REV1 Loss Triggers a G2/M Cell-Cycle Arrest Through Dysregulation of Mitotic Regulators
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Western Blotting
2.3. BrdU Staining for Flow Cytometry
2.4. FACS Analysis of Histone H3S28
2.5. Chemical Inhibitors and Drugs
2.6. Real-Time RT-PCR
2.7. Statistics
3. Results
3.1. REV1 Knockout Cells Exhibit G2/M Cell Cycle Arrest Without Impacting S Phase
3.2. REV1 Is Required for Cells to Progress Through the G2/M Phase of the Cell Cycle
3.3. REV1 Knockout Cells Suppress Phosphorylation of Histone H3S28 and the Expression of Histone H3
3.4. REV1 Regulates Tubulin Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huber, K.; Mestres-Arenas, A.; Fajas, L.; Leal-Esteban, L.C. The multifaceted role of cell cycle regulators in the coordination of growth and metabolism. FEBS J. 2021, 288, 3813–3833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chatterjee, N.; Walker, G.C. Mechanisms of DNA damage, repair, and mutagenesis. Environ. Mol. Mutagen. 2017, 58, 235–263. [Google Scholar] [CrossRef] [Scilit]
- Matthews, H.K.; Bertoli, C.; de Bruin, R.A.M. Cell cycle control in cancer. Nat. Rev. Mol. Cell Biol. 2022, 23, 74–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alberts, B.; Johnson, A.; Lewis, J.; Raff, M.; Roberts, K.; Walter, P. Components of the Cell-Cycle Control System; Garland Science: New York, NY, USA, 2002. [Google Scholar]
- Errol, C.; Friedberg, G.C.W.; Siede, W.; Wood, R.D.; Schultz, R.A.; Ellenberger, T. DNA Repair and Mutagenesis, 2nd ed.; ASM Press: Washington, DC, USA, 2006. [Google Scholar]
- Weinberg, R.A. The molecular basis of carcinogenesis: Understanding the cell cycle clock. Cytokines Mol. Ther. 1996, 2, 105–110. [Google Scholar]
- Weinberg, R.A. The Biology of Cancer; W.W. Norton & Company: New York, NY, USA, 2023. [Google Scholar]
- Nasheuer, H.P.; Smith, R.; Bauerschmidt, C.; Grosse, F.; Weisshart, K. Initiation of eukaryotic DNA replication: Regulation and mechanisms. Prog. Nucleic Acid. Res. Mol. Biol. 2002, 72, 41–94. [Google Scholar]
- Blagosklonny, M.V.; Pardee, A.B. The restriction point of the cell cycle. Cell Cycle 2002, 1, 103–110. [Google Scholar] [CrossRef] [Scilit]
- Krude, T.; Jackman, M.; Pines, J.; Laskey, R.A. Cyclin/Cdk-dependent initiation of DNA replication in a human cell-free system. Cell 1997, 88, 109–119. [Google Scholar] [CrossRef] [Scilit]
- Jackman, M.R.; Pines, J.N. Cyclins and the G2/M transition. Cancer Surv. 1997, 29, 47–73. [Google Scholar]
- John, P.C.; Mews, M.; Moore, R. Cyclin/Cdk complexes: Their involvement in cell cycle progression and mitotic division. Protoplasma 2001, 216, 119–142. [Google Scholar] [CrossRef] [Scilit]
- Vazquez-Novelle, M.D.; Sansregret, L.; Dick, A.E.; Smith, C.A.; McAinsh, A.D.; Gerlich, D.W.; Petronczki, M. Cdk1 inactivation terminates mitotic checkpoint surveillance and stabilizes kinetochore attachments in anaphase. Curr. Biol. 2014, 24, 638–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Kanakousaki, K.; Buttitta, L. How the cell cycle impacts chromatin architecture and influences cell fate. Front. Genet. 2015, 6, 19. [Google Scholar] [CrossRef] [Scilit]
- Gillette, T.G.; Hill, J.A. Readers, writers, and erasers: Chromatin as the whiteboard of heart disease. Circ. Res. 2015, 116, 1245–1253. [Google Scholar] [CrossRef] [Scilit]
