Next Article in Journal
Unveiling Racial Disparities in Localized Prostate Cancer: A Systems-Level Exploration of the lncRNA Landscape
Previous Article in Journal
Expanding the Clinical Spectrum Associated with the Recurrent Arg203Trp Variant in PACS1: An Italian Cohort Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Identification of Ziziphus jujuba cv. Dongzao DNA Demethylase ZjROS1 Gene Family and Construction of CRISPR/Cas9-Mediated Gene-Editing Vector

1
School of Biological Science and Engineering, North Minzu University, Yinchuan 750021, China
2
Innovation Team for Genetic Improvement of Economic Forest, North Minzu University, Yinchuan 750021, China
*
Author to whom correspondence should be addressed.
Genes 2025, 16(2), 228; https://doi.org/10.3390/genes16020228
Submission received: 7 January 2025 / Revised: 9 February 2025 / Accepted: 15 February 2025 / Published: 17 February 2025
(This article belongs to the Section Plant Genetics and Genomics)

Abstract

:
DNA methylation is one of the earliest and most extensively studied epigenetic regulatory mechanisms. The ROS1 (Repressor of Silencing 1) gene was first discovered in Arabidopsis thaliana, and it is a DNA demethylase that can remove 5-methylcytosine from DNA, thereby affecting DNA methylation levels and gene expression. Objectives: The objective of this study was to investigate the role of ROS1 in the development and maturation of Ziziphus jujuba cv. “Dongzao” fruit. Methods: We cloned the ROS1 gene and conducted bioinformatics and expression characteristics analyses on it. Results: Three ROS1 genes, named ZjROS1-1~3, was identified, and each member protein was localized in the nucleus, cytoskeleton, chloroplast, and vacuole. The promoter contained cis-elements such as light response, plant hormone signal transduction, and stress response cis-elements, and it interacted with many proteins such as CMT, MET, and ZDP. The results of the real-time fluorescence quantitative PCR show that ZjROS1 has specific expression patterns in different tissues of Z. jujuba cv. Dongzao, and the expression of ZjROS1-2 in flowers and fruits is high. At the same time, CRISPR/Cas9 technology was used to construct a gene-editing vector for ZjROS1, which provided a basis for the subsequent genetic transformation. Conclusions: In this study, the biological function of ZjROS1 was clarified and a gene-editing vector was constructed, which provided a theoretical basis for the regulation mechanism of demethylase ZjROS1 in the fruit ripening and development of Z. jujuba cv. Dongzao.

1. Introduction

Z. jujuba cv. Dongzao is a cultivar of Ziziphus (Ziziphus jujuba Mill.) in the Rhamnaceae family and a unique cultivar of late fresh jujuba mill in China [1,2,3]. The flowering period of Z. jujuba cv. Dongzao is around June, and the fruit ripening period is usually from late October to early November [2,3,4]. It takes about three and a half months for Z. jujuba cv. Dongzao to transition from flowering to fruiting. According to the changes in peel color, this can be divided into three stages: white ripening stage, half-red stage, and full-red stage. When jujube enters the white ripening stage, it begins to mature, and the fruit surface is green, with a low sugar content and high hardness. In the half-red stage, the surface of the jujube fruit begins to color, the flesh is crisp, and the sugar content increases sharply. In the full-red stage, the surface of the jujube fruit is red, the water content of the fruit decreases, and the hardness of the flesh decreases [5].
Z. jujuba cv. Dongzao is a type of fresh fruit with important economic value; it is famous for its unique flavor and remarkable nutritional value. In addition to containing various amino acids, vitamins, and minerals, it also contains many functional bioactive ingredients, known as “jujube best”, and this is favored by consumers [6,7,8,9,10]. The formation of the flavor quality of Z. jujuba cv. Dongzao fruit is mainly affected by external environmental factors, such as water, light, and temperature. In addition to external environmental factors, fruit quality is also related to the expression of its own regulated genes. Gene expression is subject to genetic and epigenetic regulation. A large number of studies have examined the maturation flavor quality of Z. jujuba cv. Dongzao fruit from the aspects of gene regulation, transcriptomics, and metabolomics, such as phosphoenolpyruvate, galactose synthesis pathway genes, and phenolic-synthesis-related regulatory enzymes [11,12,13,14]. Although the mechanisms of DNA methylation and demethylation in A. thaliana and some fruits have been elucidated [15,16,17], the regulatory mechanisms of DNA methylation during the development of Z. jujuba cv. Dongzao fruit are still poorly understood.
DNA methylation is a common epigenetic pathway in plants and one of the earliest and most extensively studied topics in epigenetics. In plants, the DNA glycosylase DEMETER family members DME, DML2, and DML3 and silencing suppressor 1 (ROS1) perform active DNA demethylation. The ROS1 gene, first identified in A. thaliana, is a DNA demethylase capable of removing 5-methylcytosine from DNA, thereby affecting DNA methylation levels and gene expression. Previous studies have shown that Ros1-mediated DNA demethylation and gene regulation control a variety of processes, including antimicrobial defense, seed dormancy, and stomatal stem cell production. Studies have shown that active DNA demethylation mediated by silencing suppressor 1 (ROS1) in plants plays an important role in regulating the DNA methylation balance in biotic and abiotic stress responses. Research has shown that DNA demethylase ROS1 can negatively regulate the RdMM pathway [18,19]. The DNA demethylation of ROS1 in the RdMM targeting region plays an important role in regulating gene expression [20]. ROS1-mediated DNA demethylation in Arabidopsis antagonizes the RddM pathway to balance DNA methylation levels and regulate gene expression [21].
In recent years, new technologies, as represented by the CRISPR/Cas9 system, have rapidly expanded the research and application fields of gene editing [22]. The CRISPR/Cas9 system is an immune mechanism widely present in bacteria and archaea [23]. To date, CRISPR/Cas9 gene-editing and related derivative technologies have been widely used in the genetic improvement of crops. At present, it is mainly used to improve crop yield, quality, and disease resistance. Studies have shown that knocking out the circular E3 ligase-encoding gene TaGW2 can increase the wheat grain length and width, thereby increasing the wheat yield [24,25]. By knocking out the Wx1 gene through the CRISPR/Cas9 system, the amylopectin content in maize can reach close to 100% [26,27], and other phenotypes do not change. The knockout mutation obtained from the CRISPR/Cas9-targeted editing of the SlMlo1 gene in tomato can produce resistance to powdery mildew [28]. Feng Zhijuan et al. took the conserved domain of the GmGBSSⅡ protein as the target region to construct a CRISPR/Cas9 gene-editing vector for the GmGBSSⅡ gene in vegetable soybean and provided experimental materials for genetic transformation to obtain GmGBSSⅡ gene-edited mutants in vegetable soybean [29]. At present, there are relatively few studies on CRISPR/Cas9-mediated gene editing in jujube. However, with the gradual improvement in the genetic transformation system of jujube and the development of related technologies, its application prospects are broad. Some progress has been made in research on the ROS1 gene using CRISPR/Cas9-mediated gene editing. Researchers carried out CRISPR/Cas9-mediated gene editing on the OsROS1 gene in rice. They designed two 20 bp guide RNAs targeting the first and fifteenth exons of the OsROS1 gene, constructed knockout vectors, and introduced them into rice varieties through Agrobacterium-mediated transformation. As a result, multiple OsROS1 knockout mutants were obtained. Most of the mutants showed sterility during the reproductive growth stage, and the seed-setting rates of the few mutants that could produce seeds were also significantly reduced. This indicates that the OsROS1 gene is crucial for the development of rice pollen and embryo sacs [30]. To explore the role of the CmROS1 gene in fruit ripening and epigenetic regulation in melon, researchers used CRISPR/Cas9 technology to generate homozygous knockout mutants of CmROS1 under the climacteric genetic background of melon. The results show that, compared with the wild type, the mutants displayed premature ethylene production and altered climacteric behavior, indicating that the CmROS1 gene plays a role in the climacteric process of melon fruits. In addition, an analysis of the single-cytosine methylome of the CmROS1 knockout mutants revealed DNA methylation changes in the promoter regions of key ripening genes (such as ACS1, ETR1, and ACO1) and ripening-related transcription factors (such as NAC-NOR, RIN, and CNR). This indicates that CmROS1-mediated DNA demethylation is of great significance for triggering the ripening of melon fruits [31].
With the rapid development of high-throughput sequencing technology and the continuous progress of genome-wide DNA methylation research methods, an increasing number of studies have been conducted on the changes in and mechanisms of DNA methylation during fruit ripening [32]. DNA methylation has been extensively studied with regard to fruit quality because it is involved in anthocyanin accumulation [33], fruit flavor formation, and fruit development and ripening [15,16,34]. In A. thaliana, previous studies have found that the ROS1 gene has a significant impact on plant growth and development. In A. thaliana, ROS1 plays a crucial regulatory role in the process of responding to abiotic stress. It promotes the expression of defense genes and stress-responsive genes by reducing the DNA methylation level. These genes are involved in physiological processes such as plant antioxidant defense, osmotic regulation, and ion balance, helping plants better cope with abiotic stress [35]. In Malus pumila, researchers used RNA-sequencing technology to detect the transcriptional levels of the MdROS1 gene related to anthocyanin content and genes related to anthocyanin biosynthesis in apples under low-temperature stress conditions. The results showed that transient silencing of MdROS1 in apple leaves and fruits could inhibit anthocyanin accumulation and lead to a decrease in the expression of anthocyanin biosynthesis genes, while the opposite was true for leaves and fruits overexpressing MdROS1. This indicates that ROS1 affects the anthocyanin biosynthesis pathway and increases anthocyanin accumulation by reducing the methylation level of the promoters of anthocyanin-related genes, thus influencing aspects such as plant color development [36]. Taking the model organism A. thaliana as the research object, Academician Zhu Jiankang’s research team revealed through whole-genome bisulfite sequencing (WGBS) and other analyses that mutations in the DNA demethylase ROS1 led to a generation-by-generation increase in the DNA methylation level at the genomic level. This study demonstrated that ROS1 plays an important monitoring function in preventing the trans-generational inheritance of randomly formed DNA methylation and maintaining the stability of the epigenome. Since the stability of the epigenome is crucial for the normal development of plants, it indirectly illustrates that the ROS1 gene has a significant impact on plant development [37].
In this experiment, the DNA methylation sites of the Z. jujuba cv. Dongzao genome were cloned and sequenced, and ROS1-related genes were successfully isolated. Although the formation mechanism in Z. jujuba cv. Dongzao fruit ripening has been studied, many questions remain. For example, how do ROS1-related genes regulate DNA methylation levels to participate in regulating the expression levels of genes involved in fruit development, thereby affecting fruit ripening? What are the expression characteristics of the ROS1 gene in Z. jujuba cv. Dongzao? Therefore, in this study, the function of ZjROS1 in the development of Z. jujuba cv. Dongzao fruit was studied by cloning and identifying the ZjROS1 gene family and conducting serial analyses. Meanwhile, a ZjROS1 gene-editing vector for Z. jujuba cv. Dongzao was constructed using CRISPR/Cas9 technology. This study lays a foundation for further studies on the function of ZjROS1 in Z. jujuba cv. Dongzao and the establishment of a ZjROS1 genetic transformation system.

