface Plasmon Resonance Biosensing. ACS Appl. Mater. Interfaces 2018, 10, 23539–23547. [Google Scholar] [CrossRef] [PubMed]
- Rajendran, A.; Nakata, E.; Nakano, S.; Morii, T. Nucleic-Acid-Templated Enzyme Cascades. Chem. Bio. 2017, 18, 696–716. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Liu, M.; Liu, Y.; Woodbury, N.W.; Yan, H. Interenzyme Substrate Diffusion for an Enzyme Cascade Organized on Spatially Addressable DNA Nanostructures. J. Am. Chem. Soc. 2012, 134, 5516–5519. [Google Scholar] [CrossRef] [PubMed]
- Nakata, E.; Liew, F.F.; Uwatoko, C.; Kiyonaka, S.; Mori, Y.; Katsuda, Y.; Endo, M.; Sugiyama, H.; Morii, T. Zinc-Finger Proteins for Site-Specific Protein Positioning on DNA-Origami Structures. Angew. Chem. Int. Ed. 2012, 51, 2421–2424. [Google Scholar] [CrossRef] [PubMed]
- Ngo, T.A.; Nakata, E.; Saimura, M.; Kodaki, T.; Morii, T. A protein adaptor to locate a functional protein dimer on molecular switchboard. Methods 2014, 67, 142–150. [Google Scholar] [CrossRef] [PubMed]
- Ngo, T.A.; Nakata, E.; Saimura, M.; Morii, T. Spatially Organized Enzymes Drive Cofactor-Coupled Cascade Reactions. J. Am. Chem. Soc. 2016, 138, 3012–3021. [Google Scholar] [CrossRef] [PubMed]
- Kurokawa, T.; Kiyonaka, S.; Nakata, E.; Endo, M.; Koyama, S.; Mori, E.; Tran, N.H.; Dinh, H.; Suzuki, Y.; Hidaka, K.; et al. DNA Origami Scaffolds as Templates for Functional Tetrameric Kir3 K+ Channels. Angew. Chem. Int. Ed. 2018, 57, 2586–2591. [Google Scholar] [CrossRef] [PubMed]
- Douglas, S.M.; Bachelet, I.; Church, G.M. A logic-gated nanorobot for targeted transport of molecular payloads. Science 2012, 335, 831–834. [Google Scholar] [CrossRef] [PubMed]
- Koirala, D.; Shrestha, P.; Emura, T.; Hidaka, K.; Mandal, S.; Endo, M.; Sugiyama, H.; Mao, H. Single-Molecule Mechanochemical Sensing Using DNA Origami Nanostructures. Angew. Chem. Int. Ed. 2014, 53, 8137–8141. [Google Scholar] [CrossRef] [PubMed]
- Amir, Y.; Ben-Ishay, E.; Levner, D.; Ittah, S.; Abu-Horowitz, A.; Bachelet, I. Universal computing by DNA origami robots in a living animal. Nat. Nanotechnol. 2014, 9, 353–357. [Google Scholar] [CrossRef] [PubMed]
- Kaur, H.; Yung, L.-Y.L. Probing High Affinity Sequences of DNA Aptamer against VEGF165. PLoS ONE 2012, 7, e31196. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Shangguan, D.; Wang, K.; Shi, H.; Sefah, K.; Mallikratchy, P.; Chen, H.W.; Li, Y.; Tan, W. Selection of Aptamers for Molecular Recognition and Characterization of Cancer Cells. Anal. Chem. 2007, 79, 4900–4907. [Google Scholar] [CrossRef] [PubMed]
- Shangguan, D.; Tang, Z.; Mallikaratchy, P.; Xiao, Z.; Tan, W. Optimization and Modifications of Aptamers Selected from Live Cancer Cell Lines. Chem. Bio. 2007, 8, 603–606. [Google Scholar] [CrossRef] [PubMed]
- Shangguan, D.; Cao, Z.; Meng, L.; Mallikaratchy, P.; Sefah, K.; Wang, H.; Li, Y.; Tan, W. Cell-Specific Aptamer Probes for Membrane Protein Elucidation in Cancer Cells. J. Proteome Res. 2008, 7, 2133–2139. [Google Scholar] [CrossRef] [PubMed]
- Tang, M.S.L.; Shiu, S.C.-C.; Godonoga, M.; Cheung, Y.-W.; Liang, S.; Dirkzwager, R.M.; Kinghorn, A.B.; Fraser, L.A.; Heddle, J.G.; Tanner, J.A. An aptamer-enabled DNA nanobox for protein sensing. Nanomed. Nanotechnol. 2018, 14, 1161–1168. [Google Scholar] [CrossRef] [PubMed]