- Zhivotovsky, B.; Orrenius, S. Cell cycle and cell death in disease: Past, present and future. J. Intern. Med. 2010, 268, 395–409. [Google Scholar] [CrossRef] [Scilit]
- Dianov, G.L.; Hubscher, U. Mammalian base excision repair: The forgotten archangel. Nucleic Acids Res. 2013, 41, 3483–3490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gohil, D.; Sarker, A.H.; Roy, R. Base Excision Repair: Mechanisms and Impact in Biology, Disease, and Medicine. Int. J. Mol. Sci. 2023, 24, 14186. [Google Scholar] [CrossRef] [Scilit]
- Pramanik, S.; Chen, Y.; Bhakat, K.K. Base Excision Repair in Mitotic Cells and the Role of Apurinic/Apyrimidinic Endonuclease 1 (APE1) in Post-Mitotic Transcriptional Reactivation of Genes. Int. J. Mol. Sci. 2024, 25, 12735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mjelle, R.; Hegre, S.A.; Aas, P.A.; Slupphaug, G.; Drablos, F.; Saetrom, P.; Krokan, H.E. Cell cycle regulation of human DNA repair and chromatin remodeling genes. DNA Repair. 2015, 30, 53–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marra, G.; Chang, C.L.; Laghi, L.A.; Chauhan, D.P.; Young, D.; Boland, C.R. Expression of human MutS homolog 2 (hMSH2) protein in resting and proliferating cells. Oncogene 1996, 13, 2189–2196. [Google Scholar]
- Klingler, H.; Hemmerle, C.; Bannwart, F.; Haider, R.; Cattaruzza, M.S.; Marra, G. Expression of the hMSH6 mismatch-repair protein in colon cancer and HeLa cells. Swiss Med. Wkly. 2002, 132, 57–63. [Google Scholar] [CrossRef] [Scilit]
- Ciccia, A.; Elledge, S.J. The DNA damage response: Making it safe to play with knives. Mol. Cell 2010, 40, 179–204. [Google Scholar] [CrossRef] [Scilit]
- Mao, Z.; Bozzella, M.; Seluanov, A.; Gorbunova, V. DNA repair by nonhomologous end joining and homologous recombination during cell cycle in human cells. Cell Cycle 2008, 7, 2902–2906. [Google Scholar] [CrossRef] [Scilit]
- Fugger, K.; West, S.C. Keeping homologous recombination in check. Cell Res. 2016, 26, 397–398. [Google Scholar] [CrossRef] [Scilit]
- Li, L.Y.; Guan, Y.D.; Chen, X.S.; Yang, J.M.; Cheng, Y. DNA Repair Pathways in Cancer Therapy and Resistance. Front. Pharmacol. 2020, 11, 629266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, L.S.; Minesinger, B.K.; Wiltrout, M.E.; D’Souza, S.; Woodruff, R.V.; Walker, G.C. Eukaryotic translesion polymerases and their roles and regulation in DNA damage tolerance. Microbiol. Mol. Biol. Rev. 2009, 73, 134–154. [Google Scholar] [CrossRef] [Scilit]
- Xie, K.; Doles, J.; Hemann, M.T.; Walker, G.C. Error-prone translesion synthesis mediates acquired chemoresistance. Proc. Natl. Acad. Sci. USA 2010, 107, 20792–20797. [Google Scholar] [CrossRef] [Scilit]
- Yamanaka, K.; Chatterjee, N.; Hemann, M.T.; Walker, G.C. Inhibition of mutagenic translesion synthesis: A possible strategy for improving chemotherapy? PLoS Genet. 2017, 13, e1006842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghezraoui, H.; Oliveira, C.; Becker, J.R.; Bilham, K.; Moralli, D.; Anzilotti, C.; Fischer, R.; Deobagkar-Lele, M.; Sanchiz-Calvo, M.; Fueyo-Marcos, E.; et al. 53BP1 cooperation with the REV7-shieldin complex underpins DNA structure-specific NHEJ. Nature 2018, 560, 122–127. [Google Scholar] [CrossRef] [Scilit]
- Sobkowiak, K.; Kohzaki, M.; Bohm, R.; Mailler, J.; Huber, F.; Emamzadah, S.; Tropia, L.; Hiller, S.; Halazonetis, T.D. REV7 functions with REV3 as a checkpoint protein delaying mitotic entry until DNA replication is completed. Cell Rep. 2025, 44, 115431. [Google Scholar] [CrossRef] [Scilit]
