Canine Histiocytic and Hemophagocytic Histiocytic Sarcomas Display KRAS and Extensive PTPN11/SHP2 Mutations and Respond In Vitro to MEK Inhibition by Cobimetinib
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Use Statement
2.2. Histiocytic Sarcoma (HS) Samples
2.3. Hemophagocytic Histiocytic Sarcoma (HHS) Samples
2.4. Cell Lines
2.5. Genomic DNA Extraction
2.6. Genotyping using the TaqMan Custom SNP Genotyping Assay
2.7. Genotyping by Sanger Sequencing
2.8. Determination of IC50 Values
2.9. Analysis of Amino Acid Substitution Effects
2.10. Statistical Methods
3. Results
3.1. PTPN11/SHP2 and KRAS Mutational Status in HS Cases
3.2. PTPN11/SHP2 and KRAS Mutational Status in HHS Cases
3.3. Age and Sex Status in HS and HHS Cases
3.4. Cobimetinib Inhibits HS and HHS Cell Growth
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Boerkamp, K.M.; van der Kooij, M.; van Steenbeek, F.G.; van Wolferen, M.E.; Groot Koerkamp, M.J.; van Leenen, D.; Grinwis, G.C.M.; Penning, L.C.; Wiemer, E.A.C.; Rutteman, G.R. Gene expression profiling of histiocytic sarcomas in a canine model: The predisposed flatcoated retriever dog. PLoS ONE 2013, 8, e71094. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Dobson, J.; Hoather, T.; McKinley, T.J.; Wood, J.L. Mortality in a cohort of flat-coated retrievers in the UK. Vet. Comp. Oncol. 2009, 7, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Abadie, J.; Hedan, B.; Cadieu, E.; De Brito, C.; Devauchelle, P.; Bourgain, C.; Parker, H.G.; Vaysse, A.; Margaritte-Jeannin, P.; Galibert, F.; et al. Epidemiology, pathology, and genetics of histiocytic sarcoma in the Bernese mountain dog breed. J. Hered. 2009, 100 (Suppl. S1), S19–S27. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Moore, P.F. A review of histiocytic diseases of dogs and cats. Vet. Pathol. 2014, 51, 167–184. [Google Scholar] [CrossRef] [PubMed]
- Shearin, A.L.; Hedan, B.; Cadieu, E.; Erich, S.A.; Schmidt, E.V.; Faden, D.L.; Cullen, J.; Abadie, J.; Kwon, E.M.; Gröne, A.; et al. The MTAP-CDKN2A locus confers susceptibility to a naturally occurring canine cancer. Cancer Epidemiol. Biomark. Prev. 2012, 21, 1019–1027. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Evans, J.M.; Parker, H.G.; Rutteman, G.R.; Plassais, J.; Grinwis, G.C.M.; Harris, A.C.; Lana, S.E.; Ostrander, E.A. Multi-omics approach identifies germline regulatory variants associated with hematopoietic malignancies in retriever dog breeds. PLoS Genet. 2021, 17, e1009543. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Shanmugam, V.; Griffin, G.K.; Jacobsen, E.D.; Fletcher, C.D.M.; Sholl, L.M.; Hornick, J.L. Identification of diverse activating mutations of the RAS-MAPK pathway in histiocytic sarcoma. Mod. Pathol. 2019, 32, 830–843. [Google Scholar] [CrossRef] [PubMed]
- Bahar, M.E.; Kim, H.J.; Kim, D.R. Targeting the RAS/RAF/MAPK pathway for cancer therapy: From mechanism to clinical studies. Signal Transduct. Target. Ther. 2023, 8, 455. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Thaiwong, T.; Sirivisoot, S.; Takada, M.; Yuzbasiyan-Gurkan, V.; Kiupel, M. Gain-of-function mutation in PTPN11 in histiocytic sarcomas of Bernese Mountain Dogs. Vet. Comp. Oncol. 2018, 16, 220–228. [Google Scholar] [CrossRef] [PubMed]