- Kuzuya, A.; Sakai, Y.; Yamazaki, T.; Xu, Y.; Komiyama, M. Nanomechanical DNA origami ‘single-molecule beacons’ directly imaged by atomic force microscopy. Nat. Commun. 2011, 2, 449. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Jiang, S.; Liu, X.; Pan, L.; Zhang, C. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates. ACS Appl. Mater. Interfaces 2016, 8, 34054–34060. [Google Scholar] [CrossRef] [PubMed]
- Wu, N.; Willner, I. Programmed dissociation of dimer and trimer origami structures by aptamer-ligand complexes. Nanoscale 2017, 9, 1416–1422. [Google Scholar] [CrossRef] [PubMed]
- Huizenga, D.E.; Szostak, J.W. A DNA aptamer that binds adenosine and ATP. Biochemistry 1995, 34, 656–665. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.H.; Patel, D.J. Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: Distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP. Chem. Biol. 1997, 4, 817–832. [Google Scholar] [CrossRef]
- Walter, H.-K.; Bauer, J.; Steinmeyer, J.; Kuzuya, A.; Niemeyer, C.M.; Wagenknecht, H.-A. “DNA Origami Traffic Lights” with a Split Aptamer Sensor for a Bicolor Fluorescence Readout. Nano Lett. 2017, 17, 2467–2472. [Google Scholar] [CrossRef] [PubMed]
- Walter, H.-K.; Bohländer, P.R.; Wagenknecht, H.-A. Development of a Wavelength-Shifting Fluorescent Module for the Adenosine Aptamer Using Photostable Cyanine Dyes. ChemistryOpen 2015, 4, 92–96. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, Y.; Endo, M.; Suzuki, Y.; Hidaka, K.; Durand, G.; Dausse, E.; Toulme, J.J.; Sugiyama, H. Single-molecule observations of RNA-RNA kissing interactions in a DNA nanostructure. Biomater. Sci. 2016, 4, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Durand, G.; Lisi, S.; Ravelet, C.; Dausse, E.; Peyrin, E.; Toulmé, J.-J. Riboswitches Based on Kissing Complexes for the Detection of Small Ligands. Angew. Chem. Int. Ed. 2014, 53, 6942–6945. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Jiang, Q.; Liu, J.; Li, N.; Liu, Q.; Dai, L.; Gao, Y.; Liu, W.; Liu, D.; Ding, B. DNA origami/gold nanorod hybrid nanostructures for the circumvention of drug resistance. Nanoscale 2017, 9, 7750–7754. [Google Scholar] [CrossRef] [PubMed]
- Chaithongyot, S.; Chomanee, N.; Charngkaew, K.; Udomprasert, A.; Kangsamaksin, T. Aptamer-functionalized DNA nanosphere as a stimuli-responsive nanocarrier. Mater. Lett. 2018, 214, 72–75. [Google Scholar] [CrossRef]
- Ferreira, C.S.M.; Matthews, C.S.; Missailidis, S. DNA aptamers that bind to MUC1 tumour marker: Design and characterization of MUC1-binding single-stranded DNA aptamers. Tumour Biol. 2006, 27, 289–301. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Lu, Y. Fast Colorimetric Sensing of Adenosine and Cocaine Based on a General Sensor Design Involving Aptamers and Nanoparticles. Angew. Chem. Int. Ed. 2006, 45, 90–94. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Jiang, Q.; Liu, S.; Zhang, Y.; Tian, Y.; Song, C.; Wang, J.; Zou, Y.; Anderson, G.J.; Han, J.-Y.; et al. A DNA nanorobot functions as a cancer therapeutic in response to a molecular trigger in vivo. Nat. Chem. 2018, 36, 258–264. [Google Scholar] [CrossRef] [PubMed]
- Girvan, A.C.; Teng, Y.; Casson, L.K.; Thomas, S.D.; Jüliger, S.; Ball, M.W.; Klein, J.B.; Pierce, W.M.; Barve, S.S.; Bates, P.J. AGRO100 inhibits activation of nuclear factor-kappaB (NF-kappaB) by forming a complex with NF-kappaB essential modulator (NEMO) and nucleolin. Mol. Cancer Ther. 2006, 5, 1790–1799. [Google Scholar] [CrossRef] [PubMed]