- Clairmont, C.S.; D’Andrea, A.D. REV7 directs DNA repair pathway choice. Trends Cell Biol. 2021, 31, 965–978. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, C.; Fischhaber, P.L.; Luk-Paszyc, M.J.; Masuda, Y.; Zhou, J.; Kamiya, K.; Kisker, C.; Friedberg, E.C. Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis. EMBO J. 2003, 22, 6621–6630. [Google Scholar] [CrossRef] [Scilit]
- Rizzo, A.A.; Korzhnev, D.M. The Rev1-Polzeta translesion synthesis mutasome: Structure, interactions and inhibition. Enzymes 2019, 45, 139–181. [Google Scholar]
- Nelson, J.R.; Gibbs, P.E.; Nowicka, A.M.; Hinkle, D.C.; Lawrence, C.W. Evidence for a second function for Saccharomyces cerevisiae Rev1p. Mol. Microbiol. 2000, 37, 549–554. [Google Scholar] [CrossRef] [Scilit]
- Siegel, A.; Almstead, D.; Kothandaraman, N.; Reich, J.; Lamkin, E.; Victor, J.A.; Grover, A.; Ikeh, K.; Koval, H.; Crompton, A.; et al. REV1 inhibition enhances trinucleotide repeat mutagenesis. bioRxiv 2025. [Google Scholar] [CrossRef] [Scilit]
- Tsaalbi-Shtylik, A.; Moser, J.; Mullenders, L.H.; Jansen, J.G.; de Wind, N. Persistently stalled replication forks inhibit nucleotide excision repair in trans by sequestering Replication protein A. Nucleic Acids Res. 2014, 42, 4406–4413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Liu, Z.; Wang, F.; Temviriyanukul, P.; Ma, X.; Tu, Y.; Lv, L.; Lin, Y.-F.; Huang, M.; Zhang, T.; et al. FANCD2 and REV1 cooperate in the protection of nascent DNA strands in response to replication stress. Nucleic Acids Res. 2015, 43, 8325–8339. [Google Scholar] [CrossRef] [Scilit]
- Lowran, K.; Campbell, L.; Popp, P.; Wu, C.G. Assembly of a G-Quadruplex Repair Complex by the FANCJ DNA Helicase and the REV1 Polymerase. Genes 2019, 11, 5. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, N.; Whitman, M.A.; Harris, C.A.; Min, S.M.; Jonas, O.; Lien, E.C.; Luengo, A.; Heiden, M.G.V.; Hong, J.; Zhou, P.; et al. REV1 inhibitor JH-RE-06 enhances tumor cell response to chemotherapy by triggering senescence hallmarks. Proc. Natl. Acad. Sci. USA 2020, 117, 28918–28921. [Google Scholar] [CrossRef] [Scilit]
- Ikeh, K.E.; Lamkin, E.N.; Crompton, A.; Deutsch, J.; Fisher, K.J.; Gray, M.; Argyle, D.J.; Lim, W.Y.; Korzhnev, D.M.; Hadden, M.K.; et al. REV1 Inhibition Enhances Radioresistance and Autophagy. Cancers 2021, 13, 5290. [Google Scholar] [CrossRef] [Scilit]
- Victor, J.; Jordan, T.; Lamkin, E.; Ikeh, K.; March, A.; Frere, J.; Crompton, A.; Allen, L.; Fanning, J.; Lim, W.Y.; et al. SARS-CoV-2 hijacks host cell genome instability pathways. Res. Sq. 2022. [Google Scholar] [CrossRef] [Scilit]
- Zeltzer, S.; Longmire, P.; Svoboda, M.; Bosco, G.; Goodrum, F. Host translesion polymerases are required for viral genome integrity. Proc. Natl. Acad. Sci. USA 2022, 119, e2203203119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, L.S.; Walker, G.C. The critical mutagenic translesion DNA polymerase Rev1 is highly expressed during G(2)/M phase rather than S phase. Proc. Natl. Acad. Sci. USA 2006, 103, 8971–8976. [Google Scholar] [CrossRef] [Scilit]
- Jansen, J.G.; Langerak, P.; Tsaalbi-Shtylik, A.; van den Berk, P.; Jacobs, H.; de Wind, N. Strand-biased defect in C/G transversions in hypermutating immunoglobulin genes in Rev1-deficient mice. J. Exp. Med. 2006, 203, 319–323. [Google Scholar] [CrossRef] [Scilit]