2. Materials and Methods

2.1. Materials

The plant materials used in this study were obtained from 3-year-old Z. jujuba cv. Dongzao, and wild Ziziphus jujuba was used as the grafting rootstock. These plants were planted at the Institute of North Minzu University (latitude 38°29′ N, longitude 106°10′ E), with a light cycle of 12 h/d and a light intensity of 150 μmol/(m2·s). The young leaves, old leaves, young stems, old stems, flowers, and fruits of the plants at three different stages, namely, the white ripening stage, semi-red stage, and full-red stage, were collected in different seasons. After picking, they were quickly frozen in liquid nitrogen and then taken back to the laboratory for storage in a −80 °C refrigerator [38].

2.2. Research Methods

2.2.1. Bioinformatics Analysis of the ZjROS1 Gene Family

Gene Family Identification and Protein Physicochemical Property Analysis

The AtROS1 gene sequences were obtained from the A. thaliana TAIR database (https://www.arabidopsis.org/ (accessed on 27 January 2024)). The whole-genome and protein sequences of jujube were obtained from NCBI. TBtools was used to perform local BLAST and extract the sequences to obtain the genes related to demethylase ROS1 in Z. jujuba cv. Dongzao. SMART was used to identify the ROS1 protein sequence in order to ensure that all genes contained the ROS1 domain. The protein sequences were input into the Protparam webpage (https://web.expasy.org/protparam/ (accessed on 28 January 2024)) of the Expasy website (https://www.expasy.org/ (accessed on 28 January 2024)). The molecular weight, isoelectric point, amino acid composition, hydrophobicity, and other related physical and chemical properties of the ZjROS1 gene family members were analyzed, and the results were calculated and plotted.
On the ProtScale online website (https://web.expasy.org/protscale/ (accessed on 1 February 2024)), “protein sequence” was input, and then “Hydropath./Kyte & Doolittle” was selected for submission to conduct hydrophilicity and hydrophobicity analyses. By inputting the protein sequence into the NetPhos 3.1 Server website (https://services.healthtech.dtu.dk/services/NetPhos-3.1/ (accessed on 1 February 2024)) and submitting it, the analysis and prediction results of the protein phosphorylation sites were obtained.

Prediction of Signal Peptides and Transmembrane Domains, Chromosome Localization, and Subcellular Localization

The protein sequences were input into the SingalP-3.0 Server website (https://services.healthtech.dtu.dk/services/SignalP-3.0/ (accessed on 2 February 2024)), and the signal peptide prediction results of the protein sequence were obtained. The protein sequences were input into the TMHMM Server v.2.0 website (http://www.cbs.dtu.dk/services/TMHMM/ (accessed on 2 February 2024)), and the prediction results from the analysis of the proteins’ transmembrane structure field were obtained.
The gff annotation file for jujube was downloaded from NCBI. The chromosome length and location information of each gene were searched for and determined. A chromosome location map of the ZjROS1 gene family was drawn using MG2C.V2.2 (http://mg2c.iask.in/mg2c_v2.1/ (accessed on 2 February 2024)). The protein sequence was pasted on the WoLF PSORT website (https://wolfpsort.hgc.jp/ (accessed on 2 February 2024)). After choosing “plants” and submitting, the prediction results of the subcellular localization of the protein sequence were obtained.

Analysis of Conserved Motif and Conserved Domain of ZjROS1 Gene and Prediction of the Secondary and Tertiary Structures of the ZjROS1 Protein

The annotation information of the jujube genome structure was downloaded from NCBI, and MEME (http://meme-suite.org/tools/meme (accessed on 3 February 2024)) was used to predict the conserved structural elements of the ZjROS1 protein sequence. The parameters were set to default. Batch-CDD in NCBI was used to predict the conserved domain of the ZjROS1 protein sequence and was visualized using TBtools. The online website NPS@ (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_hnn.html (accessed on 3 February 2024)) was used to predict the secondary structure of the ROS1 protein sequence. The online website SWISS MODEL (https://robetta.bakerlab.org/ (accessed on 3 February 2024)) was used to predict the tertiary structure of the ROS1 protein sequences.

Promoter Cis-Acting Element Analysis and Protein Interaction Prediction Analysis

TBtools was used to extract nucleotide data from the first 2000 bp of the promoter region of the ZjROS1 gene family. The website PlantCARE (http://bioinformatics.psb.ugent.be/ (accessed on 3 February 2024)) was used to predict the cis-elements in the ZjROS1 promoter regions, and the visualization analysis results obtained using TBtools were organized and input.
The genomes of A. thaliana, Nicotiana tabacum, Glycine soja, Asparagus officinalis, Prunus salicina, Manihot esculenta, Camelina sativa, and Helianthus annuus were used to search for genes of the same family through BLAST. MEGA 7 v7.0..26 software was used to perform multiple sequence alignments on their ROS1 protein sequences and three Z. jujuba cv. Dongzao ROS1 protein sequences, and a phylogenetic tree was constructed using the maximum likelihood method. The STRING online website (https://cn.string-db.org/ (accessed on 3 February 2024)) was used for a protein interaction prediction analysis, and the model plant A. thaliana was selected as a parameter.

