Genome-Wide Association Studies of Embryogenic Callus Induction Rate in Peanut (Arachis hypogaea L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Embryogenic Callus Induction
2.3. Phenotypic Identification and Statistics
2.4. Genome-Wide Association Study
3. Results
3.1. Callus Formation
3.2. Genome-Wide Association Study and SNP Detection
3.3. Analysis of Candidate Genes for SNP Loci Associated with CIR in Peanut
4. Discussion
4.1. Induction of Callus from 353 Peanut Genotypes
4.2. GWAS Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ojiewo, C.O.; Janila, P.; Bhatnagar-Mathur, P.; Pandey, M.K.; Desmae, H.; Okori, P.; Mwololo, J.; Ajeigbe, H.; Njuguna-Mungai, E.; Muricho, G.; et al. Advances in Crop Improvement and Delivery Research for Nutritional Quality and Health Benefits of Groundnut (Arachis hypogaea L.). Front. Plant Sci. 2020, 11, 29. [Google Scholar] [CrossRef]
- Toomer, O.T. Nutritional chemistry of the peanut (Arachis hypogaea). Crit. Rev. Food Sci. Nutr. 2018, 58, 3042–3053. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.; Jeon, H.; Kim, M. Optimization of a mature embryo-based in vitro culture system for high-frequency somatic embryogenic callus induction and plant regeneration from japonica rice cultivars. Plant Cell Tissue Organ Cult. 2002, 71, 237–244. [Google Scholar] [CrossRef]
- Rao, A.Q.; Bakhsh, A.; Kiani, S.; Shahzad, K.; Shahid, A.A.; Husnain, T.; Riazuddin, S. RETRACTED: The myth of plant transformation. Biotechnol. Adv. 2019, 37, 827. [Google Scholar] [CrossRef]
- Steward, F.C.; Mapes, M.O.; Mears, K. Growth and organized development of cultured cells. II. Organization in cultures grown from freely suspended cells. Am. J. Bot. 1958, 45, 705–708. [Google Scholar] [CrossRef]
- Dale, P.J.; Deambrogio, E. A Comparison of Callus Induction and Plant Regeneration from Different Explants of Hordeum vulgare. Z. Pflanzenphysiol. 1979, 94, 65–77. [Google Scholar] [CrossRef]
- Ikeuchi, M.; Favero, D.S.; Sakamoto, Y.; Iwase, A.; Coleman, D.; Rymen, B.; Sugimoto, K. Molecular Mechanisms of Plant Regeneration. Annu. Rev. Plant Biol. 2019, 70, 377–406. [Google Scholar] [CrossRef]
- Fan, M.; Xu, C.; Xu, K.; Hu, Y. LATERAL ORGAN BOUNDARIES DOMAIN transcription factors direct callus formation in Arabidopsis regeneration. Cell Res. 2012, 22, 1169–1180. [Google Scholar] [CrossRef]
- Atta, R.; Laurens, L.; Boucheron-Dubuisson, E.; Guivarc’H, A.; Chriqui, D. Pluripotency of Arabidopsis xylem pericycle underlies shoot regeneration from root and hypocotyl explants grown in vitro. Plant J. 2008, 57, 626–644. [Google Scholar] [CrossRef]
- Sugimoto, K.; Jiao, Y.; Meyerowitz, E.M. Arabidopsis regeneration from multiple tissues occurs via a root development pathway. Dev. Cell 2010, 18, 463–471. [Google Scholar] [CrossRef]
- Che, P.; Lall, S.; Howell, N.S.H. Gene Expression Programs during Shoot, Root, and Callus Development in Arabidopsis Tissue Culture. Plant Physiol. 2006, 141, 620–637. [Google Scholar] [CrossRef]
- Iwase, A.; Mitsuda, N.; Koyama, T.; Hiratsu, K.; Kojima, M.; Arai, T.; Inoue, Y.; Seki, M.; Sakakibara, H.; Sugimoto, K.; et al. The AP2/ERF transcription factor WIND1 controls cell dedifferentiation in Arabidopsis. Curr. Biol. 2011, 21, 508–514. [Google Scholar] [CrossRef]
- Iwase, A.; Harashima, H.; Ikeuchi, M.; Rymen, B.; Sugimoto, K. WIND1 promotes shoot regeneration through transcriptional activation of ENHANCER OF SHOOT REGENERATION1 in Arabidopsis. Plant Cell 2016, 29, 54–69. [Google Scholar] [CrossRef]
- Reisch, B.; Bingham, E.T. The genetic control of bud formation from callus cultures of diploid alfalfa. Plant Sci. Lett. 1980, 20, 71–77. [Google Scholar] [CrossRef]
- Lin, Z.; Hattori, K. Inheritance of High Shoot Regeneration Ability from Seed Callus in a Rice Cultivar Joshu. Jpn. J. Breed. 1998, 48, 41–44. [Google Scholar] [CrossRef]
- Schiantarelli, E.; Pea, A.D.L.; Candela, M. Use of recombinant inbred lines (RILs) to identify, locate and map major genes and quantitative trait loci involved with in vitro regeneration ability in Arabidopsis thaliana. Theor. Appl. Genet. 2001, 102, 335–341. [Google Scholar] [CrossRef]
- Taguchi-Shiobara, F.; Yamamoto, T.; Yano, M.; Oka, S. Mapping QTLs that control the performance of rice tissue culture and evaluation of derived near-isogenic lines. Theor. Appl. Genet. 2006, 112, 968–976. [Google Scholar] [CrossRef] [PubMed]
- Paterson, A.H. Molecular dissection of quantitative traits: Progress and prospects. Genome Res. 1995, 5, 321–333. [Google Scholar] [CrossRef]
- Zhao, L.; Zhou, H.; Lu, L.; Liu, L.; Li, X.; Lin, Y.; Yu, S. Identification of quantitative trait loci controlling rice mature seed culturability using chromosomal segment substitution lines. Plant Cell Rep. 2009, 28, 247–256. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Su, Z.; Guo, Y.; Zhang, S.; Jiang, L.; Wu, R. Genome-wide association studies of callus differentiation for the desert tree, Populus euphratica. Tree Physiol. 2020, 40, 1762–1777. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Zhao, T.; Yu, D.; Gai, J. Mapping QTLs for tissue culture response in soybean (Glycine max (L.) Merr.). Mol. Cells 2011, 32, 337–342. [Google Scholar] [CrossRef]
- Dai, L.; Han, S.; Zhang, Y.; Hao, D. Genetic architecture of embryogenic callus induction in maize from the perspective of population genomics. Plant Cell Tissue Organ Cult. 2022, 150, 345–359. [Google Scholar] [CrossRef]
- Ma, J.; Deng, M.; Lv, S.-Y.; Yang, Q.; Jiang, Q.-T.; Qi, P.-F.; Li, W.; Chen, G.-Y.; Lan, X.-J.; Wei, Y.-M. Identification of QTLs associated with tissue culture response of mature wheat embryos. SpringerPlus 2016, 5, 1552. [Google Scholar] [CrossRef]
- Varshney, R.K.; Nayak, S.N.; May, G.D.; Jackson, S.A. Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol. 2009, 27, 522–530. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zheng, Z.; Sun, Z.; Qi, F.; Wang, J.; Wang, M.; Dong, W.; Cui, K.; Zhao, M.; Wang, X.; et al. Identification of two major QTLs for pod shell thickness in peanut (Arachis hypogaea L.) using BSA-seq analysis. BMC Genom. 2024, 25, 65. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Z.; Sun, Z.; Qi, F.; Fang, Y.; Lin, K.; Pavan, S.; Huang, B.; Dong, W.; Du, P.; Tian, M.; et al. DNA sequencing sheds light on the evolutionary history of peanut and identifies genes associated with phenotypic diversification. Preprint 2022. [Google Scholar] [CrossRef]
- Chu, Y.; Deng, X.Y.; Faustinelli, P.; Ozias-Akins, P. Bcl-xL transformed peanut (Arachis hypogaea L.) exhibits paraquat tolerance. Plant Cell Rep. 2008, 27, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.S.; Kim, K.M.; Eun, M.Y.; Sohn, J.K. Quantitative trait loci mapping associated with plant regeneration ability from seed derived calli in rice (Oryza sativa L.). Mol. Cells 2001, 11, 64–67. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Pressoir, G.; Briggs, W.H.; Vroh Bi, I.; Yamasaki, M.; Doebley, J.F.; McMullen, M.D.; Gaut, B.S.; Nielsen, D.M.; Holland, J.B.; et al. A unified mixed-model method for association mapping that accounts for multiple levels of relatedness. Nat. Genet. 2006, 38, 203–208. [Google Scholar] [CrossRef] [PubMed]
- Turner, S.D. qqman: An R package for visualizing GWAS results using Q-Q and manhattan plots. JOSS 2018, 3, 731. [Google Scholar] [CrossRef]
- Abe, T.; Futsuhara, Y. Genotypic variability for callus formation and plant regeneration in rice (Oryza sativa L.). Theor. Appl. Genet. 1986, 72, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Taguchi-Shiobara, F.; Komatsuda, T.; Oka, S. Comparison of two indices for evaluating regeneration ability in rice (Oryza sativa L.) through a diallel analysis. Theor. Appl. Genet. 1997, 94, 378–382. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhao, H.; Li, W.; Wu, J.; Zhou, Z.; Zhou, F.; Chen, H.; Lin, Y. Genome-wide association study of callus induction variation to explore the callus formation mechanism of rice. J. Integr. Plant Biol. 2019, 61, 1134–1150. [Google Scholar] [CrossRef] [PubMed]
- Matand, K.; Prakash, C.S. Evaluation of peanut genotypes for in vitro plant regeneration using thidiazuron. J. Biotechnol. 2007, 130, 202–207. [Google Scholar] [CrossRef] [PubMed]
- Trujillo-Moya, C.; Gisbert, C.; Vilanova, S.; Nuez, F. Localization of QTLs for in vitro plant regeneration in tomato. BMC Plant Biol. 2011, 11, 140. [Google Scholar] [CrossRef]
- Abd El-Fatah, B.E.S.; Sayed, M.A.; El-Sanusy, S.A. Genetic analysis of anther culture response and identification of QTLs associated with response traits in wheat (Triticum aestivum L.). Mol. Biol. Rep. 2020, 47, 9289–9300. [Google Scholar] [CrossRef] [PubMed]
- McFarland, F.L.; Collier, R.; Walter, N.; Martinell, B.; Kaeppler, S.M.; Kaeppler, H.F. A key to totipotency: Wuschel-like homeobox 2a unlocks embryogenic culture response in maize (Zea mays L.). Plant Biotechnol. J. 2023, 21, 1860–1872. [Google Scholar] [CrossRef]
- Wanders, R.J.A.; Waterham, H.R. Biochemistry of mammalian peroxisomes revisited. Annu. Rev. Biochem. 2006, 75, 295–332. [Google Scholar] [CrossRef]
- Baker, A.; Carrier, D.J.; Schaedler, T.; Waterham, H.R.; van Roermund, C.W.; Theodoulou, F.L. Peroxisomal ABC transporters: Functions and mechanism. Biochem. Soc. Trans. 2015, 43, 959–965. [Google Scholar] [CrossRef]
- Okushima, Y.; Fukaki, H.; Onoda, M.; Theologis, A.; Tasaka, M. ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis. Plant Cell 2007, 19, 118–130. [Google Scholar] [CrossRef]
- Che, P.; Lall, S.; Howell, S.H. Developmental steps in acquiring competence for shoot development in Arabidopsis tissue culture. Planta 2007, 226, 1183–1194. [Google Scholar] [CrossRef] [PubMed]
- Dharmasiri, N.; Dharmasiri, S.; Estelle, M. The F-box protein TIR1 is an auxin receptor. Nature 2005, 435, 441–445. [Google Scholar] [CrossRef] [PubMed]
- Ren, H.; Gray, W.M. SAUR Proteins as Effectors of Hormonal and Environmental Signals in Plant Growth. Mol. Plant 2015, 8, 1153–1164. [Google Scholar] [CrossRef] [PubMed]
- Franco, A.R.; Gee, M.A.; Guilfoyle, T.J. Induction and superinduction of auxin-responsive mRNAs with auxin and protein synthesis inhibitors. J. Biol. Chem. 1990, 265, 15845–15849. [Google Scholar] [CrossRef] [PubMed]
- McClure, B.A.; Guilfoyle, T. Characterization of a class of small auxin-inducible soybean polyadenylated RNAs. Plant Mol. Biol. 1987, 9, 611–623. [Google Scholar] [CrossRef] [PubMed]
- Kathare, P.K.; Dharmasiri, S.; Dharmasiri, N. SAUR53 regulates organ elongation and apical hook development in Arabidopsis. Plant Signal. Behav. 2018, 13, e1514896. [Google Scholar] [CrossRef] [PubMed]
- Chae, K.; Isaacs, C.G.; Reeves, P.H.; Maloney, G.S.; Muday, G.K.; Nagpal, P.; Reed, J.W. Arabidopsis SMALL AUXIN UP RNA63 promotes hypocotyl and stamen filament elongation. Plant J. 2012, 71, 684–697. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Li, M.; Lv, M.; Hepworth, S.R.; Li, D.; Ma, C.; Li, J.; Wang, S.-M. SAUR15 Promotes Lateral and Adventitious Root Development via Activating H+-ATPases and Auxin Biosynthesis. Plant Physiol. 2020, 184, 837–851. [Google Scholar] [CrossRef]
- King, G.J.; Chanson, A.H.; McCallum, E.J.; Ohme-Takagi, M.; Byriel, K.; Hill, J.M.; Martin, J.L.; Mylne, J.S. The Arabidopsis B3 domain protein VERNALIZATION1 (VRN1) is involved in processes essential for development, with structural and mutational studies revealing its DNA-binding surface. J. Biol. Chem. 2013, 288, 3198–3207. [Google Scholar] [CrossRef]
- Levy, Y.Y.; Mesnage, S.; Mylne, J.S.; Gendall, A.R.; Dean, C. Multiple roles of Arabidopsis VRN1 in vernalization and flowering time control. Science 2002, 297, 243–246. [Google Scholar] [CrossRef]
- Ge, F.; Luo, X.; Huang, X.; Zhang, Y.; He, X.; Liu, M.; Lin, H.; Peng, H.; Li, L.; Zhang, Z.; et al. Genome-wide analysis of transcription factors involved in maize embryonic callus formation. Physiol. Plant 2016, 158, 452–462. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.-L.; Zeng, H.-N.; Shi, M.-Z.; Xie, D.-Y. Development of tobacco callus cultures over expressing Arabidopsis PAP1/MYB75 transcription factor and characterization of anthocyanin biosynthesis. Planta 2008, 229, 37–51. [Google Scholar] [CrossRef] [PubMed]




| Subculture | Chr | SNP Location (bp) | Major Allele | Minor Allele | p |
|---|---|---|---|---|---|
| T7 | Arahy.01 | 44,535,215 | T | TA | 1.07 × 10−6 |
| Arahy.01 | 37,905,924 | T | TA | 1.41 × 10−5 | |
| Arahy.02 | 78,055,673 | C | A | 5.39 × 10−6 | |
| Arahy.12 | 110,745,152 | C | T | 2.00 × 10−5 | |
| Arahy.12 | 110,744,821 | C | A | 2.55 × 10−5 | |
| Arahy.13 | 83,801,701 | G | A | 8.54 × 10−8 | |
| Arahy.13 | 143,122,895 | TA | A | 1.70 × 10−7 | |
| Arahy.13 | 91,882,550 | G | A | 3.69 × 10−7 | |
| Arahy.13 | 87,089,142 | G | T | 6.30 × 10−6 | |
| Arahy.13 | 17,372,387 | G | A | 1.36 × 10−5 | |
| Arahy.13 | 7,863,511 | CA | C | 1.89 × 10−5 | |
| Arahy.14 | 39,653,468 | AT | A | 1.49 × 10−5 | |
| Arahy.14 | 18,525,892 | G | A | 1.79 × 10−5 | |
| Arahy.14 | 53,962,810 | A | G | 1.92 × 10−5 | |
| Arahy.14 | 16,587,777 | C | T | 2.23 × 10−5 | |
| Arahy.14 | 29,924,017 | C | T | 2.27 × 10−5 | |
| Arahy.14 | 37,587,465 | A | T | 2.58 × 10−5 | |
| Arahy.14 | 65,049,781 | A | G | 2.62 × 10−5 | |
| Arahy.14 | 33,807,861 | G | A | 3.08 × 10−5 | |
| Arahy.14 | 19,876,608 | G | A | 3.12 × 10−5 | |
| Arahy.14 | 31,198,728 | C | T | 3.15 × 10−5 | |
| Arahy.17 | 124,709,181 | C | CTA | 2.84 × 10−5 | |
| Arahy.20 | 19,417,946 | C | CAT | 1.73 × 10−5 | |
| T8 | Arahy.01 | 15,782,356 | CA | A | 6.59 × 10−7 |
| Arahy.02 | 85,103,096 | CA | C | 3.26 × 10−6 | |
| Arahy.04 | 8,623,742 | GA | A | 7.14 × 10−7 | |
| Arahy.04 | 61,118,310 | C | CCAATACTCGTAAAGAGTCTCAGATTTGCCTTGAA | 6.65 × 10−6 | |
| Arahy.04 | 64,427,766 | AC | A | 1.23 × 10−5 | |
| Arahy.05 | 94,095,749 | CGGT | C | 8.89 × 10−6 | |
| Arahy.07 | 22,858,555 | C | CA | 3.74 × 10−7 | |
| Arahy.07 | 49,041,776 | C | T | 2.38 × 10−5 | |
| Arahy.10 | 4,186,469 | CA | C | 2.00 × 10−5 | |
| Arahy.11 | 67,723,994 | C | CT | 2.34 × 10−5 | |
| Arahy.13 | 83,801,701 | G | A | 1.94 × 10−6 | |
| Arahy.13 | 17,372,387 | G | A | 3.60 × 10−6 | |
| Arahy.13 | 23,273,713 | C | A | 7.12 × 10−6 | |
| Arahy.13 | 91,882,550 | G | A | 7.41 × 10−6 | |
| Arahy.13 | 87,089,142 | G | T | 1.70 × 10−5 | |
| Arahy.14 | 51,951,294 | A | G | 1.76 × 10−5 | |
| Arahy.16 | 84,573,006 | TC | T | 2.42 × 10−6 | |
| Arahy.16 | 119,791,828 | TA | T | 9.75 × 10−6 | |
| Arahy.16 | 122,692,509 | GTGC | G | 2.60 × 10−5 | |
| Arahy.16 | 24,861,124 | C | T | 3.02 × 10−5 | |
| Arahy.17 | 5,025,554 | GT | G | 6.36 × 10−7 | |
| Arahy.17 | 14,468,911 | C | T | 2.22 × 10−5 | |
| T9 | Arahy.02 | 78,055,673 | C | A | 2.82 × 10−5 |
| Arahy.04 | 105,916,420 | C | G | 1.22 × 10−5 | |
| Arahy.04 | 111,900,912 | C | T | 1.67 × 10−5 | |
| Arahy.04 | 119,003,542 | G | A | 3.20 × 10−5 | |
| Arahy.13 | 83,801,701 | G | A | 1.18 × 10−5 | |
| Arahy.17 | 6,136,617 | C | T | 1.51 × 10−5 | |
| Arahy.17 | 6,170,139 | C | T | 1.96 × 10−5 | |
| Arahy.20 | 118,558,032 | C | A | 2.78 × 10−5 |
| Subculture | SNP Location (bp) | Chr | Candidate Genes | Distance to SNP (kb) | Functional Annotation |
|---|---|---|---|---|---|
| T7 | 44,535,215 | Arahy.01 | Arahy.KCTF4J | 9 (44,544,077–44,544,971) | SAUR-like auxin-responsive protein family |
| 37,905,924 | Arahy.01 | Arahy.6W2W8X | 124 (37,777,131–37,781,543) | MYB transcription factor MYB93 | |
| 110,744,821 | Arahy.12 | Arahy.M89JWR | 37 (110,782,249–110,794,939) | Pentatricopeptide repeat (PPR) superfamily protein | |
| Arahy.12 | Arahy.46GJXK | 67 (110,812,150–110,816,210) | Pentatricopeptide repeat (PPR) superfamily protein | ||
| 83,801,701 | Arahy.13 | Arahy.LC8K5G | 53 (83,747,374–83,747,929) | peroxisomal ABC transporter 1 | |
| 91,882,550 | Arahy.13 | Arahy.CH5A50 | 72 (91,954,110–91,961,683) | Homeodomain-like transcriptional regulator | |
| 17,372,387 | Arahy.13 | Arahy.I1CX7V | 124 (17,245,402–17,248,068) | Pentatricopeptide repeat (PPR) superfamily protein | |
| Arahy.13 | Arahy.2NE4Q7 | 119 (17,251,821–17,253,819) | SAUR-like auxin-responsive protein family | ||
| Arahy.13 | Arahy.4B15T0 | 126 (17,498,819–17,502,146) | myb transcription factor | ||
| 39,653,468 | Arahy.14 | Arahy.SI4FKG | 149 (39,802,122–39,804,507) | auxin response factor 19 | |
| 18,525,892 | Arahy.14 | Arahy.HDV1A7 | 116 (18,407,047–18,409,728) | auxin canalisation protein | |
| Arahy.14 | Arahy.6YY5F1 | 93 (18,618,421–18,623,655) | ankyrin repeat-containing protein At5g02620-like isoform X6 | ||
| 124,709,181 | Arahy.17 | Arahy.26LA0S | 113 (124,822,009–124,824,185) | myb transcription factor | |
| Arahy.17 | Arahy.N9VQ32 | 156 (124,865,117–124,870,706) | Pentatricopeptide repeat (PPR-like) superfamily protein | ||
| Arahy.17 | Arahy.Z51W7G | 170 (124,879,592–124,882,521) | Pentatricopeptide repeat (PPR-like) superfamily protein | ||
| Arahy.17 | Arahy.A8R8TX | 181 (124,890,375–124,892,445) | Pentatricopeptide repeat (PPR-like) superfamily protein | ||
| Arahy.17 | Arahy.H6TD7S | 183 (124,892,449–124,894,438) | Pentatricopeptide repeat (PPR-like) superfamily protein | ||
| T8 | 94,095,749 | Arahy.05 | Arahy.F6IJX6 | 11 (94,082,178–94,084,422) | auxin response factor 19 |
| Arahy.05 | Arahy.X8R2JI | 10 (94,084,481–94,084,965) | auxin response factor 19-like isoform X1 | ||
| Arahy.05 | Arahy.K8JH1A | 9 (94,084,986–94,086,080) | auxin response factor 19-like isoform X1 | ||
| Arahy.05 | Arahy.58VMN1 | 4 (94,087,242–9,409,170) | acetyl-CoA carboxylase biotin carboxylase subunit | ||
| Arahy.05 | Arahy.MIX90M | 0 (94,093,951–94,101,641) | auxin response factor 19 | ||
| Arahy.05 | Arahy.KFS3KW | 185 (94,280,364–94,282,288) | B3 domain-containing transcription factor VRN1-like | ||
| 83,801,701 | Arahy.13 | Arahy.LC8K5G | 53 (83,747,374–83,747,929) | peroxisomal ABC transporter 1 | |
| 17,372,387 | Arahy.13 | Arahy.I1CX7V | 124 (17,245,402–17,248,068) | Pentatricopeptide repeat (PPR) superfamily protein | |
| Arahy.13 | Arahy.2NE4Q7 | 119 (17,251,821–17,253,819) | SAUR-like auxin-responsive protein family | ||
| Arahy.13 | Arahy.4B15T0 | 126 (17,498,819–17,502,146) | myb transcription factor | ||
| 91,882,550 | Arahy.13 | Arahy.CH5A50 | 72 (91,954,110–91,961,683) | Homeodomain-like transcriptional regulator | |
| 5,025,554 | Arahy.17 | Arahy.G50Y2D | 102 (4,918,422–4,923,604) | uncharacterized protein LOC100777386 isoform X2 | |
| Arahy.17 | Arahy.LA4AI5 | 82 (4,942,078–4,943,769) | probable WRKY transcription factor 28-like | ||
| Arahy.17 | Arahy.226PX6 | 0 (5,024,406–5,026,216) | uncharacterized protein LOC100778027 isoform X2 | ||
| T9 | 83,801,701 | Arahy.13 | Arahy.LC8K5G | 53 (83,747,374–83,747,929) | peroxisomal ABC transporter 1 |
| 6,136,617 | Arahy.17 | Arahy.6TK8TS | 153 (5,981,429–5,983,822) | Pentatricopeptide repeat (PPR) superfamily protein | |
| Arahy.17 | Arahy.I0AKGU | 71 (6,066,092–6,068,587) | Pentatricopeptide repeat (PPR) superfamily protein | ||
| Arahy.17 | Arahy.6847YK | 28 (6,164,347–6,165,237) | Pentatricopeptide repeat (PPR) superfamily protein | ||
| 118,558,032 | Arahy.20 | Arahy.35R4A4 | 69 (118,488,460–118,489,125) | Myb/SANT-like DNA-binding domain protein |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, D.; Shi, L.; Sun, Z.; Qi, F.; Liu, H.; Xue, L.; Li, X.; Liu, H.; Qu, P.; Zhao, H.; et al. Genome-Wide Association Studies of Embryogenic Callus Induction Rate in Peanut (Arachis hypogaea L.). Genes 2024, 15, 160. https://doi.org/10.3390/genes15020160
Luo D, Shi L, Sun Z, Qi F, Liu H, Xue L, Li X, Liu H, Qu P, Zhao H, et al. Genome-Wide Association Studies of Embryogenic Callus Induction Rate in Peanut (Arachis hypogaea L.). Genes. 2024; 15(2):160. https://doi.org/10.3390/genes15020160
Chicago/Turabian StyleLuo, Dandan, Lei Shi, Ziqi Sun, Feiyan Qi, Hongfei Liu, Lulu Xue, Xiaona Li, Han Liu, Pengyu Qu, Huanhuan Zhao, and et al. 2024. "Genome-Wide Association Studies of Embryogenic Callus Induction Rate in Peanut (Arachis hypogaea L.)" Genes 15, no. 2: 160. https://doi.org/10.3390/genes15020160
APA StyleLuo, D., Shi, L., Sun, Z., Qi, F., Liu, H., Xue, L., Li, X., Liu, H., Qu, P., Zhao, H., Dai, X., Dong, W., Zheng, Z., Huang, B., Fu, L., & Zhang, X. (2024). Genome-Wide Association Studies of Embryogenic Callus Induction Rate in Peanut (Arachis hypogaea L.). Genes, 15(2), 160. https://doi.org/10.3390/genes15020160