- Ireson, C.R.; Kelland, L.R. Discovery and development of anticancer aptamers. Mol. Cancer Ther. 2006, 5, 2957–2962. [Google Scholar] [CrossRef] [PubMed]
- Sun, P.; Zhang, N.; Tang, Y.; Yang, Y.; Zhou, J.; Zhao, Y. Site-specific anchoring aptamer C2NP on DNA origami nanostructures for cancer treatment. RSC Adv. 2018, 8, 26300–26308. [Google Scholar] [CrossRef]
- Parekh, P.; Kamble, S.; Zhao, N.; Zeng, Z.; Portier, B.P.; Zu, Y. Immunotherapy of CD30-expressing lymphoma using a highly stable ssDNA aptamer. Biomaterials 2013, 34, 8909–8917. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, H.; Sode, K.; Ikebukuro, K. Selection of DNA aptamers against VEGF165 using a protein competitor and the aptamer blotting method. Biotechnol. Lett. 2008, 30, 829–834. [Google Scholar] [CrossRef] [PubMed]
- Stojanovic, M.N.; de Prada, P.; Landry, D.W. Aptamer-Based Folding Fluorescent Sensor for Cocaine. J. Am. Chem. Soc. 2001, 123, 4928–4931. [Google Scholar] [CrossRef] [PubMed]
- Nutiu, R.; Li, Y. Structure-Switching Signaling Aptamers. J. Am. Chem. Soc. 2003, 125, 4771–4778. [Google Scholar] [CrossRef] [PubMed]
- Stojanovic, M.N.; de Prada, P.; Landry, D.W. Fluorescent Sensors Based on Aptamer Self-Assembly. J. Am. Chem. Soc. 2000, 122, 11547–11548. [Google Scholar] [CrossRef] [PubMed]
- Koirala, D.; Yu, Z.; Dhakal, S.; Mao, H. Detection of Single Nucleotide Polymorphism Using Tension-Dependent Stochastic Behavior of a Single-Molecule Template. J. Am. Chem. Soc. 2011, 133, 9988–9991. [Google Scholar] [CrossRef] [PubMed]
- Han, D.; Pal, S.; Nangreave, J.; Deng, Z.; Liu, Y.; Yan, H. DNA origami with complex curvatures in three-dimensional space. Science 2011, 332, 342–346. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Tian, C.; Yu, J.; Li, Y.; Jiang, W.; Mao, C. Self-Assembly of Responsive Multilayered DNA Nanocages. J. Am. Chem. Soc. 2015, 137, 1730–1733. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Endo, M.; Hidaka, K.; Sugiyama, H. Photo-Controllable DNA Origami Nanostructures Assembling into Predesigned Multiorientational Patterns. J. Am. Chem. Soc. 2012, 134, 20645–20653. [Google Scholar] [CrossRef] [PubMed]
- Sefah, K.; Shangguan, D.; Xiong, X.; O’Donoghue, M.B.; Tan, W. Development of DNA aptamers using Cell-SELEX. Nat. Protoc. 2010, 5, 1169–1185. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.; Kim, D.-M.; Kim, K.-S.; Jung, W.; Kim, D.-E. Applications of Cancer Cell-Specific Aptamers in Targeted Delivery of Anticancer Therapeutic Agents. Molecules 2018, 23, 830. [Google Scholar] [CrossRef] [PubMed]
- Chang, M.; Yang, C.-S.; Huang, D.-M. Aptamer-conjugated DNA icosahedral nanoparticles as a carrier of doxorubicin for cancer therapy. ACS Nano 2011, 5, 6156–6163. [Google Scholar] [CrossRef] [PubMed]
- Srivithya, V.; Roun, H.; Babu, M.S.; Hyung, P.J.; Ha, P.S. Aptamer-conjugated DNA nano-ring as the carrier of drug molecules. Nanotechnology 2018, 29, 095602. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Zheng, J.; Song, E.; Donovan, M.; Zhang, K.; Liu, C.; Tan, W. Self-assembled, aptamer-tethered DNA nanotrains for targeted transport of molecular drugs in cancer theranostics. Proc. Natl. Acad. Sci. USA 2013, 110, 7998–8003. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Ma, Y.; Xie, Y.; An, Y.; Huang, Y.; Zhu, Z.; Yang, C.J. A Controllable Aptamer-Based Self-Assembled DNA Dendrimer for High Affinity Targeting, Bioimaging and Drug Delivery. Sci. Rep. 2015, 5, 10099. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Wu, L.; Wang, L.; Jiang, W. A dual-targeting DNA tetrahedron nanocarrier for breast cancer cell imaging and drug delivery. Talanta 2018, 179, 356–363. [Google Scholar] [CrossRef] [PubMed]
