Selection of Reference Genes of Flower Development in Ludisia discolor
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Total RNA Isolation and cDNA Synthesis
2.3. Selection of Candidate Reference Genes and Primer Design
2.4. RT-qPCR and Amplification Efficiency
2.5. Data Analysis and Validation of Selected Candidate Reference Genes
3. Results and Analysis
3.1. Primer Specificity Testing and PCR Amplification Efficiency
3.2. Analysis of Expression Levels of Candidate Reference Genes
3.3. Analysis of Expression Stability of Candidate Reference Genes
3.3.1. GeNorm Analysis
3.3.2. NormFinder Analysis
3.3.3. BestKeeper Analysis
3.3.4. ΔCt Method
3.3.5. Comprehensive Analysis
3.4. Reference Gene Validation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Derveaux, S.; Vandesompele, J.; Hellemans, J. How to do successful gene expression analysis using real-time PCR. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J. Biomol. Tech. 2004, 15, 155–166. [Google Scholar] [PubMed]
- Gutierrez, L.; Mauriat, M.; Guenin, S.; Pelloux, J.; Lefebvre, J.F.; Louvet, R.; van Wuytswinkel, O. The lack of a systematic validation of reference genes: A serious pitfall undervalued in reverse transcription–polymerase chain reaction (RT-PCR) analysis in plants. Plant Biotechnol. J. 2008, 6, 609–618. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Vladimir, B.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Wittwer, C.T. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Wang, W.T.; Hu, S.Y.; Cao, Y.; Chen, R.; Wang, Z.Z.; Cao, X.Y. Selection and evaluation of reference genes for qRT-PCR of Scutellaria baicalensis Georgi under different experimental conditions. Mol. Biol. Rep. 2021, 48, 1115–1126. [Google Scholar] [CrossRef]
- Jia, Y.; Liu, S.C.; Zhao, J.; Chen, X.X.; Sun, L.X.; Yu, X.F.; Li, X. Reference gene selection and validation by qRT-PCR during flower development and in different organs of Primula forbesii. J. Hortic. Sci. Biotech. 2020, 95, 383–394. [Google Scholar] [CrossRef]
- Hou, F.F.; Li, S.; Wang, J.Y.; Kang, X.P.; Weng, Y.Q.; Xing, G.M. Identification and validation of reference genes for quantitative real-time PCR studies in long yellow daylily. PLoS ONE 2017, 12, e0174933. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.S.; Ahmed, R.; Haque, M.S.; Alam, M.M.; Islam, M.S. Identification and validation of reference genes for real-time quantitative RT-PCR analysis in jute. BMC Mol. Biol. 2019, 20, 13. [Google Scholar] [CrossRef]
- Chen, X.; Gale, S.W.; Cribb, P.J. The complete chloroplast genome sequence of Ludisia discolor from Hainan of China. Mitochondrial DNA Part B 2019, 4, 3663–3664. [Google Scholar] [CrossRef]
- Yang, Z.Z.; Li, Y.Q.; Gao, F.Z.; Jin, W.; Shadrack, K.; Yang, S.; Bao, T.T.; Gao, X.; Wang, L. MYB21 interacts with MYC2 to control the expression of terpene synthase genes in flowers of Freesia hybrida and Arabidopsis thaliana. J. Exp. Bot. 2020, 71, 4140–4158. [Google Scholar] [CrossRef]
- Huang, H.; Gao, H.; Liu, B.; Qi, T.; Tong, J.; Xiao, L.; Xie, D.; Song, S. Arabidopsis MYB24 regulates jasmonate-mediated stamen development. Front. Plant Sci. 2017, 8, 1525. [Google Scholar] [CrossRef] [PubMed]