- Jang, S.M.; Nathans, J.F.; Fu, H.; Redon, C.E.; Jenkins, L.M.; Thakur, B.L.; Pongor, L.S.; Baris, A.M.; Gross, J.M.; Oʹneill, M.J.; et al. The RepID-CRL4 ubiquitin ligase complex regulates metaphase to anaphase transition via BUB3 degradation. Nat. Commun. 2020, 11, 24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mukhtar, E.; Adhami, V.M.; Mukhtar, H. Targeting microtubules by natural agents for cancer therapy. Mol. Cancer Ther. 2014, 13, 275–284. [Google Scholar] [CrossRef] [Scilit]
- Wojtaszek, J.L.; Chatterjee, N.; Najeeb, J.; Ramos, A.; Lee, M.; Bian, K.; Xue, J.Y.; Fenton, B.A.; Park, H.; Li, D.; et al. A Small Molecule Targeting Mutagenic Translesion Synthesis Improves Chemotherapy. Cell 2019, 178, 152–159e11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- Zhou, B.B.; Elledge, S.J. The DNA damage response: Putting checkpoints in perspective. Nature 2000, 408, 433–439. [Google Scholar] [CrossRef] [Scilit]
- Bunz, F.; Dutriaux, A.; Lengauer, C.; Waldman, T.; Zhou, S.; Brown, J.P.; Sedivy, J.M.; Kinzler, K.W.; Vogelstein, B. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 1998, 282, 1497–1501. [Google Scholar] [CrossRef] [Scilit]
- Flatt, P.M.; Tang, L.J.; Scatena, C.D.; Szak, S.T.; Pietenpol, J.A. p53 regulation of G2 checkpoint is retinoblastoma protein dependent. Mol. Cell Biol. 2000, 20, 4210–4223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agarwal, M.L.; Agarwal, A.; Taylor, W.R.; Stark, G.R. p53 controls both the G2/M and the G1 cell cycle checkpoints and mediates reversible growth arrest in human fibroblasts. Proc. Natl. Acad. Sci. USA 1995, 92, 8493–8497. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, M.L.; Agarwal, A.; Taylor, W.R.; Chernova, O.; Sharma, Y.; Stark, G.R. A p53-dependent S-phase checkpoint helps to protect cells from DNA damage in response to starvation for pyrimidine nucleotides. Proc. Natl. Acad. Sci. USA 1998, 95, 14775–14780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wyllie, F.S.; Haughton, M.F.; Bond, J.A.; Rowson, J.M.; Jones, C.J.; Wynford-Thomas, D. S phase cell-cycle arrest following DNA damage is independent of the p53/p21(WAF1) signalling pathway. Oncogene 1996, 12, 1077–1082. [Google Scholar]
- Gartner, A.; Milstein, S.; Ahmed, S.; Hodgkin, J.; Hengartner, M.O. A conserved checkpoint pathway mediates DNA damage-induced apoptosis and cell cycle arrest in C. elegans. Mol. Cell 2000, 5, 435–443. [Google Scholar] [CrossRef] [Scilit]
- Clarke, D.J.; Gimenez-Abian, J.F. Checkpoints controlling mitosis. Bioessays 2000, 22, 351–363. [Google Scholar] [CrossRef] [Scilit]
- Blagosklonny, M.V.; Fojo, T. Molecular effects of paclitaxel: Myths and reality (a critical review). Int. J. Cancer 1999, 83, 151–156. [Google Scholar] [CrossRef] [Scilit]
- Senderowicz, A.M.; Sausville, E.A. Preclinical and clinical development of cyclin-dependent kinase modulators. J. Natl. Cancer Inst. 2000, 92, 376–387. [Google Scholar] [CrossRef] [Scilit]
- Tirman, S.; Quinet, A.; Wood, M.; Meroni, A.; Cybulla, E.; Jackson, J.; Pegoraro, S.; Simoneau, A.; Zou, L.; Vindigni, A. Temporally distinct post-replicative repair mechanisms fill PRIMPOL-dependent ssDNA gaps in human cells. Mol. Cell 2021, 81, 4026–4040e8. [Google Scholar] [CrossRef] [Scilit]