2.2.2. Cloning of ZjROS1 Gene

The total RNA was extracted from different parts and at different stages of the Z. jujuba cv. Dongzao fruits using a plant total RNA extraction kit provided by Beijing ComWin Biotech Co., Ltd. (Beijing, China). The RNA concentration was detected using a microspectrophotometer, and the extraction quality was determined using 1.5% agar gel electrophoresis. A PrimeScript™ RT reagent kit with a gDNA Eraser (Perfect Real Time) kit (TaKaRa BIO INC, Beijing, China) was used to reverse transcribe the total RNA into cDNA, which was stored at −80 °C for later use.
The CDS sequence of Z. jujuba cv. Dongzao was obtained from NCBI, and the ZjROS1 clone and quantitative primer were designed using the software Primer Premier 5.0. ZjACT was selected as the internal reference gene, and the primer sequences were designed and sent to Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China) for synthesis (Table 1). The cDNA of various parts of Z. jujuba cv. Dongzao was amplified using PCR (Supplementary Table S1), the target bands were recovered using 1% agarose gel electrophoresis, and positive clones were identified and sent for testing.

2.2.3. Tissue-Specific Gene Expression Characteristics of ZjROS1 Family

The internal reference gene ZjACT and 3 ZjROS1 genes were selected, and the young leaves, old leaves, young stems, old stems, flowers, and fruits at the white maturity stage, half-red stage, and full-red stage were selected as cDNA templates. TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa BIO INC, Beijing, China) was used for real-time fluorescence quantitative PCR (Supplementary Table S2). The experiment was repeated three times for each ZjROS1 gene. The relative expression levels of the ZjROS1 gene in various parts and periods of the fruit were calculated using the −ΔΔCT method, and an electronic expression heat map was drawn.

2.2.4. Construction of Ziziphus jujuba cv. Dongzao ZjROS1 Gene-Editing Vector

The online tool CRISPR2 (http://cbi.hzau.edu.cn/cgi-bin/CRISPR2/SCORE (accessed on 5 April 2024)) was used to design a pair of 20 bp left–right oligo DNA strands in the target DNA area. Two primers with high scores were selected and designed in accordance with the design requirements of target site primers for the pP1C.4 carrier (dicotyledon) of Genloci Biotechnologies Inc., Nanjing, China. Thereafter, the primers were sent to Sangon Biotech (Shanghai) Co., Ltd., for synthesis. The purification level was PAGE (Table 2).
Using the carrier as the template, all of the above primers were used with 2×TransStart KD Plus PCR SuperMix (Beijing TransGen Biotech Co., Ltd., Beijing, China), a high-fidelity PCR amplification enzyme, to obtain the sgRNA box (Supplementary Table S3). The PCR products were detected using 1% agarose gel electrophoresis. The target fragments were recovered, and the OD260/OD280 values of the recovered products were between 1.8 and 2.0. The pP1C.4 vector was digested with EcoRI and XbaI double enzymes (Supplementary Table S4). DNA recombinase was used to recombine the digested product and the amplified fragment recovered above, constructing the recombinant vector (Supplementary Table S5).
The recombinant products were transformed into Escherichia coli GT115 (Beyotime Biological Co., Ltd., Shanghai, China) competent cells. The suspended bacterial solution was spread on LB medium containing kanamycin and cultured overnight at 37 °C. Single colonies were selected and verified using PCR. After verification, the culture was expanded, and the bacteria were preserved with 50% glycerol. The positive bacteria were extracted and transferred into Agrobacterium GV3101 competent cells (Beyotime Biological Co., Ltd., Shanghai, China). The cells were spread on Kanamycin–Rifampicin Selective (Beyotime Biological Co., Ltd., Shanghai, China) LB solid medium and cultured at 28 °C for 36 h. Single colonies were selected for PCR detection. The selected positive single colonies were placed in kanamycin–rifampicin-resistant LB liquid medium, cultured at 28 °C for 36 h, protected with 70% glycerol, and stored in a −80 °C refrigerator for subsequent genetic transformation.

3. Results

3.1. Bioinformatics Analysis of the ZjROS1 Gene Family

3.1.1. Gene Family Identification and Protein Physicochemical Property Analysis

By comparing the Z. jujuba cv. Dongzao genome with AtROS1, using the homologous sequence principle, the genes related to demethylase ROS1 in Z. jujuba cv. Dongzao were searched. Finally, three ZjROS1 gene sequences, named ZjROS1-1, ZjROS1-2, and ZjROS1-3, were obtained. The physical and chemical properties are shown in Table 3. The numbers of amino acids were 1758, 1938, and 753. The isoelectric points were between 5.0 and 8.0. The instability coefficient was greater than 40, indicating that all were unstable proteins. The fat solubility coefficients were all less than 80, and the total average hydrophilicity was less than 0, indicating that all the proteins were hydrophilic proteins (Table 3 and Supplementary Figure S1). According to the prediction analysis of those protein phosphorylation sites (Supplementary Figure S2), the family proteins all contained phosphoric acid sites in serine, threonine, and tyrosine, among which the amino acids above 0.5 were phosphorylated amino acids based on the pink line (0.5) in the horizontal coordinate. It can be seen that the proteins of the gene family have multiple phosphorylation sites and may be regulated by phosphorylation.

3.1.2. Transmembrane Domain Analysis and Chromosome Localization Prediction

The ZjROS1 family proteins had no signal peptide (Supplementary Figure S3). The N-best prediction results in the 1-1.2 range showed that the ZjROS1 family proteins had no transmembrane domain (Supplementary Figure S4), indicating that they were not membrane proteins or secreted proteins. The three genes of ZjROS1 were distributed on chromosomes 12, 3, and 2, suggesting that the gene distribution of this family is unbiased and that there is no tandem replication (Figure 1) [39]. According to a subcellular localization prediction analysis, ZjROS1-1 was located in the nucleus; ZjROS1-2 was located in the nucleus and cytoskeleton; and ZjROS1-3 was located in the nucleus, cytoskeleton, vacuoles, and chloroplasts (Supplementary Table S6).

3.1.3. ZjROS1 Gene Conserved Motif, Conserved Domain Analysis, and Secondary and Tertiary Structures’ Prediction Analysis

According to Figure 2, it was predicted that the arrangement orders of the conserved motifs in the different members of the ZjROS1 gene family are basically the same. Using Batch-CDD in NCBI to predict conserved domains, it was found that the RRM_DME and Perm-CXXC complex domains exist in the ZjROS1 gene family. RRM_DME is a predictive RRM folding domain involved in DNA demethylation in plants. Perm-CXXC is a single unit of the ZF-CXXC domain detected in plant proteins and ROS1 that catalyzes the release of 5-methylcytosine from DNA through the glycosylase/lyase mechanism.
According to the analysis, there were the following four types of secondary structural elements, with random curling and the α-helix accounting for the largest proportions: random curling accounted for 41.97~45.34%; the α-helix accounted for 32.31~35.99%; the extended chain accounted for 14.04~15.47%; and the β-fold accounted for the smallest proportion, ranging from 6.66% to 7.97% (Table 4 and Supplementary Figures S5 and S6).

3.1.4. Promoter Cis-Acting Element Analysis and Protein Interaction Prediction Analysis

According to the analysis results in Figure 3, the promoters of the ZjROS1 gene family members contain various cis-acting elements. These include the CAAT-box, TATA-box, and CCAAT-box, which are essential for the transcription initiation sites of promoters. The components involved in the light response are the AAAC-motif, GT1-motif, ACE, G-Box, ATCT-motif, Ctt-motif, I-box, GATA-motif, CTC-motif, AE-box, ATC-motif, GTGGC-motif, and ATCT-motif. The transcription activator is E2Fb. The MYB binding sites are involved in the drought-related element MBS. The antioxidant reaction element is ARE. The cold-stress response element is the W-box. MYB, MYB-like sequences, and MYC elements respond to stress and hormone stimuli. The hormone-related regulatory elements include the plant hormone signal transduction element F-box, AuxRR-core, and TGA-element. The response elements for methyl jasmonate are the CGTCA-motif and TGACG-motif. The salicylic acid response element is the TCA-element. The ABRE, AAGAA-motif, and LAMP-element are also present. The gibberellin response elements are the GARE-motif and P-box. TC-rich repeats, which are defensive stress elements, are related to biotic and abiotic stresses. The element regulating anaerobic induction is ARE. The GCN4-motif cis-element is involved in endosperm-specific expression. The WUN-motif is an active element involved in the wound response. The element participating in the stress response is STRE. The dehydration reaction element is the DRE-core. The element participating in the low-temperature response is LTR. The meristem-specific element is the CAT-box. Additionally, WRE3 is the TCF protein-binding site.