- Perez-Rodriguez, M.; Jaffe, F.W.; Butelli, E.; Glover, B.J.; Martin, C. Development of three different cell types is associated with the activity of a specific MYB transcription factor in the ventral petal of Antirrhinum majus flowers. Development 2005, 132, 359–370. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.L.; Wang, J.Y.; Zhang, B.H. RefFinder: A web-based tool for comprehensively analyzing and identifying reference genes. Funct. Integr. Genom. 2023, 23, 125. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntof, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef]
- Yuan, X.Y.; Jiang, S.H.; Wang, M.F.; Ma, J.; Zhang, X.Y.; Cui, B. Evaluation of internal control for gene expression in Phalaenopsis by quantitative real-time PCR. Appl. Biochem. Biotechnol. 2014, 173, 1431–1445. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, Y.; Huang, J.; Wang, W.; Tong, Y.; Zhao, K.; Zhou, Y. Selection of Suitable RT-qPCR Reference Genes for Floral Scent Biosynthesis in Phalaenopsis I-Hsin Venus. Trop. Crops. J. 2023, 44, 2188–2195. [Google Scholar]
- Karuppaiya, P.; Yan, X.X.; Liao, W.; Wu, J.; Chen, F.; Tang, L. Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas—A biodiesel plant. PLoS ONE 2017, 12, e0172460. [Google Scholar]
- da Silva Santos, P.H.; Manechini, J.R.V.; Brito, M.S.; Romanel, E.; Vicentini, R.; Scarpari, M.; Jackson, S.; Pinto, L.R. Selection and validation of reference genes by RT-qPCR under photoperiodic induction of flowering in sugarcane (Saccharum spp.). Sci. Rep. 2021, 11, 4589. [Google Scholar] [CrossRef]
- Qi, S.A.; Yang, L.W.; Wen, X.H.; Hong, Y.; Song, X.B.; Zhang, M.M.; Dai, S.L. Reference gene selection for RT-qPCR analysis of flower development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front. Plant Sci. 2016, 7, 287. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.M.; Zhang, W.; Zhang, S.B. Selection and validation of reference genes for quantitative real-Time PCR analysis of development and tissue-dependent flower color formation in Cymbidium lowianum. Int. J. Mol. Sci. 2022, 23, 738. [Google Scholar] [CrossRef] [PubMed]
- Hou, T.; Yi, S.; Zhang, Z.; Wang, J.; Li, C. Selection and Validation of Reference Genes for RT-qPCR in Autumn Dendrobium. Acta Hortic. Sin. 2022, 49, 2489–2501. [Google Scholar]
- Kanakachari, M.; Solanke, A.U.; Prabhakaran, N.; Ahmad, I.; Dhandapani, G.; Jayabalan, N.; Kumar, P.A. Evaluation of suitable reference genes for normalization of qPCR gene expression studies in brinjal (Solanum melongena L.) during fruit developmental stages. Appl. Biochem. Biotechnol. 2016, 178, 433–450. [Google Scholar] [CrossRef]
- Qi, X.; Chen, S.; Feng, J.; Wang, H.; Deng, Y. Selection and validation of candidate reference genes for quantitative real-time PCR in Jasminum sambac Aiton. Acta Agric. Boreali-Sin. 2020, 35, 22–30. [Google Scholar]
- Feller, A.; Machemer, K.; Braun, E.L.; Grotewold, E. Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J. 2011, 66, 94–116. [Google Scholar] [CrossRef]
- Son, Y.E.; Cho, H.J.; Park, H.S. The MYB-like protein MylA contributes to conidiogenesis and conidial germination in Aspergillus nidulans. Commun. Biol. 2024, 7, 768. [Google Scholar] [CrossRef]
- Davies, K.M.; Albert, N.W.; Schwinn, K.E. From landing lights to mimicry: The molecular regulation of flower colouration and mechanisms for pigmentation patterning. Funct. Plant Biol. 2012, 39, 619–638. [Google Scholar] [CrossRef]
- Liao, H.-S.; Chen, Y.-J.; Hsieh, W.-Y.; Li, Y.-C.; Hsieh, M.-H. Arabidopsis ACT DOMAIN REPEAT9 represses glucose signaling pathways. Plant Physiol. 2023, 192, 1532–1547. [Google Scholar] [CrossRef]