- Takada, M.; Smyth, L.A.; Thaiwong, T.; Richter, M.; Corner, S.M.; Schall, P.Z.; Kiupel, M.; Yuzbasiyan-Gurkan, V. Activating Mutations in PTPN11 and KRAS in Canine Histiocytic Sarcomas. Genes 2019, 10, 505. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Aaroe, A.; Kurzrock, R.; Goyal, G.; Goodman, A.M.; Patel, H.; Ruan, G.; Ulaner, G.; Young, J.R.; Li, Z.; Dustin, D.; et al. Successful treatment of non-Langerhans cell histiocytosis with the MEK inhibitor trametinib: A multicenter analysis. Blood Adv. 2023, 7, 3984–3992. [Google Scholar] [CrossRef] [PubMed]
- Takada, M.; Hix, J.M.L.; Corner, S.; Schall, P.Z.; Kiupel, M.; Yuzbasiyan-Gurkan, V. Targeting MEK in a Translational Model of Histiocytic Sarcoma. Mol. Cancer Ther. 2018, 17, 2439–2450. [Google Scholar] [CrossRef] [PubMed]
- Takada, M.; Smyth, L.A.; Hix, J.M.; Corner, S.M.; O’Reilly, S.; Kiupel, M.; Yuzbasiyan-Gurkan, V. Development of an Orthotopic Intrasplenic Xenograft Mouse Model of Canine Histiocytic Sarcoma and Its Use in Evaluating the Efficacy of Treatment with Dasatinib. Comp. Med. 2019, 69, 22–28. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Takada, M.; Kitagawa, K.; Zhang, Y.; Bulitta, J.B.; Moirano, S.; Jones, A.; Borgen, J.; Onsager, A.; Thaiwong, T.; Vail, D.M. Population Pharmacokinetics, Pharmacodynamics and Safety Properties of Trametinib in Dogs With Cancer: A Phase I Dose Escalating Clinical Trial. Vet. Comp. Oncol. 2024. ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Hedan, B.; Rault, M.; Abadie, J.; Ulve, R.; Botherel, N.; Devauchelle, P.; Copie-Bergman, C.; Cadieu, E.; Parrens, M.; Alten, J.; et al. PTPN11 mutations in canine and human disseminated histiocytic sarcoma. Int. J. Cancer 2020, 147, 1657–1665. [Google Scholar] [CrossRef] [PubMed]
- Tani, H.; Kurita, S.; Miyamoto, R.; Ochiai, K.; Tamura, K.; Bonkobara, M. Canine histiocytic sarcoma cell lines with SHP2 p.Glu76Gln or p.Glu76Ala mutations are sensitive to allosteric SHP2 inhibitor SHP099. Vet. Comp. Oncol. 2020, 18, 161–168. [Google Scholar] [CrossRef] [PubMed]
- U.S. Food and Drug Administration (FDA). 2015. Available online: https://www.accessdata.fda.gov/drugsatfda_docs/nda/2015/206192Orig1s000PharmR.pdf (accessed on 1 July 2024).
- Rosen, L.S.; LoRusso, P.; Ma, W.W.; Goldman, J.W.; Weise, A.; Colevas, A.D.; Adjei, A.; Yazji, S.; Shen, A.; Johnston, S.; et al. A first-in-human phase I study to evaluate the MEK1/2 inhibitor, cobimetinib, administered daily in patients with advanced solid tumors. Investig. New Drugs 2016, 34, 604–613. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Ram, T.; Singh, A.K.; Kumar, A.; Singh, H.; Pathak, P.; Grishina, M.; Khalilullah, H.; Jaremko, M.; Emwas, A.-H.; Verma, A.; et al. MEK inhibitors in cancer treatment: Structural insights, regulation, recent advances and future perspectives. RSC Med. Chem. 2023, 14, 1837–1857. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Signorelli, J.; Shah Gandhi, A. Cobimetinib. Ann. Pharmacother. 2017, 51, 146–153. [Google Scholar] [CrossRef] [PubMed]
- Takada, M.; Parys, M.; Gregory-Bryson, E.; Vilar Saavedra, P.; Kiupel, M.; Yuzbasiyan-Gurkan, V. A novel canine histiocytic sarcoma cell line: Initial characterization and utilization for drug screening studies. BMC Cancer 2018, 18, 237. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Cheng, J.; Novati, G.; Pan, J.; Bycroft, C.; Zemgulyte, A.; Applebaum, T.; Pritzel, A.; Wong, L.H.; Zielinski, M.; Sargeant, T.; et al. Accurate proteome-wide missense variant effect prediction with AlphaMissense. Science 2023, 381, eadg7492. [Google Scholar] [CrossRef] [PubMed]
- Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A method and server for predicting damaging missense mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Robinson, J.T.; Thorvaldsdottir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011, 29, 24–26. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Chen, X.; Keller, S.J.; Hafner, P.; Alrawashdeh, A.Y.; Avery, T.Y.; Norona, J.; Zhou, J.; Ruess, D.A. Tyrosine phosphatase PTPN11/SHP2 in solid tumors—Bull’s eye for targeted therapy? Front. Immunol. 2024, 15, 1340726. [Google Scholar] [CrossRef] [PubMed]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Varadi, M.; Bertoni, D.; Magana, P.; Paramval, U.; Pidruchna, I.; Radhakrishnan, M.; Tsenkov, M.; Nair, S.; Mirdita, M.; Yeo, J.; et al. AlphaFold Protein Structure Database in 2024: Providing structure coverage for over 214 million protein sequences. Nucleic Acids Res. 2024, 52, D368–D375. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Meng, E.C.; Couch, G.S.; Croll, T.I.; Morris, J.H.; Ferrin, T.E. UCSF ChimeraX: Structure visualization for researchers, educators, and developers. Protein Sci. 2021, 30, 70–82. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Takahashi, R.H.; Ma, S.; Yue, Q.; Kim-Kang, H.; Yi, Y.; Ly, J.; Boggs, J.W.; Fettes, A.; McClory, A.; Deng, Y.; et al. Absorption, metabolism and excretion of cobimetinib, an oral MEK inhibitor, in rats and dogs. Xenobiotica 2017, 47, 50–65. [Google Scholar] [CrossRef] [PubMed]
- Hof, P.; Pluskey, S.; Dhe-Paganon, S.; Eck, M.J.; Shoelson, S.E. Crystal structure of the tyrosine phosphatase SHP-2. Cell 1998, 92, 441–450. [Google Scholar] [CrossRef] [PubMed]
- Bentires-Alj, M.; Paez, J.G.; David, F.S.; Keilhack, H.; Halmos, B.; Naoki, K.; Maris, J.M.; Richardson, A.; Bardelli, A.; Sugarbaker, D.J.; et al. Activating mutations of the noonan syndrome-associated SHP2/PTPN11 gene in human solid tumors and adult acute myelogenous leukemia. Cancer Res. 2004, 64, 8816–8820. [Google Scholar] [CrossRef] [PubMed]
- Prouteau, A.; Denis, J.A.; De Fornel, P.; Cadieu, E.; Derrien, T.; Kergal, C.; Botherel, N.; Ulvé, R.; Rault, M.; Bouzidi, A.; et al. Circulating tumor DNA is detectable in canine histiocytic sarcoma, oral malignant melanoma, and multicentric lymphoma. Sci. Rep. 2021, 11, 877. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Diamond, E.L.; Durham, B.H.; Ulaner, G.A.; Drill, E.; Buthorn, J.; Ki, M.; Bitner, L.; Cho, H.; Young, R.J.; Francis, J.H.; et al. Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature 2019, 567, 521–524. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Jacobsen, E.; Shanmugam, V.; Jagannathan, J. Rosai-Dorfman Disease with Activating KRAS Mutation—Response to Cobimetinib. N. Engl. J. Med. 2017, 377, 2398–2399. [Google Scholar] [CrossRef] [PubMed]
- Dobson, J.; Villiers, E.; Roulois, A.; Gould, S.; Mellor, P.; Hoather, T.; Watson, P. Histiocytic sarcoma of the spleen in flat-coated retrievers with regenerative anaemia and hypoproteinaemia. Vet. Rec. 2006, 158, 825–829. [Google Scholar] [CrossRef] [PubMed]
- Moore, P.F.; Affolter, V.K.; Vernau, W. Canine hemophagocytic histiocytic sarcoma: A proliferative disorder of CD11d+ macrophages. Vet. Pathol. 2006, 43, 632–645. [Google Scholar] [CrossRef] [PubMed]
- Soare, T.; Noble, P.J.; Hetzel, U.; Fonfara, S.; Kipar, A. Paraneoplastic syndrome in haemophagocytic histiocytic sarcoma in a dog. J. Comp. Pathol. 2012, 146, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Elliott, J. Lomustine chemotherapy for the treatment of presumptive haemophagocytic histiocytic sarcoma in Flat-coated Retrievers. Aust. Vet. J. 2018, 96, 502–507. [Google Scholar] [CrossRef] [PubMed]