3.1.5. Construction of Phylogenetic Tree

The ZjROS1 protein sequence was input into MEGA 7 for a multiple sequence comparison, and a ZjROS1 gene family evolutionary tree was constructed using the maximum likelihood method. Meanwhile, the ROS1 protein family of A. thaliana, Nicotiana tabacum, Glycine soja, Asparagus officinalis, Prunus salicina, Manihot esculenta, Camelina sativa, and Helianthus annuus and other ROS1 protein families were introduced, and the evolutionary tree shown in Figure 4 was obtained through an evolutionary analysis. It can be seen in the figure that the three protein sequences of Z. jujuba cv. Dongzao are in the same branch as the ROS proteins of N. tabacum, G. soja, A. officinalis, and other plants, and their similarity is high.

3.1.6. Protein Interaction Prediction Analysis

The protein sequence was submitted to the STRING online website, the species was selected as the model plant A. thaliana, and the prediction results of interactions with the ROS1 protein were obtained (Figure 5). According to the results, with the ROS1 protein as the center, it interacts with the ROS3, CMT2, CMT3, NRPD1B, NRPD1A, MET1, ZDP, IDM2, and APE1L proteins.

3.2. Cloning of ZjROS1 Gene of Ziziphus jujuba cv. Dongzao

RNA was extracted from different parts and fruits of Z. jujuba cv. Dongzao and reverse-transcribed into cDNA. The 28S and 18S RNA bands were clear, and the OD260/OD280 values were between 1.8 and 2.1, indicating that the extracted RNA had good integrity (Figure 6a,b). Using Z. jujuba cv. Dongzao cDNA as a template, PCR was performed on the ZjROS1 family genes. The obtained bands of the amplified products are shown in Figure 6c.

3.3. Analysis of the Tissue Expression Characteristics of ZjROS1 Gene Family

The expression of the ZjROS1 gene family in Z. jujuba cv. Dongzao was further studied, the expression and response characteristics of the ZjROS1 gene in different tissues were analyzed, and a heatmap was drawn (Figure 7). ZjROS1-1 and ZjROS1-2 used the semi-red stage as a basis, while ZjROS1-3 used the young stem as a basis. The results show that the ZjROS1 gene family was expressed to varying degrees in the stems and flowers, while most genes had low or no expression in the fruits and leaves. In various parts of the Z. jujuba cv. Dongzao leaves, except for ZjROS1-1, which was expressed in both old and young leaves, the rest were not expressed. In the stems and flowers of Z. jujuba cv. Dongzao, the ZjROS1 gene was expressed to varying degrees, and the expression levels of ZjROS1-1 and ZjROS1-2 were higher in the old stems than in the young stems, with ZjROS1-2 having the highest expression level in the flowers. In the fruits at different stages, except for ZjROS1-3, which was not expressed, all other ZjROS1 genes had a certain expression level, and ZjROS1-2 had the highest relative expression level during the full-red stage. In addition, the closer the genetic evolutionary relationship, the more similar the expression patterns. The research results indicate that these genes have specific expression patterns in different tissue parts and play a certain role in regulating the maturity and development of Z. jujuba cv. Dongzao.

3.4. Construction of Ziziphus jujuba cv. Dongzao ZjROS1 Gene-Editing Vector

The online tool CRISPR2 was used to design gene knockout primers, and the knockout sites were named ZjROS1-1-1, ZjROS1-1-2, ZjROS1-2-1, and ZjROS1-2-2. The sgRNA clone frame was obtained via PCR amplification using U6p.4-F universal primers and target gene primers. After amplification, the PCR products were detected using 1% agarose gel electrophoresis, and the target fragment was about 350 bp, which was consistent with the expected results (Figure 8a). A new gene-edited recombinant plasmid was obtained by connecting the pP1C.4 vector cut by EcoRI and XbaI with the sgRNA frame. The length of the linear vector fragment after digestion was about 14 kb (Figure 8b).
The recombinant gene-editing vector was introduced into Escherichia coli GT115 competent cells (Figure 9a–c), single colonies were selected for PCR detection and sequencing identification, and the PCR products were subjected to 1% agar gel electrophoresis. The results show that the target fragment was about 400 bp, which is consistent with the expected results, and it was proven to be a positive clone (Figure 10a). The plasmid of positive E. coli bacteria was extracted and introduced into Agrobacterium GV3101 receptor cells for PCR verification. The product was subjected to 1% agarose gel electrophoresis, and the results show that the target fragment was about 400 bp, which is consistent with the expected results (Figure 10b), providing a basis for the subsequent genetic transformation.