- Li, H.; Li, Z.; Li, X.; Li, Y.H.; Lan, X.G. Selection of Reference Genes for Real-Time Quantitative PCR in Different Tissues and Stigma Development of Brassica oleracea. Plant Res. 2016, 36, 565–572. [Google Scholar]
- He, C.; Luo, C.; Yan, J.; Liu, W.; Wang, M.; Xie, D.; Wu, Z.; Jiang, B. Screening and Evaluation of Reference Genes for Real-time Quantitative PCR in Wax Gourd. Acta Hortic. Sin. 2024, 51, 748–760. [Google Scholar]
- Wang, F.; Li, P.; Liu, Q.; Nie, G.; Zhu, Y.; Zhang, X. Selection and Validation of Reference Genes inSudan Grass (Sorghum sudanense(Piper) Stapf) under Various Abiotic Stresses by qRT-PCR. Genes 2024, 15, 210. [Google Scholar] [CrossRef] [PubMed]
- Li, C.Q.; Hu, L.Z.; Wang, X.Q.; Liu, H.Z.; Tian, H.H.; Wang, J.S. Selection of reliable reference genes for gene expression analysis in seeds at different developmental stages and across various tissues in Paeonia ostii. Mol. Biol. Rep. 2019, 46, 6003–6011. [Google Scholar] [CrossRef] [PubMed]
- Narancio, R.; John, U.; Mason, J.; Spangenberg, G. Selection of optimal reference genes for quantitative RT-PCR transcript abundance analysis in white clover (Trifolium repens L.). Funct. Plant Biol. 2018, 45, 737–744. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.L.; Wang, Q.; Li, Y.; Gao, L.L.; Lv, F.N.; Yang, R.T.; Wang, P. Candidate reference genes for quantitative gene expression analysis in Lagerstroemia indica. Mol. Biol. Rep. 2021, 48, 1677–1685. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Cui, H.L.; Ji, X.J.; Xue, J.A.; Jia, X.Y.; Li, R.Z. Selection of the optional reference genes for transcript expression analysis of lipid biosynthesis–related genes in Okra (Abelmoschus esculentus). Sci. Hortic. 2021, 282, 110044. [Google Scholar] [CrossRef]
- Liu, X.; Cheng, L.; Guo, Q. Selection and Validation of Reference Genes for qRT-PCR in Chenopodium under PA-2 Strain Stress. Chin. J. Grassl. 2024, 46, 48–56. [Google Scholar]
- Xiao, C.; Yan, J.; Long, G.; Dai, D.S.; Li, L.D.; Deng, D.Z. Stability evaluation of reference genes in citrus. Acta Hortic. Sin. 2012, 29, 978–984. [Google Scholar]
- Lovdal, T.; Lillo, C. Reference gene selection for quantitative real-time PCR normalization in tomato subjected to nitrogen, cold, and light stress. Anal. Biochem. 2009, 387, 238–242. [Google Scholar] [CrossRef]
- Zhang, S.; Zhang, A.; Wu, X.; Zhu, Z.; Yang, Z.; Zhu, Y.; Zha, D. Transcriptome analysis revealed expression of genes related to anthocyanin biosynthesis in eggplant (Solanum melongena L.) under high-temperature stress. BMC Plant Biol. 2019, 19, 387. [Google Scholar] [CrossRef]
Gene ID | Primer Sequence (5′–3′) | Primer Sequence (3′–5′) | Amplicon Length/bp | Tem/°C | Blast Result | Gene |
---|---|---|---|---|---|---|
evm.model.tig36.167 | GCTATGCTCGATGAGCCACT | GTTCTTTCCTCGCCAAGTGC | 131 | 59.9 °C 59.7 °C | Protein phosphatase 2A | PP2A |
evm.model.tig46.401 | TGGCACAGGATCTGGATTGG | TTATACGGCTCCACGACTGC | 129 | 59.7 °C 59.9 °C | β-tubulin1 | TUB |
evm.model.tig135.74 | CTCCTGCTGGCATTAGTGGT | CTCGGTGAATTGCAGCGTC | 125 | 59.7 °C 59.5 °C | Ubiquitin1 | UBQ1 |
evm.model.tig38.70 | AGCACGGAGCTCTTGATTCG | AAGCTAGCACAGCGTGACTC | 106 | 60.4 °C 60.3 °C | Histone superfamily protein | HIS |
evm.model.tig130.179 | AGTGGACCAGGCAATCCTTG | GCAACTGAAGCCAGCACTTC | 108 | 59.9 °C 60.0 °C | Ubiquitin1 | UBQ2 |