- You, M.; Peng, L.; Shao, N.; Zhang, L.; Qiu, L.; Cui, C.; Tan, W. DNA “Nano-Claw”: Logic-Based Autonomous Cancer Targeting and Therapy. J. Am. Chem. Soc. 2014, 136, 1256–1259. [Google Scholar] [CrossRef] [PubMed]
- Charoenphol, P.; Bermudez, H. Aptamer-targeted DNA nanostructures for therapeutic delivery. Mol. Pharm. 2014, 11, 1721–1725. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wei, T.; Zhao, J.; Huang, Y.; Deng, H.; Kumar, A.; Wang, C.; Liang, Z.; Ma, X.; Liang, X.-J. Multifunctional aptamer-based nanoparticles for targeted drug delivery to circumvent cancer resistance. Biomaterials 2016, 91, 44–56. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.S.; Zhao, D.; Shao, X.R.; Lin, S.Y.; Xie, X.P.; Liu, M.T.; Ma, W.J.; Shi, S.R.; Lin, Y.F. Aptamer-Modified Tetrahedral DNA Nanostructure for Tumor-Targeted Drug Delivery. ACS Appl. Mater. Interfaces 2017, 9, 36695–36701. [Google Scholar] [CrossRef] [PubMed]
- Jain, R.K.; Stylianopoulos, T. Delivering nanomedicine to solid tumors. Nat. Rev. Clin. Oncol. 2010, 7, 653–664. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Q.; Song, C.; Nangreave, J.; Liu, X.; Lin, L.; Qiu, D.; Wang, Z.-G.; Zou, G.; Liang, X.; Yan, H.; et al. DNA origami as a carrier for circumvention of drug resistance. J. Am. Chem. Soc. 2012, 134, 13396–13403. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.-X.; Shaw, A.; Zeng, X.; Benson, E.; Nyström, A.M.; Högberg, B. DNA origami delivery system for cancer therapy with tunable release properties. ACS Nano 2012, 6, 8684–8691. [Google Scholar] [CrossRef] [PubMed]
- Halley, P.D.; Lucas, C.R.; McWilliams, E.M.; Webber, M.J.; Patton, R.A.; Kural, C.; Lucas, D.M.; Byrd, J.C.; Castro, C.E. Daunorubicin-Loaded DNA Origami Nanostructures Circumvent Drug-Resistance Mechanisms in a Leukemia Model. Small 2015, 12, 308–320. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Rahman, M.A.; Zhao, Z.; Weiss, K.; Zhang, C.; Chen, Z.; Hurwitz, S.J.; Chen, Z.G.; Shin, D.M.; Ke, Y. Visualization of the Cellular Uptake and Trafficking of DNA Origami Nanostructures in Cancer Cells. J. Am. Chem. Soc. 2018, 140, 2478–2484. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Jiang, Q.; Li, N.; Dai, L.; Liu, Q.; Song, L.; Wang, J.; Li, Y.; Tian, J.; Ding, B.; et al. DNA origami as an in vivo drug delivery vehicle for cancer therapy. ACS Nano 2014, 8, 6633–6643. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Q.; Shi, Y.; Zhang, Q.; Li, N.; Zhan, P.; Song, L.; Dai, L.; Tian, J.; Du, Y.; Cheng, Z.; et al. A Self-Assembled DNA Origami-Gold Nanorod Complex for Cancer Theranostics. Small 2015, 11, 5134–5141. [Google Scholar] [CrossRef] [PubMed]
- Perrault, S.D.; Shih, W.M. Virus-Inspired Membrane Encapsulation of DNA Nanostructures to Achieve In Vivo Stability. ACS Nano 2014, 8, 5132–5140. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Jain, P.K.; El-Sayed, I.H.; El-Sayed, M.A. Plasmonic photothermal therapy (PPTT) using gold nanoparticles. Lasers Med. Sci. 2007, 23, 217–228. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Song, L.; Liu, S.; Jiang, Q.; Liu, Q.; Li, N.; Wang, Z.-G.; Ding, B. A DNA-Based Nanocarrier for Efficient Gene Delivery and Combined Cancer Therapy. Nano Lett. 2018, 18, 3328–3334. [Google Scholar] [CrossRef] [PubMed]