4. Discussion

ROS1 family proteins, also known as DNA demethylases, participate in the demethylation process of DNA methylation modification, which has an important impact on plant growth and development and environmental adaptation [40]. ROS1 affects gene expression levels by removing 5-methylcytosine from DNA. In addition, the ROS1 gene also interacts with DNA methylation-modified transcription factors and epigenetic modifiers to regulate gene expression patterns.
Studies have shown that demethylase ROS1 can regulate various biological processes in many plants and participate in the regulation of plant gene expression [41]. Based on previous studies, in this study, the AtROS1 gene of A. thaliana was compared with the whole genome database of Z. jujuba cv. Dongzao; a total of three ZjROS1 proteins with similar domains were compared, and three ZjROS1 proteins were bioinformatically analyzed. The results showed that ZjROS1 belonged to hydrophilic lipopolysin. Subcellular localization showed that ZjROS1 was located in the nucleus or cytoskeleton, vacuole, or chloroplast and had no transmembrane domain. It was found that the three proteins were mainly distributed on three chromosomes, and there was no gene tandem replication. By constructing an evolutionary tree, it was found that the three protein sequences were in the same branch as the ROS proteins of Nicotiana tabacum, Glycine soja, Asparagus officinalis, and other plants, and their similarity was high. The RRM_DME complex domain was also found in the conserved structural elements of the ZjROS1 protein sequence, which is involved in DNA demethylation in plants. The Perm-CXXC domain catalyzes the release of 5-methylcytosine from DNA through the glycosylase/lyase mechanism. Zhu, M.Y. et al. elaborate in detail on the functions of conserved domains in plant DNA demethylases, including the RRM_DME and Perm-CXXC domains. Their study showed that the RRM_DME domain plays a crucial role in recognizing and binding to specific DNA sequences, which corresponds to the function of the RRM_DME complex domain in the ZjROS1 protein in this study, which is involved in DNA demethylation. The Perm-CXXC domain has catalytic activity and can participate in the removal process of 5-methylcytosine, similar to the function of the Perm-CXXC domain in the ZjROS1 protein in this study, which catalyzes the release of 5-methylcytosine from DNA through the glycosylase/lyase mechanism [42].
By predicting the promoter of the ZjROS1 gene family in Z. jujuba cv. Dongzao, in addition to the promoter necessary for transcription initiation sites, many hormone-related regulatory elements were identified, such as the CGTCA-motif and TGACG-motif of the methyl jasmonate response, suggesting that ZjROS1 may respond to the regulation of methyl jasmonate. It was involved in the endosperm expression element, that is, the GCN4_motif, and the meristemia-specific element, that is, the CAT-box, indicating that the ZjROS1 gene family may be involved in plant cell growth and fruit development. The elements associated with biotic and abiotic stresses indicate that the ZjROS1 gene family may respond to drought stress, low temperature, etc. Zhu, H.F. et al. found that ROS1 negatively regulates the DNA methylation of the DOGL4 promoter, thereby controlling gene imprinting. Moreover, it regulates seed dormancy and the ABA response through DOGL4. In the plant hormone regulation network, there may be certain interactions between ABA and methyl jasmonate, which indirectly indicates the role of the ROS1 gene in related regulatory pathways. This study also pointed out that DOGL4 is an imprinted gene in the endosperm of A. thaliana. ROS1 negatively regulates DOGL4 gene imprinting by preventing the hypermethylation and complete silencing of the paternal allele, affecting its expression in the endosperm. Additionally, this study discovered that ROS1 affects seed dormancy by regulating DOGL4 gene imprinting. As seed dormancy is closely related to plant growth and development, it indirectly reflects the influence of the ROS1 gene on plant growth and development, which corresponds to the promoter prediction results of this study [43]. Chang, Y.N. et al. found that ROS1-mediated DNA demethylation is involved in the regulation of the stress response, further demonstrating the epigenetic regulatory role of the ROS1 gene in the plant stress response [44]. In conclusion, combined with the promoter element analysis, it is indicated that the ZjROS1 family may participate in the development and ripening of Z. jujuba cv. Dongzao fruits through multiple pathways.
A protein interaction network prediction analysis revealed that the ROS1 protein interacts with the DML1, CMT2, and CMT3 proteins. The tissue expression characteristics of the ZjROS1 gene family were analyzed, and the results show that the ZjROS1 gene family is specifically expressed in different tissue of Z. jujuba cv. Dongzao, which is speculated to play a certain role in the regulation of the maturation and development of Z. jujuba cv. Dongzao.
In plants, active DNA demethylation is initiated by the ROS1 family with bifunctional DNA glycosylase/lyase. ROS1 has been shown to play an important regulatory role in the demethylation mechanism of plant DNA [45]. In Nicotiana tabacum, NtROS1 has also shown the ability to remove 5-methylcytosine from DNA in addition to 5-methylcytosine, but this reaction is less efficient than 5-methylcytosine because the plant rarely uses 5-methylcytosine as an epigenetic mark [46]. In Oryza sativa, it was found through gene cloning that a dominant negative mutation of the DNA demethylase gene OsROS1 led to aleurone layer thickening, which is of great significance for expanding the breeding of the nutritional quality of gramineous crops [47]. At present, there are few studies on the effects of ROS1 on plant growth and development. Using CRISPR/Cas9 gene-editing technology to select alleles derived from DNA methylation or demethylation mutants or to generate alleles as editing sites to obtain mutant plants is an important method for plant breeding [41].
In the future, we plan to use CRISPR/Cas9 technology to obtain gene-edited plants and further study the specific functions of the ZjROS1 gene family members in the growth and development, fruit quality formation, and stress resistance of Z. jujuba cv. Dongzao. By comparing the phenotypic differences between wild-type and gene-edited plants at different growth stages and under different environmental conditions, as well as combining the determination of physiological and biochemical indicators, the functional mechanism of the ZjROS1 gene will be clarified. We will search for the upstream transcription factors that regulate the expression of the ZjROS1 gene, as well as the downstream target genes regulated by the ZjROS1 gene; draw a complete regulatory network; and deeply examine its action path in the biological processes of Z. jujuba cv. Dongzao. By combining multi-omics technologies, such as transcriptomics, proteomics, and metabolomics, we will comprehensively analyze the role of the ZjROS1 gene family in the growth, development, and environmental response of Z. jujuba cv. Dongzao. Through an integrated analysis of multi-omics data, we will explore the key metabolic pathways and biological processes related to the ZjROS1 gene, discover more potential regulatory factors and functional genes, attempt to genetically modify Z. jujuba cv. Dongzao through gene-editing technology, cultivate new varieties with more excellent traits, and promote the development of the Z. jujuba cv. Dongzao industry.

5. Conclusions

DNA demethylase essentially contains ENDO3C, RRM-DME, and Perm-CXXC domains, which are closely related to plant growth and development regulation, plant stress resistance, etc. In this study, we identified three ZjROS1 genes with the RRM-DME and Perm-CXXC domains. A gene-editing vector was constructed, laying the foundation for subsequent genetic transformation. A tissue expression specificity analysis revealed that the ZjROS1 gene was related to the growth and development of Z. jujuba cv. Dongzao fruit. ZjROS1 may regulate the growth and development of Z. jujuba cv. Dongzao fruit through DNA methylation modification, but the specific methylation function and epigenetic regulatory mechanism of Z. jujuba cv. Dongzao need to be further verified. By constructing a phylogenetic tree, it was found that compared with the ROS1 genes in other species, the ZjROS1 gene in Z. jujuba cv. Dongzao exhibits a certain evolutionary conservation. This implies that during the long evolutionary process, the ROS1 genes of these plants may have originated from a common ancestor, and there may also be similarities in their functions. For instance, in A. thaliana, the ROS1 gene plays a crucial regulatory role in coping with abiotic stress. It promotes the expression of defense genes and stress-responsive genes by reducing the DNA methylation level. Although the ZjROS1 gene in Z. jujuba cv. Dongzao shares similarities with the ROS1 genes of these species, due to the unique growth characteristics and fruit development process of Z. jujuba cv. Dongzao, the ZjROS1 gene may possess unique functions in regulating the fruit ripening and development of Z. jujuba cv. Dongzao. In subsequent research, based on the constructed gene-editing vector, the CRISPR/Cas9 technology can be utilized to obtain gene-edited plants. By comparing the differences in aspects such as growth and development, fruit quality, and stress resistance between wild-type and gene-edited plants, the specific functions of the ZjROS1 gene family members can be explored in depth.
This study provides an important theoretical basis for further understanding the regulatory mechanism of ROS1 demethylation and its roles in the growth and development of Z. jujuba cv. Dongzao.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes16020228/s1. Supplementary Table S1: PCR amplification reaction system and program; Supplementary Table S2: Real-time PCR reaction system and procedure; Supplementary Table S3: High-Fidelity DNA Polymerase PCR amplification reaction system and program; Supplementary Table S4: Enzyme digestion reaction system; Supplementary Table S5: Recombinant enzyme integration reaction system; Supplementary Table S6: Subcellular localization prediction of ZjROS1 family; Supplementary Figure S1: Prediction of hydrophilicity of ZjROS1 family proteins in Ziziphus jujuba cv. Dongzao; Supplementary Figure S2: Prediction of phosphate sites in the ZjROS1 family protein of Ziziphus jujuba cv. Dongzao; Supplementary Figure S3: Analysis of ZjROS1 family protein signal peptides in Ziziphus jujuba cv. Dongzao; Supplementary Figure S4: Analysis of transmembrane domains of ZjROS1 family proteins in Ziziphus jujuba cv. Dongzao; Supplementary Figure S5: Prediction of secondary structures of ZjROS1-1, ZjROS1-2, and ZjROS1-3; Supplementary Figure S6: Prediction of tertiary structures of ZjROS1-1, ZjROS1-2, and ZjROS1-3; Supplementary Figure S7: Plasmid map of pP1C.4.