- Kerboeuf, M.; Brun-Hansen, H.; Oscarson, M.; Sjetne Lund, H. Case report: Haemophagocytic histiocytic sarcoma in an english setter. Vet. Med. Sci. 2021, 7, 1154–1158. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Clarke, L.L.; Kelly, L.S.; Garner, B.; Brown, C.A. Atypical cytologic presentation of a histiocytic sarcoma in a Cavalier King Charles Spaniel dog. J. Vet. Diagn. Investig. 2017, 29, 541–543. [Google Scholar] [CrossRef] [PubMed]
- Soileau, A.M.; Neto, R.; Jimenez, P.T.; Hamersky, J.; Smith, A.A. Doxorubicin and zoledronate treatment in a dog with hemophagocytic histiocytic sarcoma. Can. Vet. J. 2023, 64, 1103–1108. [Google Scholar] [PubMed] [PubMed Central]
- Montalvo, N.; Lara-Endara, J.; Redroban, L.; Leiva, M.; Armijos, C.; Russo, L. Primary splenic histiocytic sarcoma associated with hemophagocytic lymphohistiocytosis: A case report and review of literature of next-generation sequencing involving FLT3, NOTCH2, and KMT2A mutations. Cancer Rep. (Hoboken) 2022, 5, e1496. [Google Scholar] [CrossRef] [PubMed]
- Audouin, J.; Vercelli-Retta, J.; Le Tourneau, A.; Adida, C.; Camilleri-Broet, S.; Molina, T.; Diebold, J. Primary histiocytic sarcoma of the spleen associated with erythrophagocytic histiocytosis. Pathol. Res. Pract. 2003, 199, 107–112. [Google Scholar] [CrossRef] [PubMed]
- Heinrich, F.; Contioso, V.B.; Stein, V.M.; Carlson, R.; Tipold, A.; Ulrich, R.; Puff, C.; Baumgärtner, W.; Spitzbarth, I. Passage-dependent morphological and phenotypical changes of a canine histiocytic sarcoma cell line (DH82 cells). Vet. Immunol. Immunopathol. 2015, 163, 86–92. [Google Scholar] [CrossRef] [PubMed]
- Wellman, M.L.; Krakowka, S.; Jacobs, R.M.; Kociba, G.J. A macrophage-monocyte cell line from a dog with malignant histiocytosis. In Vitro Cell Dev. Biol. 1988, 24, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Reiner, A.S.; Durham, B.H.; Yabe, M.; Petrova-Drus, K.; Francis, J.H.; Rampal, R.K.; Lacouture, M.E.; Rotemberg, V.; Abdel-Wahab, O.; Panageas, K.S.; et al. Outcomes after interruption of targeted therapy in patients with histiocytic neoplasms. Br. J. Haematol. 2023, 203, 389–394. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Diamond, E.L.; Durham, B.; Dogan, A.; Yabe, M.; Petrova-Drus, K.; Rampal, R.K.; Ulaner, G.; Lacouture, M.; Rotemberg, V.; Covey, A.; et al. Phase 2 Trial of Single-Agent Cobimetinib for Adults with Histiocytic Neoplasms. Blood 2023, 142 (Suppl. S1), 1812. [Google Scholar] [CrossRef]



| Gene (Protein) Name | Mutation | Assay ID | Genomic Coordinates of Mutations * | Location in cDNA |
|---|---|---|---|---|
| PTPN11 (SHP2) | E76K | ANT2AD7 (Lot P180405-000 B02) | Chr26: 10,340,007 | c.440G>A (XM_038575149.1) |
| G503V | ANDJ2M3 (Lot P180403-001 E05) | Chr26: 10,377,939 | c.1,508G>T (XM_038575149.1) | |
| KRAS | Q61H | AN47YG4 (Lot P180307-008 A08) | Chr27: 24,263,793 | c.183A>C (XM_038577089.1) |
| Gene Name | Forward Primer Sequence (5′ -> 3′) | Reverse Primer Sequence (5′ -> 3′) | Amplicon Size | Amplicon Coordinates * |
|---|---|---|---|---|
| PTPN11 (exon 3) | GGAAAGGAGCCAGGCAACAA | TGGCATGGAAGAGGTGCATT | 395 bp | chr26: 10339752+10340146 |
| KRAS (exon 2) | AAAGGTGTTGATAGAGTGGGT | AGCCAATGGAACCCAAGTACA | 380 bp | chr27: 24279858-24280237 |
| Frequency of All Mutations in PTPN11/SHP2 | 55.8% (72/129) | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Frequency of PTPN11/SHP2 Mutations in 2 Exons | Exon 3 47.3% (61/129) | Exon 13 8.5% (11/129) | |||||||
| PTPN11/SHP2 Mutations | G60V | D61V | E69K | E76A | E76G | E76K | E76Q | A72T | G503V |
| Number of dogs | 2 | 1 | 4 | 4 | 3 | 44 | 1 | 2 | 11 |
| Frequency in 129 HS cases (current study) | 1.6% | 0.8% | 3.1% | 3.1% | 2.3% | 34.1% | 0.8% | 1.6% | 8.5% |
| Status: New or previously reported [reference] (species) | [15] (dog) | New | [15] (human) | [16] (dog) | [15] (dog) | [9] (dog) | [16] (dog) | New | [10] (dog) |
| Reported in human cancers: (per cBioportal) | yes | no | yes | yes | no | yes | no | yes | yes |
| Amino Acid Substitution Effects: | |||||||||
| AlphaMissense (human) | 1.000 | 0.999 | 0.998 | 0.998 | 0.997 | 1.000 | 0.997 | 0.998 | 1.000 |
| PolyPhen2 (dog protein) | 1.000 | 0.997 | 0.012 | 0.999 | 1.000 | 0.997 | 0.997 | 0.967 | 1.000 |
| Frequency of All Mutations in PTPN11/SHP2 | Total Percentage: 46.2% (12/26 dogs) | ||||
|---|---|---|---|---|---|
| Frequency of PTPN11/SHP2 Mutations in 2 Exons | Exon 3 Frequency: 26.9% (7/26) | Exon 13 Frequency: 19.2% (5/26) | |||
| PTPN11/SHP2 Mutations | E69K | A72V | E76K | E76V | G503V |
| Number of dogs | 1 | 1 | 4 | 1 | 5 |
| Frequency in 26 HHS cases | 3.8% | 3.8% | 15.4% | 3.8% | 19.2% |
| [reference] (species) | [15] (human) | New variant | [9] (dog) | New variant | [10] (dog) |
| Reported in human cancers: (per cBioportal) | yes | yes | yes | no | yes |
| Amino Acid Substitution Effects: | |||||
| AlphaMissense (human) | 0.998 | 0.999 | 1.000 | 1.000 | 1.000 |
| PolyPhen2 (dog protein) | 0.012 | 0.962 | 0.997 | 0.998 | 1.000 |
| Groups | N | Avg Age | PTPN11/SHP2 Mutant | E76K | G503V | Other Variants |
|---|---|---|---|---|---|---|
| HS BMD | 129 | 8.4 | 72 (56%) | 44 (34%) | 11 (9%) | 17 (13%) |
| HHS all cases | 26 | 7.7 | 12 (46%) | 4 (15%) | 5 (19%) | 3 (12%) |
| HHS BMD | 14 | 6.6 | 9 (64%) | 4 (29%) | 4 (29%) | 1 (7%) |
| HHS other breeds | 12 | 8.9 | 3 (25%) | 0 | 1 (8%) | 2 (17%) |
| Groups | N | KRAS Mutant | Q61H | G12A | G12D |
|---|---|---|---|---|---|
| HS BMD | 129 | 4 (3%) | 3 (2%) | 1 (0.8%) | 0 |
| HHS all cases | 26 | 1 (4%) | 0 | 0 | 1 (4%) |
| HHS BMD | 14 | 1 (7%) | 0 | 0 | 1 (7%) |
| HHS other breeds | 12 | 0 | 0 | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.-T.; Engleberg, A.I.; Kapoor, I.; Kitagawa, K.; Hilburger, S.A.; Thaiwong-Nebelung, T.; Yuzbasiyan-Gurkan, V. Canine Histiocytic and Hemophagocytic Histiocytic Sarcomas Display KRAS and Extensive PTPN11/SHP2 Mutations and Respond In Vitro to MEK Inhibition by Cobimetinib. Genes 2024, 15, 1050. https://doi.org/10.3390/genes15081050
Yang Y-T, Engleberg AI, Kapoor I, Kitagawa K, Hilburger SA, Thaiwong-Nebelung T, Yuzbasiyan-Gurkan V. Canine Histiocytic and Hemophagocytic Histiocytic Sarcomas Display KRAS and Extensive PTPN11/SHP2 Mutations and Respond In Vitro to MEK Inhibition by Cobimetinib. Genes. 2024; 15(8):1050. https://doi.org/10.3390/genes15081050
Chicago/Turabian StyleYang, Ya-Ting, Alexander I. Engleberg, Ishana Kapoor, Keita Kitagawa, Sara A. Hilburger, Tuddow Thaiwong-Nebelung, and Vilma Yuzbasiyan-Gurkan. 2024. "Canine Histiocytic and Hemophagocytic Histiocytic Sarcomas Display KRAS and Extensive PTPN11/SHP2 Mutations and Respond In Vitro to MEK Inhibition by Cobimetinib" Genes 15, no. 8: 1050. https://doi.org/10.3390/genes15081050
APA StyleYang, Y.-T., Engleberg, A. I., Kapoor, I., Kitagawa, K., Hilburger, S. A., Thaiwong-Nebelung, T., & Yuzbasiyan-Gurkan, V. (2024). Canine Histiocytic and Hemophagocytic Histiocytic Sarcomas Display KRAS and Extensive PTPN11/SHP2 Mutations and Respond In Vitro to MEK Inhibition by Cobimetinib. Genes, 15(8), 1050. https://doi.org/10.3390/genes15081050