Name | Target | Sequences | Length/DNA or RNA | Employed by | Ref. |
---|---|---|---|---|---|
HD1 | Thrombin (exosite I) | GGTTGGTGTGGTTGG | 15nt ssDNA | [53,54,59,61] | [3] |
HD22 | Thrombin (exosite II) | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 29nt ssDNA | [18,56,59,63] | [52] |
NU172 1 | Thrombin | CGCCTAGGTTGGGTAGGGTGGTGGCG | 26nt ssDNA | [56] | [55] |
36t | PDGF (platelet derived growth factor) | CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT | 40nt ssDNA | [18] | [51] |
41t | PDGF | TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTAT | 45nt ssDNA | [70,71,72] | [51] |
SL12 | VEGF (vascular endothelial growth factor) | ATACCAGTCTATTCAATTGGGCCCGTCCGTATGGTGGGTGTGCT 3 | 44nt ssDNA | [72] | [73] |
TE17 | CCRF-CEM cell | CAGCTACGCAATACAAAACTCCGAACACCTGCTTCTGACTGGGTGCTG | 48nt ssDNA | [70] | [74] |
sgc8c | PTK7 | ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA | 41nt ssDNA | [70] | [75,76] |
2008s | PfLDH | CTGGGCGGTAGAACCATAGTGACCCAGCCGTCTAC | 35nt ssDNA | [57,77] | [60] |
AFB1 aptamer | AFB1 | GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCAC | 49nt ssDNA | [58] | [62] |
ATP aptamer | ATP | ACCTGGGGGAGTATTGCGGAGGAAGGT 4 | 27nt ssDNA | [78,79,80] | [81,82] |
ATP aptamer | ATP | 1: CTAcUACCTGGGGGAGTAT 5 2: TGCGGAGGAAGGTcUAG | 43nt ssDNA | [83] | [84] |
aptakiss and GTP switch | GTP | aptakiss: UGCUCGGCCCCGCGAGCA GTPswitch: UCCGAAGUGGUUGGGCUGGGGCGUGUGAAAACGGAGTPswitch mutant: UCCGAAGUGGUUGGGCUGGGCGUGUGAAAACGGA | 18nt RNA/35nt RNA/34nt RNA | [85] | [86] |
S2.2 | MUC-1 | GCAGTTGATCCTTTGGATACCCTGG | 25nt ssDNA | [87,88] | [89] |
cocaine aptamer | cocaine | GGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC6 | 39nt ssDNA | [79,80] | [90] |
AS14112 | Nucleolin | GGTGGTGGTGGTTGTGGTGGTGGTGG | 26nt ssDNA | [91] | [92,93] |
C2NP | CD30 | ACTGGGCGAAACAAGTCTATTGACTATGAGC | 32nt ssDNA | [94] | [95] |
zif268 binding site | zif268 | CTGCGTGGGCGTGTTTTCACGCCCACGCAG | 30nt ssDNA | [64,66,69] | [66] |
AZP4 binding site | AZP4 | CTTACGTGGCATGTTTCATGCCTCGTAAG | 29nt ssDNA | [66,69] | [66] |
GCN4 binding site | GCN4 | CTTCATGAGTCATGCGTTTTCGCATGACTCATGAAG | 36nt ssDNA | [64,67] | [67] |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sakai, Y.; Islam, M.S.; Adamiak, M.; Shiu, S.C.-C.; Tanner, J.A.; Heddle, J.G. DNA Aptamers for the Functionalisation of DNA Origami Nanostructures. Genes 2018, 9, 571. https://doi.org/10.3390/genes9120571
Sakai Y, Islam MS, Adamiak M, Shiu SC-C, Tanner JA, Heddle JG. DNA Aptamers for the Functionalisation of DNA Origami Nanostructures. Genes. 2018; 9(12):571. https://doi.org/10.3390/genes9120571
Chicago/Turabian StyleSakai, Yusuke, Md. Sirajul Islam, Martyna Adamiak, Simon Chi-Chin Shiu, Julian Alexander Tanner, and Jonathan Gardiner Heddle. 2018. "DNA Aptamers for the Functionalisation of DNA Origami Nanostructures" Genes 9, no. 12: 571. https://doi.org/10.3390/genes9120571
APA StyleSakai, Y., Islam, M. S., Adamiak, M., Shiu, S. C.-C., Tanner, J. A., & Heddle, J. G. (2018). DNA Aptamers for the Functionalisation of DNA Origami Nanostructures. Genes, 9(12), 571. https://doi.org/10.3390/genes9120571