Author Contributions

Conceptualization, J.W. and W.X.; methodology, J.W., H.W., J.Z. (Jiayi Zhai) and W.X.; software, J.W., F.Z. and W.X.; investigation, J.W., H.W., Z.Z. and L.L.; resources, J.Z. (Jun Zhou) and Y.R.; data curation, J.Z. (Jun Zhou) and W.X.; writing—original draft preparation, J.W.; writing—review and editing, J.W. and W.X.; supervision, W.X.; project administration, W.X.; funding acquisition, W.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China, grant number: 32060669; Innovation Team for Genetic Improvement of Economic Forests, grant number: 2022QCXTD04; The sixth batch of Ningxia young scientific and technological talent lifting project, Graduate Innovation Program of North Minzu University, grant number: YCX24138.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets supporting the results presented in this manuscript are included within the article (and its Supplementary Materials).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhang, Z.B.; Zhao, X.C.; Shi, Z.A.; Li, G.C.; Li, X.L. Effect of ecological factors on the quality of Ziziphus jujuba Mill. cv.“Dongzao”fruit. Chin. J. Eco-Agric. 2009, 5, 923–928. [Google Scholar]
  2. Xu, J.R.; Li, S.Y.; Zhang, C.S. Zizyphus jujuba cv. Dongzao and its diffrence with other late-ripe Jujube cultivars. Forest Ecol. Sci. 2003, 1, 38–42. [Google Scholar]
  3. Ji, Q.; Bao, C.Y.; Zhou, J.; Xu, Y.L.; Wang, D.W.; Wang, L.C.; Yang, H.S.; Bai, M.X.; Xie, Z.W.; Tian, J.S.; et al. Effects of rain shelter cultivation on fruit quality of Ziziphus jujuba Mill. cv. Dongzao. Non-Wood For. Res. 2018, 36, 64–72. [Google Scholar] [CrossRef]
  4. He, R.P.; Li, F.L.; Xu, J.R. Study on flower development and fruit anatomical structure of Zizyphus jujube ‘Dongzao’. J. Agric. 2010, 10, 30–32+41. [Google Scholar]
  5. Li, L.; Yan, X.Y.; Zhang, H.; LI, X.F.; Liu, M.; Wang, Y.F. Transcriptome data analysis of fresh Jujube fruits during ripening process based on High-throughput Sequencing. Mol. Pl. Breed. 2020, 18, 4213–4221. [Google Scholar] [CrossRef]
  6. Li, Y.F. The Molecular Mechanism Research on the Red Pigment Development of Zizyphus jujuba Mill cv. Dongzao; Tianjin University: Tianjin, China, 2017. [Google Scholar]
  7. Chen, Q. Comprehensive Evaluation of the Main Functional Factors and Identification of the Antioxidant and Tumor-Inhibition Compounds in Jujube; Tianjin University: Tianjin, China, 2015. [Google Scholar]
  8. Wu, J.Y. Effects of Coating Treatments on Storage Quality and Antioxidant Capacity of Zizyphus jujuba Miller cv. Dongzao; Tianjin University: Tianjin, China, 2016. [Google Scholar]
  9. Li, J.W.; Fan, L.P.; Ding, S.D.; Ding, X.L. Nutritional composition of five cultivars of chinese jujube. Food Chem. 2006, 103, 454–460. [Google Scholar] [CrossRef]
  10. Shen, L. Mechanism and Control of Fermentation Softening of Chinese Ziziphus jujuba cv. Dongzao During Storage; China Agricultural University: Beijing, China, 2002. [Google Scholar]
  11. Chen, C.; Yuan, Y.L.; Zhang, C.; Li, H.X.; Ma, F.W.; Li, M.J. Sucrose phloem unloading follows an apoplastic pathway with high sucrose synthase in Actinidia fruit. Plant Sci. 2017, 255, 40–50. [Google Scholar] [CrossRef]
  12. Kai, Y.; Matsumura, H.; Izui, K. Phospho enol pyruvate carboxylase: Three-dimensional structure and molecular mechanisms. Arch. Biochem. Biophys. 2003, 414, 170–179. [Google Scholar] [CrossRef]
  13. Koyama, K.; Ikeda, H.; Poudel, R.P.; Goto-Yamamoto, N. Light quality affects flavonoid biosynthesis in young berries of Cabernet Sauvignon grape. Phytochemistry 2012, 78, 54–64. [Google Scholar] [CrossRef]
  14. Zhang, C.M.; Huang, J.; Li, X.G. Transcriptomic analysis reveals the metabolic mechanism of L-ascorbic acid in Ziziphus jujuba Mill. Front. Plant Sci. 2016, 7, 122. [Google Scholar] [CrossRef]
  15. Cheng, J.F.; Niu, Q.F.; Zhang, B.; Chen, K.S.; Yang, R.H.; Zhu, J.K.; Zhang, Y.J.; Lang, Z.B. Downregulation of RdDM during strawberry fruit ripening. Genome biol. 2018, 19, 212. [Google Scholar] [CrossRef] [PubMed]
  16. Huang, H.; Liu, R.; Niu, Q.F.; Lang, Z.B. Global increase in DNA methylation during orange fruit development and ripening. Proc. Natl. Acad. Sci. USA 2019, 116, 1430–1436. [Google Scholar] [CrossRef] [PubMed]
  17. Zhang, H.M.; Lang, Z.B.; Zhu, J.K. Dynamics and function of DNA methylation in plants. Nat. Rev. Mol. Cell Biol. 2018, 19, 489–506. [Google Scholar] [CrossRef] [PubMed]
  18. Gong, Z.Z.; Morales-Ruiz, T.; Ariza, R.R.; Roldán-Arjona, T.; David, L.; Zhu, J.K. ROS1, a Repressor of Transcriptional Gene Silencing in Arabidopsis, Encodes a DNA Glycosylase/Lyase. Cell 2002, 111, 803–814. [Google Scholar] [CrossRef]
  19. Yu, A.; Lepère, G.; Jay, F.; Wang, J.; Bapaume, L.; Wang, Y.; Abraham, A.L.; Penterman, J.; Fischer, R.L.; Voinnet, O.; et al. Dynamics and biological relevance of DNA demethylation in Arabidopsis antibacterial defense. Proc. Natl. Acad. Sci. USA 2013, 110, 2389–2394. [Google Scholar] [CrossRef]
  20. Qian, M.J. Mechanism of DNA Methylation and micmRNA Regulating Peel Coloration in Red Pear; Zhejiang University: Hangzhou, China, 2017. [Google Scholar]
  21. Yang, Y.; Tang, K.; Datsenka, T.U.; Liu, W.; Lv, S.; Lang, Z.; Wang, X.; Gao, J.; Wang, W.; Nie, W.; et al. Critical function of DNA methyltransferase 1 in tomato development and regulation of the DNA methylome and transcriptome. J. Integr. Plant Biol. 2019, 61, 1224–1242. [Google Scholar] [CrossRef]
  22. Chen, Y.O.; Bao, Y.; Ma, H.Z.; Yi, Z.Y.; Zhou, Z.; Wei, W.S. Gene editing technology and its research progress in China. Hereditas 2018, 40, 900–915. [Google Scholar] [CrossRef]
  23. Lin, Y.; Cradick, T.J.; Brown, M.T.; Deshmukh, H.; Ranjan, P.; Sarode, N.; Wile, B.M.; Vertino, P.M.; Stewart, F.J.; Bao, G. CRISPR/Cas9 systems have off-target activity with insertions or deletions between target DNA and guide RNA sequences. Nucleic Acids Res. 2014, 42, 7473–7485. [Google Scholar] [CrossRef]
  24. Wang, W.; Simmonds, J.; Pan, Q.; Davidson, D.; He, F.; Battal, A.; Akhunova, A.; Trick, H.N.; Uauy, C.; Akhunov, E. Gene editing and mutagenesis reveal inter-cultivar differences and additivity in the contribution of TaGW2 homoeologues to grain size and weight in wheat. Theor. Appl. Genet. 2018, 131, 2463–2475. [Google Scholar] [CrossRef]
  25. Zhang, Y.; Li, D.; Zhang, D.B.; Zhao, X.G.; Cao, X.M.; Dong, L.L.; Liu, J.X.; Chen, K.L.; Zhang, H.W.; Gao, C.X.; et al. Analysis of the functions of TaGW2 homoeologs in wheat grain weight and protein content traits. Plant J. 2018, 94, 857–866. [Google Scholar] [CrossRef]
  26. Nelson, O.E.; Rines, H.W. The enzymatic deficiency in the waxy mutant of maize. Biochem. Biophys. Res. Commun. 1962, 9, 297–300. [Google Scholar] [CrossRef] [PubMed]
  27. Doane, C.; Liu, Z.B.; Jeffry, S. Use of CRISPR/Cas9 for crop improvement in maize and soybean. Prog. Mol. Biol. Transl. Sci. 2017, 149, 27–46. [Google Scholar] [CrossRef]
  28. Vladimir, N.; Wang, C.M.; Joe, W.; Christa, L.; Detlef, W.; Sophien, K. Rapid generation of a transgene-free powdery mildew resistant tomato by genome deletion. Sci. Rep. 2017, 7, 482. [Google Scholar] [CrossRef]
  29. Feng, Z.J.; Liu, N.; Zhang, G.W.; Bu, Y.P.; Wang, B.; Gong, Y.M. Construction of vegetable soybean GBSSII gene editing vector based on CRISPR/Cas9. Mol. Plant Breed. 2022, 9, 1–9. [Google Scholar]
  30. Yang, X.; Wang, F.Q.; Chen, Z.H.; Wang, J.; Li, W.Q.; Fan, F.J.; Tao, Y.J.; Jiang, Y.J.; Zhu, Q.H.; Yang, J. CRISPR/Cas9-targeted mutagenesis of the OsROS1 gene induces pollen and embryo sac defects in rice. Plant Biotechnol. J. 2020, 10, 1999–2001. [Google Scholar] [CrossRef]
  31. Andrea, G.; Santo, M.D.; Leandro, Q.; Marta, P.; Montserrat, A.M.; Jordi, G.M. CRISPR/Cas9 gene editing uncovers the role of CTR1 and ROS1 in melon fruit ripening and epigenetic regulation. J. Exp. Bot. 2022, 73, 4022–4033. [Google Scholar] [CrossRef]
  32. Gu, C.; Pei, M.S.; Guo, Z.H.; Wu, L.; Qi, K.J.; Wang, X.P.; Liu, H.; Liu, Z.C.; Lang, Z.B.; Zhang, S.L. Multi-omics provide insights into the regulation of DNA methylation in pear fruit metabolism. Genome Biol. 2024, 25, 70. [Google Scholar] [CrossRef]
  33. Wang, Z.G.; Dong, M.; Wang, A.D.; Li, T.L.; Jiang, S.L.; Cong, P.H.; Li, T.Z. The methylation of the PcMYB10 promoter is associated with green-skinned sport in Max Red Bartlett pear. Plant Physiol. 2013, 162, 885–896. [Google Scholar] [CrossRef]
  34. Lang, Z.B.; Wang, Y.H.; Tang, K.; Tang, D.G.; Tatsiana, D.; Cheng, J.F.; Zhang, Y.J.; Handa, A.K.; Zhu, J.K. Critical roles of DNA demethylation in the activation of ripening-induced genes and inhibition of ripening-repressed genes in tomato fruit. Proc. Natl. Acad. Sci. USA 2017, 114, E4511–E4519. [Google Scholar] [CrossRef]
  35. Yang, L.P.; Lang, C.J.; Wu, Y.J.; Meng, D.W.; Yang, T.B.; Li, D.Q.; Jin, T.C.; Zhou, X.F. ROS1-mediated decrease in DNA methylation and increase in expression of defense genes and stress response genes in Arabidopsis thaliana due to abiotic stresses. BMC Plant Biol. 2022, 22, 104. [Google Scholar] [CrossRef]
  36. Yu, L.J.; Sun, Y.Y.; Zhang, X.; Chen, M.C.; Wu, T.; Zhang, J.; Xing, Y.F.; Tian, J.; Yao, Y.C. ROS1 promotes low temperature-induced anthocyanin accumulation in apple by demethylating the promoter of anthocyanin-associated genes. Hortic. Res. 2022, 9, uhac007. [Google Scholar] [CrossRef] [PubMed]