- Taglialatela, A.; Leuzzi, G.; Sannino, V.; Cuella-Martin, R.; Huang, J.W.; Wu-Baer, F.; Baer, R.; Costanzo, V.; Ciccia, A. REV1-Polzeta maintains the viability of homologous recombination-deficient cancer cells through mutagenic repair of PRIMPOL-dependent ssDNA gaps. Mol. Cell. 2021, 81, 4008–4025e7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maslowska, K.H.; Wong, R.P.; Ulrich, H.D.; Pages, V. Post-replicative lesion processing limits DNA damage-induced mutagenesis. Nucleic Acids Res. 2025, 53, gkaf198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, S.; Hicks, J.K.; Chute, C.L.; Brennan, J.R.; Ahn, J.Y.; Glover, T.W.; Canman, C.E. REV1 and polymerase zeta facilitate homologous recombination repair. Nucleic Acids Res. 2012, 40, 682–691. [Google Scholar] [CrossRef] [Scilit]
- Orren, D.K.; Petersen, L.N.; Bohr, V.A. Persistent DNA damage inhibits S-phase and G2 progression, and results in apoptosis. Mol. Biol. Cell 1997, 8, 1129–1142. [Google Scholar] [CrossRef] [Scilit]
- Cheng, J.; Yang, X.; Zhao, W.; Xu, J.; Hao, Y.; Xu, F. REV1-targeting inhibitor JH-RE-06 induces ferroptosis via NCOA4-mediated ferritinophagy in colorectal cancer cells. Oncol Rep. 2025, 54, 159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vermeulen, K.; Van Bockstaele, D.R.; Berneman, Z.N. The cell cycle: A review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif. 2003, 36, 131–149. [Google Scholar] [CrossRef] [Scilit]
- Hara, M.; Abe, Y.; Tanaka, T.; Yamamoto, T.; Okumura, E.; Kishimoto, T. Greatwall kinase and cyclin B-Cdk1 are both critical constituents of M-phase-promoting factor. Nat. Commun. 2012, 3, 1059. [Google Scholar] [CrossRef] [Scilit]
- Pines, J.; Hunter, T. Isolation of a human cyclin cDNA: Evidence for cyclin mRNA and protein regulation in the cell cycle and for interaction with p34cdc2. Cell 1989, 58, 833–846. [Google Scholar] [CrossRef] [Scilit]
- Lemonnier, T.; Dupre, A.; Jessus, C. The G2-to-M transition from a phosphatase perspective: A new vision of the meiotic division. Cell Div. 2020, 15, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, Z.; Malureanu, L.; Huang, J.; Wang, W.; Li, H.; van Deursen, J.M.; Tindall, D.J.; Chen, J. Plk1-dependent phosphorylation of FoxM1 regulates a transcriptional programme required for mitotic progression. Nat. Cell Biol. 2008, 10, 1076–1082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jurvansuu, J.; Fragkos, M.; Ingemarsdotter, C.; Beard, P. Chk1 instability is coupled to mitotic cell death of p53-deficient cells in response to virus-induced DNA damage signaling. J. Mol. Biol. 2007, 372, 397–406. [Google Scholar] [CrossRef] [Scilit]
- Schaefer, T.J.; Panda, P.K.; Wolford, R.W. Dengue Fever. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2024. [Google Scholar]
- Deibler, R.W.; Kirschner, M.W. Quantitative reconstitution of mitotic CDK1 activation in somatic cell extracts. Mol. Cell 2010, 37, 753–767. [Google Scholar] [CrossRef] [Scilit]
- Athar, M.; Kim, A.L.; Ahmad, N.; Mukhtar, H.; Gautier, J.; Bickers, D.R. Mechanism of ultraviolet B-induced cell cycle arrest in G2/M phase in immortalized skin keratinocytes with defective p53. Biochem. Biophys. Res. Commun. 2000, 277, 107–111. [Google Scholar] [CrossRef] [Scilit]
- Sawicka, A.; Hartl, D.; Goiser, M.; Pusch, O.; Stocsits, R.R.; Tamir, I.M.; Mechtler, K.; Seiser, C. H3S28 phosphorylation is a hallmark of the transcriptional response to cellular stress. Genome Res. 2014, 24, 1808–1820. [Google Scholar] [CrossRef] [Scilit]