evm.model.tig64.104 | CCGTGCTTTCCCTTTATGCC | TGTGGGAGTGCATAGCCTTC | 106 | 59.5 °C 59.7 °C | Actin1 | ACT |
evm.model.tig65.234 | GAACCACCCTGGACAGATCG | AAGCTCCTTTCCAGATCGCC | 121 | 60.1 °C 60.1 °C | Elongation factor 1-α | EF1-α1 |
evm.model.tig13.434 | CTGTTGAGGATGTGCCCTGT | GGATGGGCATCAACCTCCTT | 106 | 59.9 °C 59.7 °C | Elongation factor 1-α | EF1-α2 |
evm.model.tig14.338 | GAGGTAGAGAGCAGCGACAC | TCCGACCATCTTCCAACTGC | 118 | 59.9 °C 60.0 °C | Ubiquitin1 | UBQ3 |
Gene ID | Gene Name | Primer Sequence (5′–3′) | Primer Sequence (3′–5′) | Amplicon Product Length (bp) |
---|---|---|---|---|
evm.model.tig63.29 | LdMYB1 | GGGAGTGAACGAGACGGTTC | AGCTTGGAATGCCCGATCTC | 135 |
evm.model.tig37.173 | LdMYB2 | GCAGCTCGTGGAAGAGTTTG | AATGGCCGCCTCTTGATTCT | 129 |
evm.model.tig23.210 | LdMYB3 | TGCTTCCAAGCTCAAGCTCC | TAGGGGAAGAATCGGTGGGT | 149 |
evm.model.tig6.584 | LdMYB4 | AGATCAGGGAAGAGTTGCCG | AAAGAGGCGAGCGATCACAG | 147 |
Gene | Amplification Efficiency (%) | Correlation Coefficient (R2) | Slope (K) |
---|---|---|---|
EF1-α1 | 108.41 | 0.995 | −3.135 |
ACT | 109.21 | 0.994 | −3.119 |
HIS | 98.29 | 0.997 | −3.363 |
TUB | 95.58 | 0.992 | −3.432 |
EF1-α2 | 90.21 | 0.994 | −3.581 |
PP2A | 97.37 | 0.996 | −3.386 |
UBQ1 | 101.67 | 0.989 | −3.282 |
UBQ3 | 95.31 | 0.981 | −3.439 |
UBQ2 | 93.68 | 0.999 | −3.483 |
Ranking | Gene Name | Stability M Value |
---|---|---|
1 | ACT/HIS | 0.545 |
2 | EF1-α1 | 0.632 |
3 | TUB | 0.773 |
4 | EF1-α2 | 0.888 |
5 | UBQ1 | 0.963 |
6 | PP2A | 1.084 |
7 | UBQ3 | 1.243 |
8 | UBQ2 | 1.341 |
Ranking | Gene Name | Stability Value |
---|---|---|
1 | EF1-α1 | 0.506 |
2 | ACT | 0.592 |
3 | HIS | 0.7 |
4 | TUB | 0.749 |
5 | EF1-α2 | 0.938 |
6 | PP2A | 1.098 |
7 | UBQ1 | 1.134 |
8 | UBQ3 | 1.332 |
9 | UBQ2 | 1.459 |
Ranking | Gene Name | SD | CV |
---|---|---|---|
1 | PP2A | 0.36 | 1.53 |
2 | UBQ3 | 0.82 | 3.75 |
3 | ACT | 0.85 | 4.26 |
4 | EF1-α1 | 0.93 | 4.80 |
5 | TUB | 0.94 | 4.00 |
6 | UBQ2 | 0.99 | 4.57 |
7 | HIS | 1.15 | 5.11 |
8 | EF1-α2 | 1.20 | 5.71 |
9 | UBQ1 | 1.55 | 7.34 |
Ranking | Gene Name | Stability Value |
---|---|---|
1 | EF1-α2 | 1.09 |
2 | ACT | 1.12 |
3 | HIS | 1.15 |
4 | TUB | 1.22 |
5 | EF1-α2 | 1.32 |
6 | UBQ1 | 1.43 |
7 | PP2A | 1.44 |
8 | UBQ3 | 1.60 |
9 | UBQ2 | 1.69 |
Ranking | Gene Name | Geometric Mean Value |
---|---|---|
1 | ACT | 1.86 |
2 | EF1-α1 | 1.86 |
3 | HIS | 2.82 |
4 | PP2A | 4.14 |
5 | TUB | 4.23 |
6 | EF1-α2 | 5.62 |
7 | UBQ3 | 5.66 |
8 | UBQ1 | 6.90 |
9 | UBQ2 | 8.13 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, R.; He, W.; Zhu, W.-T.; Zhao, X.; Chen, C.; Wu, Y.; Wu, S.; Zhai, J.-W.; Liu, Z.-J. Selection of Reference Genes of Flower Development in Ludisia discolor. Genes 2024, 15, 1225. https://doi.org/10.3390/genes15091225
Gao R, He W, Zhu W-T, Zhao X, Chen C, Wu Y, Wu S, Zhai J-W, Liu Z-J. Selection of Reference Genes of Flower Development in Ludisia discolor. Genes. 2024; 15(9):1225. https://doi.org/10.3390/genes15091225
Chicago/Turabian StyleGao, Rui, Wenyan He, Wen-Tao Zhu, Xuewei Zhao, Chen Chen, You Wu, Shasha Wu, Jun-Wen Zhai, and Zhong-Jian Liu. 2024. "Selection of Reference Genes of Flower Development in Ludisia discolor" Genes 15, no. 9: 1225. https://doi.org/10.3390/genes15091225
APA StyleGao, R., He, W., Zhu, W.-T., Zhao, X., Chen, C., Wu, Y., Wu, S., Zhai, J.-W., & Liu, Z.-J. (2024). Selection of Reference Genes of Flower Development in Ludisia discolor. Genes, 15(9), 1225. https://doi.org/10.3390/genes15091225