  37. Tang, K.; Zhu, X.; Xie, S.; Lang, Z.B.; Zhu, J.K. Transgenerational increases in DNA methylation in Arabidopsis plants defective in active DNA demethylation. Proc. Natl. Acad. Sci. USA 2024, 121, e2320468121. [Google Scholar] [CrossRef] [PubMed]
  38. Wang, H.R.; Wang, J.Q.; Zhou, J.; Ren, Y.F.; Wang, C.P.; Xu, W.D.; Zhang, K.; Qiao, S. Bioinformatics analysis and expression identification of ZjRWD40 gene family in Ziziphus jujuba cv. Dongzao. Mol. Plant Breed. 2024, 10, 1–16. [Google Scholar]
  39. Liu, F.; Qu, S.; Sun, H.W.; Jiang, H.P.; Han, Y.P. Identification and bioinformatical analysis of GRAS gene family in response to soybean cyst nematode. Acta Agric. Boreali-Sin. 2023, 38, 166–178. [Google Scholar]
  40. Liu, R.; Lang, Z.B. The mechanism and function of active DNA demethylation in plants. J. Integr. Plant Biol. 2020, 62, 148–159. [Google Scholar] [CrossRef]
  41. Wang, J.; Xie, L.N. Research progress of demethylase ROS1 in plants. Biol. Bull. 2020, 36, 148–157. [Google Scholar] [CrossRef]
  42. Zhu, M.Y.; Li, Y.Z.; Mu, H.M.; Guo, S.J. Cloning and Identification of the Demethylase Gene DME-5B in Wheat. Mol. Plant Breed. 2024, 5, 1403–1409. [Google Scholar] [CrossRef]
  43. Zhu, H.F.; Xie, W.X.; Xu, D.C.; Daisuke, M.; Tang, K.; Huang, C.F.; Zhu, J.K. DNA demethylase ROS1 negatively regulates the imprinting of DOGL4 and seed dormancy in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2018, 42, E9962–E9970. [Google Scholar] [CrossRef]
  44. Chang, Y.N.; Zhu, C.; Jiang, J.; Zhang, H.M.; Zhu, J.K.; Duan, C.G. Epigenetic regulation in plant abiotic stress responses. J. Integr. Plant Biol. 2020, 5, 563–580. [Google Scholar] [CrossRef]
  45. Gehring, M.; Reik, W.; Henikoff, S. DNA demethylation by DNA repair. Trends Genet. 2008, 25, 82–90. [Google Scholar] [CrossRef]
  46. Petrova, D.V.; Permyakova, N.V.; Grin, I.R.; Zharkov, D.O. Characterization of demethylating DNA glycosylase ROS1 from Nicotiana tabacum L. Vavilovskii Zhurnal Genet. Sel. 2022, 26, 341–348. [Google Scholar] [CrossRef]
  47. Liu, J.X.; Wu, X.B.; Yao, X.F.; Yu, R.; Larkin, P.J.; Liu, C.M. Mutations in the DNA demethylase OsROS1 result in a thickened aleurone and improved nutritional value in rice grains. Proc. Natl. Acad. Sci. USA 2018, 115, 11327–11332. [Google Scholar] [CrossRef]
Figure 1. Chromosomal mapping of the ZjROS1 gene family.
Figure 1. Chromosomal mapping of the ZjROS1 gene family.
Genes 16 00228 g001
Figure 2. Schematic diagram of the conserved motifs and conserved domain of the ZjROS1 family. (The upper part of the picture: small boxes of different colors or shapes represent different types of conserved motifs.).
Figure 2. Schematic diagram of the conserved motifs and conserved domain of the ZjROS1 family. (The upper part of the picture: small boxes of different colors or shapes represent different types of conserved motifs.).
Genes 16 00228 g002
Figure 3. Homeopathic element distribution in the promoter region of the ZjROS1 gene. The colored boxes indicate the cis-element types. Different colors represent different numbers of cis-elements.
Figure 3. Homeopathic element distribution in the promoter region of the ZjROS1 gene. The colored boxes indicate the cis-element types. Different colors represent different numbers of cis-elements.
Genes 16 00228 g003
Figure 4. Evolutionary tree of the ROS1 gene family.
Figure 4. Evolutionary tree of the ROS1 gene family.
Genes 16 00228 g004
Figure 5. Protein network prediction of ZjROS1 protein function.
Figure 5. Protein network prediction of ZjROS1 protein function.
Genes 16 00228 g005
Figure 6. RNA extraction and cloning of the ZjROS1 gene from Z. jujuba cv. Dongzao: (a,b) RNA extraction from different tissues and fruits; (a) lanes 1–6 are for young leaves, old leaves, flowers, white ripe fruits, semi red fruits, and fully red fruits; (b) lanes 1–2 and 4–5 are for young stems, old stems, flowers, and white ripe fruits; (c) lanes 1–3 are ZjROS1 gene cloning (lane 1: ZjROS1-3 827 bp, lane 2: ZjROS1-2 1476 bp, lane 3: ZjROS1-1 1656 bp, lane 4: negative control.).
Figure 6. RNA extraction and cloning of the ZjROS1 gene from Z. jujuba cv. Dongzao: (a,b) RNA extraction from different tissues and fruits; (a) lanes 1–6 are for young leaves, old leaves, flowers, white ripe fruits, semi red fruits, and fully red fruits; (b) lanes 1–2 and 4–5 are for young stems, old stems, flowers, and white ripe fruits; (c) lanes 1–3 are ZjROS1 gene cloning (lane 1: ZjROS1-3 827 bp, lane 2: ZjROS1-2 1476 bp, lane 3: ZjROS1-1 1656 bp, lane 4: negative control.).
Genes 16 00228 g006
Figure 7. Expression specificity of the ZjROS1 gene family in Z. jujuba cv. Dongzao. LJ: old stem; YJ: young stem; LY: old leaf; YY: young leaf; H: flower; BS: white ripening period; BH: half-red period; QH: full-red period.
Figure 7. Expression specificity of the ZjROS1 gene family in Z. jujuba cv. Dongzao. LJ: old stem; YJ: young stem; LY: old leaf; YY: young leaf; H: flower; BS: white ripening period; BH: half-red period; QH: full-red period.
Genes 16 00228 g007
Figure 8. (a) SgRNA amplification; (b) linearization vector.
Figure 8. (a) SgRNA amplification; (b) linearization vector.
Genes 16 00228 g008
Figure 9. Transformation of Agrobacterium GV3101 competent cell colony growth chart. (a) Positive control: Agrobacterium tumefaciens known to contain the target gene and with a relatively high transformation efficiency was spread on a plate as a positive control. A large number of resistant Agrobacterium colonies grew, indicating that the transformation experimental system was basically normal. (b) Transforming GV3101 competent cells. (c) Negative control. No colonies grew on the negative control plate, indicating that the concentration of the antibiotic used could effectively inhibit the growth of untransformed Agrobacterium. This ensures that only Agrobacterium that has successfully incorporated the vector containing the resistance gene can grow during the screening of transformants, improving the accuracy of the screening.
Figure 9. Transformation of Agrobacterium GV3101 competent cell colony growth chart. (a) Positive control: Agrobacterium tumefaciens known to contain the target gene and with a relatively high transformation efficiency was spread on a plate as a positive control. A large number of resistant Agrobacterium colonies grew, indicating that the transformation experimental system was basically normal. (b) Transforming GV3101 competent cells. (c) Negative control. No colonies grew on the negative control plate, indicating that the concentration of the antibiotic used could effectively inhibit the growth of untransformed Agrobacterium. This ensures that only Agrobacterium that has successfully incorporated the vector containing the resistance gene can grow during the screening of transformants, improving the accuracy of the screening.
Genes 16 00228 g009
Figure 10. Colony PCR amplification electrophoresis image: (a) Escherichia coli colony PCR. (lines 1–2: negative control); (b) Agrobacterium colony PCR (lane 5: negative control). M: DL2000 DNA Marker.
Figure 10. Colony PCR amplification electrophoresis image: (a) Escherichia coli colony PCR. (lines 1–2: negative control); (b) Agrobacterium colony PCR (lane 5: negative control). M: DL2000 DNA Marker.
Genes 16 00228 g010
Table 1. Primer sequences used in the experiment.
Table 1. Primer sequences used in the experiment.
Primer NamePrimer Sequence (5′–3′)Primer Use
ZjROS1-1-FATGTCTTTCACTGGCCTATTGGGene clone
ZjROS1-1-RCTACTCATCTTTCCTTTCCTTATTT
ZjROS1-2-FATGTAGTGGAACTAATCATGTTTGC
ZjROS1-2-RCTATCTCCTTGAACAAGATGCATT
ZjROS1-3-FATGCTGAACCCATCATTGAAGT
ZjROS1-3-RCTACTCATCATCGTCTTCGTTTATC
dl-ROS1-1-FTGCACCTGTAACACCGGATAReal-time fluorescence quantitative PCR reaction
dl-ROS1-1-RGGAATCTGAAGCAGGCTTTG
dl-ROS1-2-FGAACCAAACGGGTAAAGCAA
dl-ROS1-2-RTTGTGCTGCCATTTTGAGAG
dl-ROS1-3-FAGGCAAGTTCAAAAGCTCCA
dl-ROS1-3-RCTCACAAGATGCTGGCTCTG
ZjACT-FTCACACTTTCTACAATGAGCT
ZjACT-RATATCCACATCACACTTCAT
Table 2. Primer sequences.
Table 2. Primer sequences.
Primer NamePrimer Sequence (5′–3′)Primer Use
qc-ROS1-1-1 RGCTATTTCTAGCTCTAAAACTGGTCACCTCTTTCAGCTACAATCACTACTTCGACTCTGene editing
qc-ROS1-1-2 RGCTATTTCTAGCTCTAAAACAGTCTGGAAGTTCATAGACTCAATCACTACTTCGACTCT
qc-ROS1-2-1 RGCTATTTCTAGCTCTAAAACCTTTCTTCACTAGACTTGGGCAATCACTACTTCGACTCT
qc-ROS1-2-2 RGCTATTTCTAGCTCTAAAACTTTGGATTGACATCATTTGCAATCACTACTTCGACTCT
U6p.4-FCAGGAAACAGCTATGACCATATTCATTCGGAGTTTTTGTATC
Table 3. Physicochemical properties of ZjROS1 protein in Z. jujuba cv. Dongzao.
Table 3. Physicochemical properties of ZjROS1 protein in Z. jujuba cv. Dongzao.
Gene NAMESequence ID (NCBI)Number of Amino Acids (aa)Molecular Weight (Da)Theoretical pIInstability IndexAliphatic IndexGrand Average of Hydropathicity
ZjROS1-1XP_015898699.11758197,208.616.4946.9065.63−0.768
ZjROS1-2XP_015876562.11938217,902.567.6947.5668.98−0.767
ZjROS1-3XP_024926338.175384,959.775.7454.1673.84−0.584
Table 4. Prediction of the protein secondary structure of the ZjROS1 family.
Table 4. Prediction of the protein secondary structure of the ZjROS1 family.
Geneα Helixβ TurnExtendedRandom Coil
ZjROS1-132.31%6.68%15.47%45.34%
ZjROS1-234.31%6.66%14.04%44.99%
ZjROS1-335.99%7.97%14.08%41.97%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, J.; Wang, H.; Zhai, J.; Zhu, F.; Ren, Y.; Zhou, J.; Zhang, Z.; Luo, L.; Xu, W. Identification of Ziziphus jujuba cv. Dongzao DNA Demethylase ZjROS1 Gene Family and Construction of CRISPR/Cas9-Mediated Gene-Editing Vector. Genes 2025, 16, 228. https://doi.org/10.3390/genes16020228