- Goto, H.; Tomono, Y.; Ajiro, K.; Kosako, H.; Fujita, M.; Sakurai, M.; Okawa, K.; Iwamatsu, A.; Okigaki, T.; Takahashi, T.; et al. Identification of a novel phosphorylation site on histone H3 coupled with mitotic chromosome condensation. J. Biol. Chem. 1999, 274, 25543–25549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goto, H.; Yasui, Y.; Nigg, E.A.; Inagaki, M. Aurora-B phosphorylates Histone H3 at serine28 with regard to the mitotic chromosome condensation. Genes Cells 2002, 7, 11–17. [Google Scholar] [CrossRef] [Scilit]
- Rossetto, D.; Avvakumov, N.; Cote, J. Histone phosphorylation: A chromatin modification involved in diverse nuclear events. Epigenetics 2012, 7, 1098–1108. [Google Scholar] [CrossRef] [Scilit]
- Lai, P.M.; Gong, X.; Chan, K.M. Roles of Histone H2B, H3 and H4 Variants in Cancer Development and Prognosis. Int. J. Mol. Sci. 2024, 25, 9699. [Google Scholar] [CrossRef] [Scilit]
- Binarova, P.; Tuszynski, J. Tubulin: Structure, Functions and Roles in Disease. Cells 2019, 8, 1294. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Chen, J.; Xiao, M.; Li, W.; Miller, D.D. An overview of tubulin inhibitors that interact with the colchicine binding site. Pharm. Res. 2012, 29, 2943–2971. [Google Scholar] [CrossRef] [Scilit]
- Hastie, S.B. Interactions of colchicine with tubulin. Pharmacol. Ther. 1991, 51, 377–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jordan, M.A.; Wilson, L. Microtubules and actin filaments: Dynamic targets for cancer chemotherapy. Curr. Opin. Cell Biol. 1998, 10, 123–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Badugu, S.; Dhyani, K.M.; Thakur, M.; Muniyappa, K. Saccharomyces cerevisiae Rev7 promotes non-homologous end-joining by blocking Mre11 nuclease and Rad50’s ATPase activities and homologous recombination. eLife 2024, 13, RP96933. [Google Scholar] [CrossRef] [Scilit]
- Bhat, A.; Wu, Z.; Maher, V.M.; McCormick, J.J.; Xiao, W. Rev7/Mad2B plays a critical role in the assembly of a functional mitotic spindle. Cell Cycle 2015, 14, 3929–3938. [Google Scholar] [CrossRef] [Scilit]
- Knobel, P.A.; Kotov, I.N.; Felley-Bosco, E.; Stahel, R.A.; Marti, T.M. Inhibition of REV3 expression induces persistent DNA damage and growth arrest in cancer cells. Neoplasia 2011, 13, 961–970. [Google Scholar] [CrossRef] [Scilit]
- Listovsky, T.; Sale, J.E. Sequestration of CDH1 by MAD2L2 prevents premature APC/C activation prior to anaphase onset. J. Cell Biol. 2013, 203, 87–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bian, K.; Gruber, C.C.; Byers, E.; Leclerc, P.; Hemann, M.T.; Walker, G.C. Sensitization of cancer cells to DNA-damaging agents by expression of the REV1 C-terminal domain: Implications for chemotherapy. Proc. Natl. Acad. Sci. USA 2025, 122, e2511136122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Samuel, T.; Weber, H.O.; Rauch, P.; Verdoodt, B.; Eppel, J.T.; McShea, A.; Hermeking, H.; Funk, J.O. The G2/M regulator 14-3-3sigma prevents apoptosis through sequestration of Bax. J. Biol. Chem. 2001, 276, 45201–45206. [Google Scholar] [CrossRef] [Scilit]
- Shim, H.S.; Wei, M.; Brandhorst, S.; Longo, V.D. Starvation promotes REV1 SUMOylation and p53-dependent sensitization of melanoma and breast cancer cells. Cancer Res. 2015, 75, 1056–1067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghelli Luserna di Rora, A.; Cerchione, C.; Martinelli, G.; Simonetti, G. A WEE1 family business: Regulation of mitosis, cancer progression, and therapeutic target. J. Hematol. Oncol. 2020, 13, 126. [Google Scholar] [CrossRef] [Scilit]
- Bayer, L.V.; Milano, S.N.; Kaur, H.; Kumar, Z.; Bratu, D.P. Post-transcriptional regulation of cyclin A and B mRNAs by Bruno 1, Cup, and P-bodies. iScience 2025, 28, 112727. [Google Scholar] [CrossRef] [Scilit]
- Ding, L.; Yang, L.; He, Y.; Zhu, B.; Ren, F.; Fan, X.; Wang, Y.; Li, M.; Li, J.; Kuang, Y.; et al. CREPT/RPRD1B associates with Aurora B to regulate Cyclin B1 expression for accelerating the G2/M transition in gastric cancer. Cell Death Dis. 2018, 9, 1172. [Google Scholar] [CrossRef] [Scilit]
- Hwang, A.; McKenna, W.G.; Muschel, R.J. Cell cycle-dependent usage of transcriptional start sites. A novel mechanism for regulation of cyclin B1. J. Biol. Chem. 1998, 273, 31505–31509. [Google Scholar] [CrossRef] [Scilit]
- Armstrong, C.; Spencer, S.L. Replication-dependent histone biosynthesis is coupled to cell-cycle commitment. Proc. Natl. Acad. Sci. USA 2021, 118, e2100178118. [Google Scholar] [CrossRef] [Scilit]
- Ferrand, J.; Rondinelli, B.; Polo, S.E. Histone Variants: Guardians of Genome Integrity. Cells 2020, 9, 2424. [Google Scholar] [CrossRef] [Scilit]
- Andonegui-Elguera, M.A.; Caceres-Gutierrez, R.E.; Lopez-Saavedra, A.; Cisneros-Soberanis, F.; Justo-Garrido, M.; Diaz-Chavez, J.; Herrera, L.A. The Roles of Histone Post-Translational Modifications in the Formation and Function of a Mitotic Chromosome. Int. J. Mol. Sci. 2022, 23, 8704. [Google Scholar] [CrossRef] [Scilit]
- Delaney, K.; Weiss, N.; Almouzni, G. The cell-cycle choreography of H3 variants shapes the genome. Mol. Cell 2023, 83, 3773–3786. [Google Scholar] [CrossRef] [Scilit]
- Jang, C.W.; Shibata, Y.; Starmer, J.; Yee, D.; Magnuson, T. Histone H3.3 maintains genome integrity during mammalian development. Genes Dev. 2015, 29, 1377–1392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bush, K.M.; Yuen, B.T.; Barrilleaux, B.L.; Riggs, J.W.; O’Geen, H.; Cotterman, R.F.; Knoepfler, P.S. Endogenous mammalian histone H3.3 exhibits chromatin-related functions during development. Epigenet. Chromatin. 2013, 6, 7. [Google Scholar] [CrossRef] [Scilit]
- Miura, M.; Ninomiya-Tsuji, J.; Tsuji, Y.; Ishibashi, S.; Ide, T. Colchicine activates cell cycle-dependent genes in growth-arrested rat 3Y1 cells. Exp. Cell Res. 1987, 173, 294–298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gasic, I.; Boswell, S.A.; Mitchison, T.J. Tubulin mRNA stability is sensitive to change in microtubule dynamics caused by multiple physiological and toxic cues. PLoS Biol. 2019, 17, e3000225. [Google Scholar] [CrossRef] [Scilit]
- Gasic, I. Regulation of Tubulin Gene Expression: From Isotype Identity to Functional Specialization. Front. Cell Dev. Biol. 2022, 10, 898076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakai, R.; Inagaki, Y.; Tsurumi, H.; Ohashi, A.; Takayama, T.; Sato, S.; Fujiwara, K. TFAP2E acts as a tumor suppressor by regulating cell cycle progression in oral squamous cell carcinoma cells. Cancer Genet. 2025, 296–297, 111–116. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Li, X.; Lian, X.; Huang, B.; Jia, J.; Zhu, C. Genetic silencing of CDC6 via AAV2-Delivered shRNA as a novel cancer genetics-based therapy for cervical carcinoma. Cancer Genet. 2025, 296–297, 208–216. [Google Scholar] [CrossRef] [Scilit]
- Hiraoka, D.; Hosoda, E.; Chiba, K.; Kishimoto, T. SGK phosphorylates Cdc25 and Myt1 to trigger cyclin B-Cdk1 activation at the meiotic G2/M transition. J. Cell Biol. 2019, 218, 3597–3611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strauss, B.; Harrison, A.; Coelho, P.A.; Yata, K.; Zernicka-Goetz, M.; Pines, J. Cyclin B1 is essential for mitosis in mouse embryos, and its nuclear export sets the time for mitosis. J. Cell Biol. 2018, 217, 179–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crncec, A.; Hochegger, H. Triggering mitosis. FEBS Lett. 2019, 593, 2868–2888. [Google Scholar] [CrossRef] [Scilit]
- Chang, D.C.; Xu, N.; Luo, K.Q. Degradation of cyclin B is required for the onset of anaphase in Mammalian cells. J. Biol. Chem. 2003, 278, 37865–37873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Comaills, V.; Castellano-Pozo, M. Chromosomal Instability in Genome Evolution: From Cancer to Macroevolution. Biology 2023, 12, 671. [Google Scholar] [CrossRef] [Scilit]
- Dewhurst, S.M.; McGranahan, N.; Burrell, R.A.; Rowan, A.J.; Gronroos, E.; Endesfelder, D.; Joshi, T.; Mouradov, D.; Gibbs, P.; Ward, R.L.; et al. Tolerance of whole-genome doubling propagates chromosomal instability and accelerates cancer genome evolution. Cancer Discov. 2014, 4, 175–185. [Google Scholar] [CrossRef] [Scilit]
- Ashouri, A.; Zhang, C.; Gaiti, F. Decoding Cancer Evolution: Integrating Genetic and Non-Genetic Insights. Genes 2023, 14, 1856. [Google Scholar] [CrossRef] [Scilit]





| Gene | Forward Sequence | Reverse Sequence |
|---|---|---|
| GAPDH | CTGTTGCTGTAGCCAAATTCGT | ACCCACTCCTCCACCTTTGAC |
| Gapdh | CATCACTGCCACCCAGAAGACTG | ATGCCAGTGAGCTTCCCGTTCAG |
| CcnB1 | AGAGGTGGAACTTGCTGAGCCT | GCACATCCAGATGTTTCCATCGG |
| H3.3 | ACAAAAGCCGCTCGCAAGAGTG | TTCTCGCACCAGACGCTGAAAG |
| Pkmyt1 | GGTCTCACCATCTTGGAAGTGG | CAGCATCATGGCGAGGACAGAA |
| Plk1 | CCATCTTCTGGGTCAGCAAGTG | CCGTCATTGTAGAGAATCAGGCG |
| TUBB6 | TGGACTTAGAGCCAGGCACCAT | TTTCGCCCAGTTGTTCCCTGCA |
| TUBB4A | CAGTGACGAACATGGCATCGAC | AGCACCGCTCTGGGGACATAAT |
| TUBB4B | TTGGGAGGTGATCAGCGATGAG | CTCCAGATCCACGAGCACGGC |
| TUBB2B | GCACGATGGATTCGGTTAGGTC | TCGGCTCCCTCTGTGTAGTGG |
| Tubb6 | CGAGGCACAATGGACTCAGTCA | TGCCCAGTTATTTCCTGCACCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Buntin, B.; Guyette, M.; Gupta, V.; Ikeh, K.; Bhattacharya, S.; Lamkin, E.N.; Lafuze, A.; del Rio-Guerra, R.; Hong, J.; Zhou, P.; et al. REV1 Loss Triggers a G2/M Cell-Cycle Arrest Through Dysregulation of Mitotic Regulators. Genes 2026, 17, 44. https://doi.org/10.3390/genes17010044
Buntin B, Guyette M, Gupta V, Ikeh K, Bhattacharya S, Lamkin EN, Lafuze A, del Rio-Guerra R, Hong J, Zhou P, et al. REV1 Loss Triggers a G2/M Cell-Cycle Arrest Through Dysregulation of Mitotic Regulators. Genes. 2026; 17(1):44. https://doi.org/10.3390/genes17010044
Chicago/Turabian StyleBuntin, Brailey, Madison Guyette, Vihit Gupta, Kanayo Ikeh, Sombodhi Bhattacharya, Erica N. Lamkin, Allison Lafuze, Roxana del Rio-Guerra, Jiyong Hong, Pei Zhou, and et al. 2026. "REV1 Loss Triggers a G2/M Cell-Cycle Arrest Through Dysregulation of Mitotic Regulators" Genes 17, no. 1: 44. https://doi.org/10.3390/genes17010044
APA StyleBuntin, B., Guyette, M., Gupta, V., Ikeh, K., Bhattacharya, S., Lamkin, E. N., Lafuze, A., del Rio-Guerra, R., Hong, J., Zhou, P., & Chatterjee, N. (2026). REV1 Loss Triggers a G2/M Cell-Cycle Arrest Through Dysregulation of Mitotic Regulators. Genes, 17(1), 44. https://doi.org/10.3390/genes17010044