AMA Style

Wang J, Wang H, Zhai J, Zhu F, Ren Y, Zhou J, Zhang Z, Luo L, Xu W. Identification of Ziziphus jujuba cv. Dongzao DNA Demethylase ZjROS1 Gene Family and Construction of CRISPR/Cas9-Mediated Gene-Editing Vector. Genes. 2025; 16(2):228. https://doi.org/10.3390/genes16020228

Chicago/Turabian Style

Wang, Jiaqi, Huiran Wang, Jiayi Zhai, Fulun Zhu, Yufeng Ren, Jun Zhou, Zhikai Zhang, Lan Luo, and Wendi Xu. 2025. "Identification of Ziziphus jujuba cv. Dongzao DNA Demethylase ZjROS1 Gene Family and Construction of CRISPR/Cas9-Mediated Gene-Editing Vector" Genes 16, no. 2: 228. https://doi.org/10.3390/genes16020228

APA Style

Wang, J., Wang, H., Zhai, J., Zhu, F., Ren, Y., Zhou, J., Zhang, Z., Luo, L., & Xu, W. (2025). Identification of Ziziphus jujuba cv. Dongzao DNA Demethylase ZjROS1 Gene Family and Construction of CRISPR/Cas9-Mediated Gene-Editing Vector. Genes, 16(2), 228. https://doi.org/10.3390/genes16020228

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop