Next Article in Journal
IGF2 May Enhance Placental Fatty Acid Metabolism by Regulating Expression of Fatty Acid Carriers in the Growth of Fetus and Placenta during Late Pregnancy in Pigs
Previous Article in Journal
Genome-Wide Identification and Expression Analysis of the SHI-Related Sequence Family in Cassava
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Influence of Methyl Jasmonate on Expression Patterns of Rosmarinic Acid Biosynthesis Genes, and Phenolic Compounds in Different Species of Salvia subg. Perovskia Kar L.

1
School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada
2
Department of Horticulture Crop Research, Isfahan Agricultural and Natural Resources Research and Education Center, AREEO, Isfahan P.O. Box 81785-199, Iran
3
Department of Agronomy and Plant Breeding, Faculty of Agriculture, Bu-Ali Sina University, Hamedan P.O. Box 6517838695, Iran
4
Department of Food Security and Public Health, Khabat Technical Institute, Erbil Polytechnic University, Erbil 44001, Iraq
5
Seed and Plant Improvement Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj P.O. Box 3158854119, Iran
6
Department of Plant Physiology and Metabolomics, Agricultural Institute, Centre for Agricultural Research, 2462 Martonvásár, Hungary
*
Authors to whom correspondence should be addressed.
Genes 2023, 14(4), 871; https://doi.org/10.3390/genes14040871
Submission received: 12 February 2023 / Revised: 30 March 2023 / Accepted: 3 April 2023 / Published: 5 April 2023
(This article belongs to the Section Plant Genetics and Genomics)

Abstract

Salvia yangii B.T. Drew and Salvia abrotanoides Kar are two important fragrant and medicinal plants that belong to the subgenus Perovskia. These plants have therapeutic benefits due to their high rosmarinic acid (RA) content. However, the molecular mechanisms behind RA generation in two species of Salvia plants are still poorly understood. As a first report, the objectives of the present research were to determine the effects of methyl jasmonate (MeJA) on the rosmarinic acid (RA), total flavonoid and phenolic contents (TFC and TPC), and changes in the expression of key genes involved in their biosynthesis (phenylalanine ammonia lyase (PAL), 4-coumarate-CoA ligase (4CL), and rosmarinic acid synthase (RAS)). The results of High-performance liquid chromatography (HPLC) analysis indicated that MeJA significantly increased RA content in S. yungii and S. abrotanoides species (to 82 and 67 mg/g DW, respectively) by 1.66- and 1.54-fold compared with untreated plants. After 24 h, leaves of Salvia yangii and Salvia abrotanoides species treated with 150 M MeJA had the greatest TPC and TFC (80 and 42 mg TAE/g DW, and 28.11 and 15.14 mg QUE/g DW, respectively), which was in line with the patterns of gene expression investigated. Our findings showed that MeJA dosages considerably enhanced the RA, TPC, and TFC contents in both species compared with the control treatment. Since increased numbers of transcripts for PAL, 4CL, and RAS were also detected, the effects of MeJA are probably caused by the activation of genes involved in the phenylpropanoid pathway.

1. Introduction

Medicinal and aromatic plants are used in pharmaceuticals, cosmetics, personal care items, incense, and food to treat diseases, maintain health, and prevent them [1]. These plants are becoming more popular as public interest in natural resources increases daily [2,3].
One of the most significant genera in the Lamiaceae family, Salvia (garden sage), has around 1000 species worldwide [4]. Numerous Salvia species are used to make herbal tea, as well as in cosmetics, fragrances, and medicines [5]. The biological properties of plants in this genus, such as antioxidant, anti-tumor, anti-inflammatory, antibacterial, antidiabetic, and anxiolytic characteristics, further set them apart [6,7,8,9].
Several perennial, shrubby, and fragrant species with possible medical uses may be found in the subgenus Perovskia Kar of the Salvia expanded genus [10]. Salvia yangii B.T. Drew (formerly Perovskia atriplicifolia Benth.) and Salvia abrotanoides Karel (formerly known as Perovskia abrotanoides Kar) are the two most common among them, being found in extensive regions including the western regions of Iran, Pakistan, Tibet, and Xinjiang in China [11,12,13,14].
Both S. abrotanoides and S. yangii are used as traditional medicines in the regions where they grow naturally. Diabetes, diarrhea, scabies, fever, wound healing, and antibiotic therapy are among the conditions that S. yangii is used to treat [15,16,17,18,19]. S. yangii has been described as a potent analgesic and parasiticide in traditional Tibetan and Chinese medicine [20,21]. Locally, S. abrotanoides, also known as “Brazambol” in common parlance, is used as a sedative, analgesic, and antiseptic as well as a therapy for toothache, typhoid, fever, headache, cardiovascular disorders, gonorrhoea, vomiting, liver fibrosis, painful urination, and cough [22,23,24,25]. Moreover, S. abrotanoides was shown to possess cytotoxic, anti-plasmodial, and anti-inflammatory pharmacological activities, all of which have been employed in Iranian traditional medicine to cure leishmaniasis [26,27].
Rosmarinic acid (RA) has been found to be the main phenylpropanoid present in the medicinal plant Slavia [28]. This molecule has many roles, such as antioxidant, anti-inflammatory, and antibacterial activities [29,30,31,32]. The main active phenolic compound, RA, chemically, is an ester of 3,4-dihydroxyphenyllactic acid and caffeic acid (Figure 1). It is a substance that occurs naturally and is present in many medicinal plants [33]. RA is found to be an active component in a number of Lamiaceae-related medicinal plants, but it may also be found in plants from other floras [34,35].
The RA biosynthesis pathway genes in two species of Salvia subgenus Perovskia (S. yangii and S. abrotanoides) treated with MeJA have not yet been assessed, despite the fact that their expression has been investigated in a range of plant species. Production and accumulation of these molecules are influenced by various time scales, developmental phases, and responses to biotic and abiotic stimuli [36,37,38,39]. Elicitors are one of the important factors that trigger plant defense mechanisms and cause the accumulation of certain secondary metabolites [40,41,42]. Methyl jasmonate (MeJA) as a signaling molecule is essential for the signal transduction pathway. Exogenous application of this potent abiotic elicitor in plants is employed to encourage the production of the desired secondary compounds [43,44]. Several medicinal plants, such as Salvia miltiorrhiza Bunge [45], Satureja khuzistanica Jamzad [46], Capparis spinosa L. [47,48], Thymus migricus Klokov and Des.-Shost [49], Melissa officinalis L. [50], Foeniculum vulgare Mill. [51], and Coriandrum sativum L. [52], have been the subject of extensive MeJA research into the regulation of secondary metabolism. Numerous studies [53,54,55] have shown that MeJA has a positive influence on RA levels and the expression levels of related essential genes in plants.
Despite the fact that many studies have looked into the effects of elicitors, such as MeJA, on the formation of phenolic acids, we are unaware of any research that has looked into RA and gene expression patterns in RA-related genes in S. yangii and S. abrotanoides species. Hence, the main objective of the present study was to investigate changes in RA-related gene expression (PAL, 4CL, and RAS), phenolic compound accumulation, and RA concentration in two species of Salvia (S. yangii and S. abrotanoides) in response to the MeJA treatment. Furthermore, we looked for an association between the expression patterns of genes involved in the RA biosynthesis pathway and the RA content in the leaves in two species of Salvia during the vegetative growth stage after the MeJA treatment.

2. Result and Discussion

2.1. RA Changes at Different MeJA Concentrations

As shown in Figure 2, the different MeJA treatments significantly affected RA, a key component of two Salvia species. Additionally, Figure 2 illustrates how, after 24 h, the RA content in both treated Salvia species dramatically increased under the MeJA elicitor. In general, RA accumulation was greater in the S. yangii than the S. abrotanoides at all MeJA concentrations. In the S. yangii species, the concentration of RA increased by 1.24, 1.38, 1.66, and 1.54 times greater than in untreated plants when they were exposed to 10, 100, 150, and 200 µM MeJA, respectively. The RA quantity in the S. abrotanoides species also increased in accordance with the application of various MeJA treatments and was 1.19, 1.23, 1.54, and 1.35 times more than their control (Figure 2). According to the results, the RA values of two Salvia species were different, which indicates that RA production is affected by genotype-specific responses to stimuli in abiotic stresses.
Our results imply that MeJA treatments may increase the amount of RA in various Salvia species, which in turn has an effect on the gene expression patterns of genes implicated in RA synthesis. On the other hand, our findings support those of earlier research [47,48,49,56] and suggest that Salvia plants’ RA levels vary depending on their genotype and dose. It has been reported that the treatments with 100–150 µM MeJA result in the accumulation of high levels of RA in Lamiaceae families [50,57]. Moreover, treating caper plants with 150 µM MeJA might stimulate the production of flavonoids [20,58]. According to some studies, MeJA stimulates the PAL enzyme’s activity, which may contribute to the growth of RA in diverse plants [46,54]. In fact, these results imply that MeJA could affect the increase in RA amount under 100- to 150-M therapy [50]. According to our findings, both ecotypes’ metabolic characteristics were noticeably impacted by the MeJA that was delivered. Moreover, the increase in RA accumulation through the MeJA may be due to the stimulation of biosynthetic pathways and the activation of related genes to induce radical scavenging through phenolic components. Both species saw a rise in RA after MeJA, although the S. yangii species experienced this increase more quickly.
Previous studies corroborate our findings about the effect of MeJA at varying doses on RA buildup and gene expression in Salvia spp. Satureja khuzistanica nodal cultures, Agastache rugosa Kuntze cell cultures, and Coleus forskohlii hairy root cultures all showed that MeJA is the most efficient elicitor for the development of RA, supporting this concept [57,58,59]. Park et al. [60] reported that both abiotic and biotic elicitors stimulated RA production in A. rugosa callus suspension cultures. A previous study conducted by Kintzios et al. [61] showed that cell suspension cultures increased RA at a rate of up to 10 mg/g dry weight in Ocimum basilicum. After MeJA treatment, Lithospermum erythrorhizon cells showed a 10-fold increase in RA content, which was in accordance with Mizukami et al. [62].

2.2. TPC and TFC as a Function of MeJA Concentration

The TPC and TFC levels of two Salvia sub-genus Perovskia Kar leaves are obviously impacted by all concentrations of MeJA (Figure 3). It is probable that the pattern of RA content changes during the MeJA treatment was reflected in the pattern of TPC and TFC changes in both S. yangii and S. abrotanoides species (Figure 2 and Figure 3A,B). Additionally, as shown by our findings, MeJA had a distinct degree of influence on phenol and flavonoid accumulation in the S. yangii species as compared to the S. abrotanoides species. In accordance with previous studies, our results revealed that MeJA as a signaling molecule plays a key role in flavonoid formation [63,64]. Hence, these genes’ elevated expression in response to MeJA is almost certainly a result of the subsequent rise in phenolic compounds.
Concentrations of 10, 100, 150, and 200 µM MeJA raised the TPC in S. yangii by 1.14, 1.27, 1.53, and 1.41 times, respectively, compared to the untreated plants (Figure 3A). Accordingly, TPC values for the S. abrotanoides treated with the various doses of MeJA were tested and were, correspondingly, 1.21, 1.5, 2.02, and 1.7 times higher than the controls (Figure 3A). Moreover, S. yangii species treated with different doses of MeJA produced TFCs of up to 12.68, 17, 27.52, and 20.59 mg QUE/g DW, which were 1.30, 1.74, 2.82, and 2.11 times higher than the control plants, respectively (Figure 3B). TFC levels in the S. abrotanoides species were increased by MeJA treatments; these increases were about 1.27, 1.53, 2.07, and 1.64 times greater than the levels in untreated plants (Figure 3B). These results corroborate those of another study [65], which discovered species-specific differences in Salvia leaf TPC and TFC. In both ecotypes, TPC values were higher than TFC in both untreated and all treated leaves, supporting previous findings [66]. Recent investigations [67,68,69] agree with ours in showing that MeJA stimuli greatly influenced TPC in several plants. Researchers found that MeJA increased secondary metabolite accumulation in various plant species [70,71,72].
Higher quantities of polyphenolic compounds may come from the more rapid breakdown of larger phenolic compounds into smaller molecules, as shown by the research of Jaafar et al. [73]. The major regulating enzyme in phenylpropanoid metabolism, PAL, has been linked to the induction of TPC and TFC in two species of the subgenus Perovskia after treatment with MeJA [71]. Many plants’ expression of the phenylpropanoid biosynthesis genes (PAL, C4H, and 4CL) is inversely proportional to their flavonoid concentration [74,75]. Hence, the increased synthesis of RA and phenolic compounds after MeJA treatments was consistent with the expression of genes involved in the RA biosynthetic pathway.

2.3. MeJA’s Effects on the Expression of the PAL, 4CL, and RAS Genes

Changes in the transcript abundance of genes involved in the process that creates RA were investigated using real-time PCR, and the relationship between RA accumulation and gene expression in two species of Salvia that were subjected to varying dosages of MeJA was also analyzed (Figure 4). Results show that three genes investigated in Salvia plants had significantly different mRNA transcript levels in response to different MeJA treatments. It is important to note that MeJA-treated S. yangii had higher transcriptional levels of RA biosynthetic genes than MeJA-treated S. abrotanoides. Possible explanation for increased RA production in MeJA-treated plants, especially at the beginning and end of the RA biosynthetic pathway and during the expression of PAL and RAS.
Our results showed that the expression level of PAL in the S. yangii species enhanced from 8.42-fold at MeJA 10 M to 11.83-fold at MeJA 150 μM and remained almost the same at 10.67-fold at MeJA 200 μM (Figure 4A). At MeJA 10 M and 100 μM, the transcript level of 4CL significantly increased in comparison to untreated plants (7- and 7.8-fold, respectively), progressively increasing to 8.31-fold at MeJA 150 μM, and subsequently decreasing to 6.49-fold (Figure 4B). RAS expression also increased significantly to 12-fold at MeJA 100 μM, peaked quickly at 17.1-fold with MeJA 150 μM, and then sharply decreased to 14.38-fold at MeJA 200 μM (Figure 4C).
As MeJA 10 μM was applied to the S. abrotanoides plants, the expression level of PAL greatly increased (6.37-fold) when compared to the control plant, but there was no discernible difference among MeJA treatments. MeJA 150 μM significantly increased PAL expression, which was 8.72-fold greater than in control plants (Figure 4A). After 24 h of treatment with MeJA 10 μM, 4CL significantly increased (5.51-fold), and with MeJA 100 μM, it increased even more, to 6.36-fold. At MeJA 150 and 200 μM, 4CL expression started to decline after reaching its greatest level at MeJA 100 μM (6.36-fold), although it was still 4.51- and 4.37-fold greater than the level before treatment (Figure 4B). RAS gene expression in S. abrotanoides treated with MeJA rose at a rate of 6.38-fold at MeJA 10 μM, 7.78-fold at MeJA 100 μM, 10.87-fold at MeJA 150 μM, and 7.91-fold at MeJA 200 μM. The RA biosynthesis pathway, which includes PAL and RAS, had a consistent pattern of expression in both species as all gene transcript levels rose at all MeJA doses (Figure 4). The MeJA treatment increased the expression of the PAL, 4 CL, and RAS genes so that their expression patterns were in accordance with the pattern of RA accumulation. Furthermore, the current study showed that spraying subgenus Perovskia species with high MeJA concentrations (200 μM) resulted in a decrease in the examined gene expression. These results are consistent with those found by Kianersi et al. [20,21,22,50], who found that large quantities of exogenously given MeJA suppressed expression. Examining the impact of external stimuli on the synthesis of secondary metabolites is useful for determining the highest performance of secondary metabolites and for clarifying their biosynthetic pathway(s) [76,77,78,79,80].
Both species showed similar patterns of PAL upregulation in response to MeJA therapy that paralleled those of RA accumulation. Likewise, a clear tread-off was observed between over-expression of the RA production-involved genes in several organs of Ocimum basilicum cultivars, lemon balm ecotypes, and Agastache rugosa [29,50,81]. Since PAL activity is rising in species belonging to the Lamiaceae family before RA accumulation [36,82], it has been hypothesized that it is a key enzyme for entrance into the phenylpropanoid pathway. Our research showed that PAL is essential for the synthesis of RA. Stress and plant species may affect the speed with which transcript levels rise and genes are induced. The expression profile of PAL in Salvia miltiorrhiza was analyzed, and it was shown to be upregulated in response to a wide variety of treatments [83,84]. Researchers have shown that activating MeJA increases PAL activity, a key enzyme in the phenylpro-panoid pathway [85,86]. Although our results unambiguously demonstrate the importance of PAL and RAS expression in RA generation in both species, the observed discrepancies in PAL and RAS expression as well as RA accumulation quantities are likely species-specific to the genus Salvia.
The strong connection between RA biosynthesis and RAS expression was highlighted by our findings. In both Salvia species treated with MeJA, there was a correlation between the pattern of RAS expression and the development of RA (Figure 2 and Figure 4). After treatment with MeJA 150 μM, RAS expression was 17.1 and 10.87 times higher in S. yangii and S. abrotanoides, respectively, compared to control plants. Similarly, the RA levels at this concentration were 1.66 times higher in S. yangii than in usual plants and 1.54 times higher in S. abrotanoides. The RAS in the studied species was reduced to 200 μM MeJA compared to 150 μM MeJA, and this was followed by a decrease in the synthesis of RA, phenol, and flavonoids. This gene may play a crucial role in regulating RA production because of the correlation between RAS expression and RA levels.
In general, our results were consistent with those of Kim et al. [55], who demonstrated that MeJA treatment enhanced the expression of the phenylpropanoid biosynthesis-related genes ArPAL, Ar4CL, and ArC4H in A. rugosa, ultimately leading to higher levels of RA accumulation. Plants exhibited rapid induction of PAL activity in response to MeJA elicitation, as reported by Mizukami et al. [62]. MeJA increases bioactive substance accumulation and changes the mRNA expression of genes involved in secondary metabolite manufacture in several plant species, as proven by numerous studies [46,47,48,76,77,87]. Similarly, Belhadj et al. [88] showed a rapid upregulation of the PAL gene expression in grape leaves using the MeJA treatment. Moreover, MeJA can alter CAD, PAL, and PPO activities as well as their relative mRNA levels [89].
Based on our results, MeJA at 150 μM was found to have the greatest levels of PAL and RAS expression, whereas control plants had the lowest levels, suggesting there is a strong association between amount of MeJA and RA. However, compared to the other dosages, leaves treated with MeJA at 100 μM generated the highest levels of the 4CL transcript in the S. abrotanoides species. Finally, our results show that MeJA treatments directly regulated the accumulation of RA and total phenolic and flavonoid compounds, as well as the expression of key genes involved in RA biosynthesis (PAL, 4CL, and RAS) in Salvia leaves.

3. Materials and Methods

3.1. Plant Materials and Environmental Factors

The seeds of S. yangii and S. abrotanoides, two species of Salvia subg. Perovskia kar, were cultivated in a glasshouse under controlled illumination (16 h day/8 h night, with a photosynthetic photon flux density of 310 mol m−2 s−1) and temperature (25/18 °C day/night) conditions.

3.2. MeJA Treatments

In the present study, Salvia plants were treated with MeJA at concentrations of 10, 100, 150, and 200 μM throughout their third month of development in a container. Distilled water served as a control (i.e., only possessing root, stem, and leaf components). The 0.22-m MILLIPORE pore-size filter membrane was used for full sterilisation of the MeJA (SIG-MA-ALDRICH) solutions. Final concentrations of MeJA and distilled water (control) were sprayed over the aerial tissues of two Salvia species until runoff. The experimental data were collected from three separate plants for each treatment. After the first day of treatment, both the control and treated leaves were sampled, frozen in liquid nitrogen, and maintained at −80 °C.

3.3. Real-Time PCR Analysis

Following the manufacturer’s instructions [20], total RNA was extracted from uniform young leaves of Salvia species, and cDNA was synthesized using the cDNA Synthesis Kit. As described before [56], we used gene-specific primers and the actin gene (as a housekeeping gene) to determine how varying amounts of MeJA affected the mRNA transcript levels of PAL, 4CL, and RAS (Table 1). The fold-change (2−ΔΔCt) approach, which has been described earlier [90], was used for this investigation. Three technical and biological replicates were also employed for the gene expression study.

3.4. HPLC Analysis

To assess the impact of different MeJA concentrations on the formation of RA, Skendi et al.’s [91] approach was slightly modified. In a nutshell, 95 mg of the powdered dry leaf was mixed with 85% methanol (1:10 w/v), sonicated for 45 min, and then centrifuged at 3000 rpm for 15 min. The supernatant was mixed with sterile water to create the 20 mL reaction volume. To separate the RA, the resultant solution was filtered using a 0.45 M syringe filter before being injected onto an Agilent Technologies 1100 series HPLC system (C18 column (250 × 4.6 mm)). One milliliter of methanol/water (50/50 v/v) was produced with various concentrations of the RA standard, ranging from 1 to 350 mg/L. The calibration curve was created using the peak regions discovered from the injections. Mobile phase eluents A (acetonitrile) and B (water-acetic acid, 97.5:2.5, v/v) were used at a flow rate of 1 mL/min. The gradient of the solvent composition was 80A/20B for five minutes, followed by 50A/50B for ten minutes, and then 100% B for another fifteen minutes. Finally, the concentration of RA was determined as mg/g of dry weight after the RA molecule was detected at a wavelength of 330 nm (Figure S1A–C). Each sample was examined three times. Validation of the chromatographic peak of RA was conducted using the retention time of the reference standard. Agilent ChemStation software was used to measure the peak regions as part of the quantitative analysis with external standardization. The results were presented as mg/g DW.

3.5. Total Phenolic and Flavonoid Contents Analysis

After being suspended in 80% methanol (25 mL) and shaken for 24 h at room temperature in a shaker, 1000 mg of dried and crushed Salvia leaf samples were turned into methanolic extracts to assess their total phenolic content (TPC) (150 rpm). The TPC was then calculated using the Folin–Ciocalteu reagent, as previously described [50], after the extracts had been filtered through two layers of Whatman paper. To begin, 2.5 mL of the Folin–Ciocalteu reagent (10-fold diluted) and 2 mL of sodium carbonate (7.5%) were added to 0.5 mL of the methanolic extract from each sample. The next step was to measure the absorbance at 765 nm after 15 min of heating at 45 °C. TPC was then determined as mg tannic acid equivalent/g dry weight (DW) (Figure 5A).
Additionally, Zhang et al.’s [92] chloride colorimetric technique was used to assess the total flavonoid content (TFC). First, 1.25 mL of water and 0.75 mL of sodium nitrate were mixed with 0.25 mg of each sample extract, and then the mixture was allowed to sit for 6 min in the dark. After 300 s of dark incubation, 0.15 mL of aluminum chloride (10%) was added to the liquid to complete the reaction. Each sample (5%) was then given 0.275 mL of water and 0.5 mL of sodium hydroxide solution. The TFC was shown as mg quercetin equivalent/g DW after reading the adsorption of the reaction solution at 510 nm (Figure 5B).

3.6. Data Analysis

The experimental data were analyzed using a factorial experiment based on a completely randomized design (CRD) with three replicates. The Duncan’s multiple range test was used to compare the means (DMRT). The statistical analysis was computed using SPSS ver. 16 software.

4. Conclusions

As the first report, our results revealed that exogenous MeJA treatment increases the contents of RA, TP, and TF, as well as the expression of key genes in the RA (phenylpropanoid) pathway such as PAL, 4CL, and RAS in two species of Salvia. Hence, further research is required to understand how the accumulation of phenolic compounds in response to other treatments involving abiotic stresses interacts with the regulation of other genes engaged in this pathway. In the future, this process may be amenable to genetic modification in order to boost Salvia’s production of crucial chemicals.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14040871/s1, Figure S1: Gas chromatogram for (A) Rosmarinic acid (RA) standard; (B) Rosmarinic acid (RA) product in control; and (C) RA product in 150 µM MeJA treated-plants.

Author Contributions

Conceptualization, F.K.; methodology, F.K. and F.F.; software, F.F. and D.A.A.; validation, F.K. and D.A.A.; formal analysis, F.K. and F.F.; investigation, A.P.-A. and D.A.A.; resources, F.K. and D.A.A.; data curation, F.K.; writing—original draft preparation, F.K. and F.F.; writing—review and editing, A.P.-A.; B.J. and T.J.; visualization, F.K. and A.P.-A.; supervision, D.A.A. and F.K.; project administration, F.K. and D.A.A.; funding acquisition, T.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by a grant from the National Research, Development, and Innovation Office (grant No. K142899).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yilmaz, A.; Ciftci, V. Genetic relationships and diversity analysis in Turkish laurel (Laurus nobilis L.) germplasm using ISSR and SCoT markers. Mol. Biol. Rep. 2021, 48, 4537–4547. [Google Scholar] [CrossRef] [Scilit]
  2. Yilmaz, A.; Guler, E.; Soydemir, H.E.; Demirel, S.; Mollahaliloglu, S.; Karadeniz, T.; Ciftci, V. Miracle. plant: Aronia (Aronia melanocarpa). MAS J. Appl. Sci. 2021, 6, 83–94. [Google Scholar]
  3. Yilmaz, A.; Karik, Ü. AMF and PGPR enhance yield and secondary metabolite profile of basil (Ocimum basilicum L.). Ind. Crops Prod. 2022, 176, 114327. [Google Scholar] [CrossRef] [Scilit]
  4. Mátis, A.; Malkócs, T.; Kuhn, T.; Laczkó, L.; Moysiyenko, I.; Szabó, A.; Bădărău, A.; Sramkó, G. Hiding in plain sight: Integrative analyses uncover a cryptic Salvia species in Europe. Taxon 2023, 72, 78–97. [Google Scholar] [CrossRef] [Scilit]
  5. Drew, B.T.; González-Gallegos, J.G.; Xiang, C.L.; Kriebel, R.; Drummond, C.P.; Walked, J.B.; Sytsma, K.J. Salvia united: The greatest good for the greatest number. Taxon 2017, 66, 133–145. [Google Scholar] [CrossRef] [Scilit]
  6. Bielecka, M.; Pencakowski, B.; Stafiniak, M.; Jakubowski, K.; Rahimmalek, M.; Gharibi, S.; Matkowski, A.; Slusarczyk, S. Metabolomics and DNA-based authentication of two traditional Asian medicinal and aromatic species of Salvia subg. Perovskia. Cells 2021, 10, 112. [Google Scholar] [CrossRef] [Scilit]
  7. Mohammadhosseini, M.; Venditti, A.; Akbarzadeh, A. The genus Perovskia Kar.: Ethnobotany, chemotaxonomy and phytochemistry: A review. Toxin Rev. 2021, 40, 484–505. [Google Scholar] [CrossRef] [Scilit]
  8. Ghaffari, Z.; Rahimmalek, M.; Sabzalian, M.R. Variations in essential oil composition and antioxidant activity in Perovskia abrotanoides Kar. collected from different regions in Iran. Chem. Biodivers. 2018, 15, e1700565. [Google Scholar] [CrossRef] [Scilit]
  9. Afshari, M.; Rahimmalek, M. Variation in essential oil composition, anatomical, and antioxidant characteristics of Achillea filipendulina Lam. as affected by different phenological stages. J. Essent. Oil Res. 2021, 33, 283–298. [Google Scholar] [CrossRef] [Scilit]
  10. Orhan, E.I.; Senol, S.F.; Ercetin, T.; Kahraman, A.; Celep, F.; Akaydin, G.; Sener, B.; Dogan, M. Assessment of anticholinesterase and antioxidant properties of selected sage (Salvia) species with their total phenol and flavonoid contents. Ind. Crops Prod. 2013, 41, 21–30. [Google Scholar] [CrossRef] [Scilit]
  11. Flora of Pakistan. Available online: http://www.efloras.org/flora_page.aspx?flora_id=5 (accessed on 17 January 2020).
  12. Rechinger, K.H. Flora Iranica; Akademische Druck- und Verlagsanstalt: Graz, Austria, 1982. [Google Scholar]
  13. Mozaffarian, V.A. Dictionary of Iranian Plant Names; Farhang Moaser: Tehran, Iran, 1996. [Google Scholar]
  14. Flora of China. Available online: http://www.efloras.org/flora_page.aspx?flora_id=2 (accessed on 17 January 2020).
  15. Perveen, S.; Malik, A.; Noor, A.T.; Tareen, R.B. Pervosides A and B, new isoferulyl glucosides from Perovskia atriplicifolia. J. Asian Nat. Prod. Res. 2008, 10, 1105–1108. [Google Scholar] [CrossRef] [Scilit]
  16. Tareen, R.B.; Bibi, T.; Khan, M.A.; Ahmad, M.; Zafar, M. Indigenous knowledge of folk medicine by the women of Kalat and Khuzdar regions of Balochistan, Pakistan. Pak. J. Bot. 2010, 42, 1465–1485. [Google Scholar]
  17. Baquar, S.R. Medicinal and Poisonous Plants of Pakistan, 1st ed.; Printas Press: Karachi, Pakistan, 1989. [Google Scholar]
  18. Cardilea, V.; Russob, A.; Formisanoc, C.; Rigano, D.; Senatore, F.; Arnold, N.A.; Piozzi, F. Essential oils of Salvia bracteata and Salvia rubifolia from Lebanon: Chemical composition, antimicrobial activity and inhibitory effect on human melanoma cells. J. Ethnol. Pharmacol. 2009, 126, 265–272. [Google Scholar] [CrossRef] [Scilit]
  19. Eisenman, S.W.; Zaurov, D.E.; Struwe, L. Medicinal Plants of Central Asia: Uzbekistan and Kyrgyzstan; Springer: Berlin/Heidelberg, Germany, 2012; ISBN 978-1-46143-912-7. [Google Scholar]
  20. Gao, L.; Zhou, J.; Zhu, L.Y.; Zhang, J.R.; Jing, Y.X.; Zhao, J.W.; Huang, X.Z.; Li, G.P.; Jiang, Z.Y.; Xue, D.Y. Four New Diterpene Glucosides from Perovskia atriplicifolia. Chem. Biodivers. 2017, 14, 1–7. [Google Scholar] [CrossRef] [Scilit]
  21. Jiang, Z.Y.; Yu, Y.J.; Huang, C.G.; Huang, X.Z.; Hu, Q.F.; Yang, G.Y.; Wang, H.B.; Zhang, X.Y.; Li, G.P. Icetexane diterpenoids from Perovskia atriplicifolia. Planta Med. 2015, 81, 241–246. [Google Scholar] [CrossRef] [Scilit]
  22. Kumar, P.G.; Gupta, S.; Murugan, P.M.; Bala Singh, S. Ethnobotanical studies of Nubra valley—A cold arid zone of Himalaya. Ethnobot. Leafl. 2009, 13, 9. [Google Scholar]
  23. Moallem, S.A.; Niapour, M. Study of embryotoxicity of Perovskia abrotanoides, an adulterant in folk-medicine, during organogenesis in mice. J. Ethnopharmacol. 2008, 117, 108–114. [Google Scholar] [CrossRef] [Scilit]
  24. Ballabh, B.; Chaurasia, O.P.; Ahmed, Z.; Singh, S.B. Traditional medicinal plants of cold desert Ladakh-Used against kidney and urinary disorders. J. Ethnopharmacol. 2008, 118, 331–339. [Google Scholar] [CrossRef] [Scilit]
  25. Hosseinzadeh, H.; Amel, S. Antinociceptive Effect of the Aerial Parts of Perovskia abrotanoides Extracts in Mice. Iran. Red Crescent Med. J. 2009, 4, 15–17. [Google Scholar]
  26. Sairafianpour, M.; Christensen, J.; Staerk, D.; Budnik, B.; Kharazmi, A.; Bagherzadeh, K.; Jaroszewski, J.W. Leishmanicidal, antiplasmodial, and cytotoxic activity of novel diterpenoid 1,2-quinones from Perovskia abrotanoides: New source of tanshinones. J. Nat. Prod. 2001, 64, 1398–1403. [Google Scholar] [CrossRef] [Scilit]
  27. Jaafari, M.R.; Hooshmand, S.; Samiei, A.; Hossainzadeh, H. Evaluation of leishmanicidal effect of Perovskia abrotanoides Karel.Root extract by in vitro leishmanicidal assay using promastigotes of Leishmania major. Pharmacologyonline 2007, 1, 299–303. [Google Scholar]
  28. Petersen, M.; Simmonds, M.S.J. Molecules of interest: Rosmarinic acid. Phytochemistry 2003, 62, 121–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Hamaguchi, T.; Ono, K.; Murase, A.; Yamada, M. Phenolic compounds prevent Alzheimer’s pathology through different effects on the amyloid-β aggregation pathway. Am. J. Pathol. 2009, 175, 2557–2565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Mazzanti, G.; Battinelli, L.; Pompeo, C.; Serrilli, A.M.; Rossi, R.; Sauzullo, I.; Megoni, F.; Vullo, V. Inhibitory activity of Melissa officinalis L. extracts on Herpes simplex virus type 2 replication. Nat. Prod. Res. 2008, 23, 1433–1440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Al-Dhabi, N.A.; Arasu, M.V.; Park, C.H.; Park, S.U. Recent studies on rosmarinic acid and its biological and pharmacological activities. EXCLI J. 2014, 13, 1192–1195. [Google Scholar]
  32. Taha, R.A.; Hassan, M.M.; Ibrahim, E.A.; Abo-Bakr, N.H.; Shaaban, E.A. Carbon nanotubes impact on date palm in vitro cultures. Plant Cell Tissue Organ Cult. 2016, 127, 525–534. [Google Scholar] [CrossRef] [Scilit]
  33. Petersen, M. Rosmarinic acid: New aspects. Phytochem. Rev. 2013, 12, 207–227. [Google Scholar] [CrossRef] [Scilit]
  34. Petersen, M.; Abdullah, Y.; Benner, J.; Eberle, D.; Gehlen, K.; Hücherig, S.; Janiak, V.; Kim, K.H.; Sander, M.; Weitzel, C.; et al. Evolution of rosmarinic acid biosynthesis. Phytochemistry 2009, 70, 1663–1679. [Google Scholar] [CrossRef] [Scilit]
  35. Weitzel, C.; Petersen, M. Cloning and characterization of rosmarinic acid synthase from Melissa officinalis L. Phytochemistry 2011, 72, 572–578. [Google Scholar] [CrossRef] [Scilit]
  36. Deng, C.; Wang, Y.; Huang, F.; Lu, S.; Zhao, L.; Ma, X.; Kai, G. SmMYB2 promotes salvianolic acid biosynthesis in the medicinal herb Salvia miltiorrhiza. J. Integr. Plant. Biol. 2020, 62, 1688–1702. [Google Scholar] [CrossRef] [Scilit]
  37. Zhang, S.; Li, H.; Liang, X.; Yan, Y.; Xia, P.; Jia, Y.; Liang, Z. Enhanced production of phenolic acids in Salvia miltiorrhiza hairy root cultures by combing the RNAi-mediated silencing of chalcone synthase gene with salicylic acid treatment. Biochem. Eng. J. 2015, 103, 185–192. [Google Scholar] [CrossRef] [Scilit]
  38. Fu, R.; Shi, M.; Deng, C.; Zhang, Y.; Zhang, X.; Wang, Y.; Kai, G. Improved phenolic acid content and bioactivities of Salvia miltiorrhiza hairy roots by genetic manipulation of RAS and CYP98A14. Food Chem. 2020, 331, 127365. [Google Scholar] [CrossRef] [Scilit]
  39. Guerriero, G.; Berni, R.; Muñoz-Sanchez, J.A.; Apone, F.; Abdel-Salam, E.M.; Qahtan, A.A.; Alatar, A.A.; Cantini, C.; Cai, G.; Hausman, J.-F.; et al. Production of plant secondary metabolites: Examples, tips and suggestions for biotechnologists. Genes 2018, 9, 309. [Google Scholar] [CrossRef] [Scilit]
  40. Naik, P.M.; Al–Khayri, J.M. Abiotic and Biotic Elicitors—Role in Secondary Metabolites Production through In Vitro Culture of Medicinal Plants. In Abiotic and Biotic Stress in Plants—Recent Advances and Future Perspectives; Shanker, A.K., Shanker, C., Eds.; InTech: Rijeka, Croatia, 2016; pp. 247–278. [Google Scholar]
  41. Gonçalves, S.; Romano, A. Production of Plant Secondary Metabolites by Using Biotechnological Tools. In Secondary Metabolites: Sources and Applications; Vijayakumar, R., Raja, S.S.S., Eds.; InTech: Rijeka, Croatia, 2018. [Google Scholar]
  42. Sircar, D.; Cardoso, H.G.; Mukherjee, C.; Mitra, A.; Arnholdt-Schmitt, B. Alternative oxidase (AOX) and phenolic metabolism in methyl jasmonate-treated hairy root cultures of Daucus carota L. J. Plant Physiol. 2012, 169, 657–663. [Google Scholar] [CrossRef] [Scilit]
  43. Narayani, M.; Srivastava, S. Elicitation: A stimulation of stress in in vitro plant cell/tissue cultures for enhancement of secondary metabolite production. Phytochem. Rev. 2017, 16, 1227–1252. [Google Scholar] [CrossRef] [Scilit]
  44. Gai, Q.; Jiao, J.; Wang, X.; Zang, Y.; Niu, L.; Fu, Y. Elicitation of Isatis tinctoria L. hairy root cultures by salicylic acid and methyl jasmonate for the enhanced production of pharmacologically active alkaloids and flavonoids. Plant Cell Tissue Organ Cult. 2019, 137, 77–86. [Google Scholar] [CrossRef] [Scilit]
  45. Xing, B.; Yang, D.; Liu, L.; Han, R.; Sun, Y.; Liang, Z. Phenolic acid production is more effectively enhanced than tanshinone production by methyl jasmonate in Salvia miltiorrhiza hairy roots. Plant Cell Tissue Organ Cult. 2018, 134, 119–129. [Google Scholar] [CrossRef] [Scilit]
  46. Fatemi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Garagounis, C.; Papadopoulou, K. Identification and expression profiling of rosmarinic acid biosynthetic genes from Satureja khuzistanica under carbon nanotubes and methyl jasmonate elicitation. Plant Cell Tissue Organ Cult. 2019, 136, 561–573. [Google Scholar] [CrossRef] [Scilit]
  47. Kianersi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Rasheed, F. Identification and tissue-specific expression of rutin biosynthetic pathway genes in Capparis spinosa elicited with salicylic acid and methyl jasmonate. Sci. Rep. 2020, 10, 8884. [Google Scholar] [CrossRef] [Scilit]
  48. Kianersi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Rasheed, F. Biosynthesis of rutin changes in Capparis spinosa due to altered expression of its pathway genes under elicitors’ supplementation. Plant Cell Tissue Organ Cult. 2020, 141, 619–631. [Google Scholar] [CrossRef] [Scilit]
  49. Kianersi, F.; PourAboughadareh, A.; Majdi, M.; Poczai, P. Effect of Methyl Jasmonate on Thymol, Carvacrol, Phytochemical Accumulation, and Expression of Key Genes Involved in Thymol/Carvacrol Biosynthetic Pathway in Some Iranian Thyme Species. Int. J. Mol. Sci. 2021, 22, 11124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Kianersi, F.; Amin Azarm, D.; Pour-Aboughadareh, A.; Poczai, P. Change in Secondary Metabolites and Expression Pattern of Key Rosmarinic Acid Related Genes in Iranian Lemon Balm (Melissa officinalis L.) Ecotypes Using Methyl Jasmonate Treatments. Molecules 2022, 27, 1715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Abdollahi, M.R.; Kianersi, F.; Moosavi, S.S.; Dastan, D.; Asadi, S. Identification and Expression Analysis of Two Genes Involved in the Biosynthesis of t-Anethole in Fennel (Foeniculum vulgare Mill.) and Their Up-Regulation in Leaves in Response to Methyl Jasmonate Treatments. J. Plant Growth Regul. 2022, 42, 759–770. [Google Scholar] [CrossRef] [Scilit]
  52. Kianersi, F.; Amin Azarm, D.; Fatemi, F.; Pour-Aboughadareh, A.; Poczai, P. Methyl Jasmonate Induces Genes Involved in Linalool Accumulation and Increases the Content of Phenolics in Two Iranian Coriander (Coriandrum sativum L.) Ecotypes. Genes 2022, 13, 1717. [Google Scholar] [CrossRef] [Scilit]
  53. Zhang, S.; Yan, Y.; Wang, B.; Liang, Z.; Liu, Y.; Liu, F.; Qi, Z. Selective responses of enzymes in the two parallel pathways of rosmarinic acid biosynthetic pathway to elicitors in Salvia miltiorrhiza hairy root cultures. J. Biosci. Bioeng. 2014, 117, 645–651. [Google Scholar] [CrossRef] [Scilit]
  54. Yousefian, S.; Lohrasebi, T.; Farhadpour, M.; Haghbeen, K. Effect of methyl jasmonate on phenolic acids accumulation and the expression profile of their biosynthesis-related genes in Mentha spicata hairy root cultures. Plant Cell Tissue Organ Cult. 2020, 142, 285–297. [Google Scholar] [CrossRef] [Scilit]
  55. Kim, Y.B.; Kim, J.K.; Uddin, M.R.; Xu, H.; Park, W.T.; Tuan, P.A.; Li, X.; Chung, E.S.; Lee, J.-H.; Park, S.U. Metabolomics analysis and biosynthesis of rosmarinic acid in Agastache rugosa Kuntze treated with methyl jasmonate. PLoS ONE 2013, 8, e64199. [Google Scholar] [CrossRef] [Scilit]
  56. Stafiniak, M.; Ślusarczyk, S.; Pencakowski, B.; Matkowski, A.; Rahimmalek, M.; Bielecka, M. Seasonal Variations of Rosmarinic Acid and Its Glucoside and Expression of Genes Related to Their Biosynthesis in Two Medicinal and Aromatic Species of Salvia subg. Perovskia. Biology 2021, 10, 458. [Google Scholar] [CrossRef] [Scilit]
  57. Fatemi, F.; Abdollahi, M.R.; Mirzaie-Asl, A.; Dastan, D.; Papadopoulou, K. Phytochemical, antioxidant, enzyme activity and antifungal properties of Satureja khuzistanica in vitro and in vivo explants stimulated by some chemical elicitors. Pharm. Biol. 2020, 58, 286–296. [Google Scholar] [CrossRef] [Scilit]
  58. Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic acid signaling pathway in plants. Int. J. Mol. Sci. 2019, 20, 2479. [Google Scholar] [CrossRef] [Scilit]
  59. Xiao, Y.; Gao, S.; Di, P.; Chen, J.; Chen, W.; Zhang, L. Methyl jasmonate dramatically enhances the accumulation of phenolic acids in Salvia miltiorrhiza hairy root cultures. Physiol. Plant. 2009, 137, 1–9. [Google Scholar] [CrossRef] [Scilit]
  60. Park, W.T.; Arasu, M.V.; Al-Dhabi, N.A.; Yeo, S.K.; Jeon, J.; Park, J.S.; Lee, S.Y.; Park, S.U. Yeast extract and silver nitrate induce the expression of phenylpropanoid biosynthetic genes and induce the accumulation of rosmarinic acid in Agastache rugosa cell culture. Molecules 2016, 21, 426. [Google Scholar] [CrossRef] [Scilit]
  61. Kintzios, S.; Makri, O.; Panagiotopoulos, E.; Scapeti, M. In vitro rosmarinic acid accumulation in sweet basil (Ocimum basilicum L.). Biotechnol. Lett. 2003, 25, 405–408. [Google Scholar] [CrossRef] [Scilit]
  62. Mizukami, H.; Tabira, Y.; Ellis, B.E. Methyl jasmonate-induced rosmarinic acid biosynthesis in Lithospermum erythrorhizon cell suspension cultures. Plant. Cell. Rep. 1993, 12, 706–709. [Google Scholar] [CrossRef] [Scilit]
  63. Guan, Y.; Hu, W.; Jiang, A.; Xu, Y.; Sa, R.; Feng, K.; Zhao, M.; Yu, J.; Ji, Y.; Hou, M.; et al. Effect of Methyl Jasmonate on Phenolic Accumulation in Wounded Broccoli. Molecules 2019, 24, 3537. [Google Scholar] [CrossRef] [Scilit]
  64. Yamamoto, R.; Ma, G.; Zhang, L.; Hirai, M.; Yahata, M.; Yamawaki, K.; Shimada, T.; Fujii, H.; Endo, T.; Kato, M. Effects of Salicylic Acid and Methyl Jasmonate Treatments on Flavonoid and Carotenoid Accumulation in the Juice Sacs of Satsuma Mandarin In Vitro. Appl. Sci. 2020, 10, 8916. [Google Scholar] [CrossRef] [Scilit]
  65. Salami, M.; Rahimmalek, M.; Ehtemam, M.H. Inhibitory effect of different fennel (Foeniculum vulgare) samples and their phenolic compounds on formation of advanced glycation products and comparison of antimicrobial and antioxidant activities. Food Chem. 2016, 213, 196–205. [Google Scholar] [CrossRef] [Scilit]
  66. Roby, M.H.H.; Sarhana, M.A.; Selima, K.A.; Khalela, K.I. Antioxidant and Antimicrobial Activities of Essential Oil and Extracts of Fennel (Foeniculum vulgare L.) and Chamomile (Matricaria chamomilla L.). Ind. Crops Prod. 2013, 44, 437–445. [Google Scholar] [CrossRef] [Scilit]
  67. Kim, H.J.; Chen, F.; Wang, X.; Choi, J.H. Effect of methyl jasmonate on phenolics, isothiocyanate, and metabolic enzymes in radish sprout (Raphanus sativus L.). J. Agric. Food. Chem. 2006, 54, 7263–7269. [Google Scholar] [CrossRef] [Scilit]
  68. Kim, H.J.; Chen, F.; Wang, X.; Rajapakse, N.C. Effect of methyl jasmonate on secondary metabolites of sweet basil (Ocimum basilicum L.). J. Agric. Food. Chem. 2006, 54, 2327–2332. [Google Scholar] [CrossRef] [Scilit]
  69. Kim, H.J.; Park, K.J.; Lim, J.H. Metabolomic analysis of phenolic compounds in buckwheat (Fagopyrum esculentum M.) sprouts treated with methyl jasmonate. J. Agric. Food. Chem. 2011, 59, 5707–5713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Awasthi, P.; Mahajan, V.; Jamwal, V.L.; Chouhan, R.; Kapoor, N.; Bedi, Y.S.; Gandhi, S.G. Characterization of the gene encoding 4-coumarate: CoA ligase in Coleus forskohlii. J. Plant. Biochem. Biotechnol. 2019, 28, 203–210. [Google Scholar] [CrossRef] [Scilit]
  71. Deng, Y.; Li, C.; Li, H.; Lu, S.; Iriti, M. Identification and characterization of flavonoid biosynthetic enzyme genes in Salvia miltiorrhiza (Lamiaceae). Molecules 2018, 23, 1467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Park, C.H.; Yeo, H.J.; Park, Y.E.; Chun, S.W.; Chung, Y.S.; Lee, S.Y.; Park, S.U. Influence of Chitosan, Salicylic Acid and Jasmonic Acid on Phenylpropanoid Accumulation in Germinated Buckwheat (Fagopyrum esculentum Moench). Foods 2019, 8, 153. [Google Scholar] [CrossRef] [Scilit]
  73. Jaafar, H.Z.; Ibrahim, M.H.; Mohamad-Fakri, N.F. Impact of soil field water capacity on secondary metabolites, phenylalanine ammonia-lyase (PAL), maliondialdehyde (MDA) and photosynthetic responses of Malaysian Kacip Fatimah (Labisia pumila Benth). Molecules 2012, 17, 7305–7322. [Google Scholar] [CrossRef] [Scilit]
  74. Zhou, P.; Li, Q.; Liu, G.; Xu, N.; Yang, Y.; Zeng, W.; Chen, A.; Wang, S. Integrated analysis of transcriptomic and metabolomic data reveals critical metabolic pathways involved in polyphenol biosynthesis in Nicotiana tabacum under chilling stress. Funct. Plant Biol. 2018, 46, 30–43. [Google Scholar] [CrossRef] [Scilit]
  75. Gharibi, S.; Sayed Tabatabaei, B.E.; Saeidi, G.; Talebi, M.; Matkowski, A. The effect of drought stress on polyphenolic compounds and expression of flavonoid biosynthesis related genes in Achillea pachycephala Rech.f. Phytochemistry 2019, 162, 90–98. [Google Scholar] [CrossRef] [Scilit]
  76. Majdi, M.; Abdollahi, M.R.; Maroufi, A. Parthenolide accumulation and expression of genes related to parthenolide biosynthesis affected by exogenous application of methyl jasmonate and salicylic acid in Tanacetum parthenium. Plant. Cell. Rep. 2015, 34, 1909–1918. [Google Scholar] [CrossRef] [Scilit]
  77. Elyasi, R.; Majdi, M.; Bahramnejad, B.; Mirzaghaderi, G. Spatial modulation and abiotic elicitors responses of the biosynthesis related genes of mono/triterpenes in black cumin (Nigella sativa). Ind. Crops Prod. 2016, 79, 240–247. [Google Scholar] [CrossRef] [Scilit]
  78. Brouki Milan, E.; Mandoulakani, B.A.; Kheradmand, F. The effect of methyl jasmonate on the expression of phenylalanine ammonia lyase and eugenol-o-methyl transferase genes in basil. Philipp. Agric. Sci. 2017, 100, 163–167. [Google Scholar]
  79. Chezem, W.R.; Clay, N.K. Regulation of plant secondary metabolism and associated specialized cell development by MYBs and bHLHs. Phytochemistry 2016, 131, 26–43. [Google Scholar] [CrossRef] [Scilit]
  80. Açıkgoz, M. Establishment of cell suspension cultures of Ocimum basilicum L. and enhanced production of pharmaceutical active ingredients. Ind. Crops Prod. 2020, 148, e112278. [Google Scholar] [CrossRef] [Scilit]
  81. Li, X.; Kim, J.K.; Park, S.U. Molecular cloning and characterization of rosmarinic acid biosynthetic genes and rosmarinic acid accumulation in Ocimum basilicum L. Saudi. J. Biol. Sci. 2017, 26, 469–472. [Google Scholar]
  82. Thiyagarajan, K.; Vitali, F.; Tolaini, V.; Galeffi, P.; Cantale, C.; Vikram, P.; Singh, S.; De Rossi, P.; Nobili, C.; Procacci, S.; et al. Genomic characterization of phenylalanine ammonia lyase gene in buckwheat. PLoS ONE 2016, 11, 151187. [Google Scholar] [CrossRef] [Scilit]
  83. Hao, X.; Pu, Z.; Cao, G.; You, D.; Zhou, Y.; Deng, C.; Shi, M.; Nile, S.H.; Wang, Y.; Zhou, W.; et al. Tanshinone and salvianolic acid biosynthesis are regulated bySmMYB98 in Salvia miltiorrhiza hairy roots. J. Adv. Res. 2020, 23, 1–12. [Google Scholar] [CrossRef] [Scilit]
  84. Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.H.; Yu, J.Q.; Chen, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef] [Scilit]
  85. Cocetta, G.; Rossoni, M.; Gardana, C.; Mignani, I.; Ferrante, A.; Spinardi, A. Methyl jasmonate affects phenolic metabolism and gene expression in blueberry (Vaccinium corymbosum). Physiol. Plant. 2015, 153, 269–283. [Google Scholar] [CrossRef] [Scilit]
  86. Biswas, T. Elicitor induced increased rosmarinic acid content of in vitro root cultures of Ocimum basilicum L. (Sweet Basil). Plant Sci. Today 2020, 7, 157–163. [Google Scholar] [CrossRef] [Scilit]
  87. Sarabandi, M.; Farokhzad, A.; Mandoulakani, B.A.; Ghasemzadeh, R. Biochemical and gene expression responses of two Iranian grape cultivars to foliar application of methyl jasmonate under boron toxicity conditions. Sci. Hort. 2019, 249, 355–363. [Google Scholar] [CrossRef] [Scilit]
  88. Belhadj, A.; Saigne, C.; Telef, N.; Cluzet, S.; Bouscaut, J.; Corio-Costet, M.F.; Mérillon, J.M. Methyl jasmonate induces defense responses in grapevine and triggers protection against Erysiphe necator. J. Agric. Food Chem. 2006, 54, 9119–9125. [Google Scholar] [CrossRef] [Scilit]
  89. Farooq, M.A.; Gill, R.A.; Islam, F.; Ali, B.; Liu, H.; Xu, J.; He, S.; Zhou, W. Methyl jasmonate regulates antioxidant defense and suppresses arsenic uptake in Brassica napus L. Front. Plant Sci. 2016, 7, 468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  91. Skendi, A.; Irakli, M.; Chatzopoulou, P. Analysis of phenolic compounds in Greek plants of Lamiaceae family by HPLC. J. Appl. Res. Med. Aromat. Plants 2017, 6, 62–69. [Google Scholar] [CrossRef] [Scilit]
  92. Zhang, D.Y.; Yao, X.H.; Duan, M.H.; Wei, F.Y.; Wu, G.H.; Li, L. Variation of essential oil content and antioxidant activity of Lonicera species in different sites of China. Ind. Crops Prod. 2015, 77, 772–779. [Google Scholar] [CrossRef] [Scilit]
Figure 1. The biosynthesis of rosmarinic acid. The enzyme genes for phenylalanine ammonia lyase (PAL), 4-coumarate-CoA ligase (4CL), and rosmarinic acid synthase (RAS), among others, are marked with an asterisk.
Figure 1. The biosynthesis of rosmarinic acid. The enzyme genes for phenylalanine ammonia lyase (PAL), 4-coumarate-CoA ligase (4CL), and rosmarinic acid synthase (RAS), among others, are marked with an asterisk.
Genes 14 00871 g001
Figure 2. Concentration of rosmarinic acid in two species of Salvia (subgenus Perovskia Kar). Duncan’s test claims that bars labeled differently reflect statistical significance at the 1% level. Error bars represent the standard deviation of the data. Means followed by the same letters in each column are not significantly different (p < 0.01).
Figure 2. Concentration of rosmarinic acid in two species of Salvia (subgenus Perovskia Kar). Duncan’s test claims that bars labeled differently reflect statistical significance at the 1% level. Error bars represent the standard deviation of the data. Means followed by the same letters in each column are not significantly different (p < 0.01).
Genes 14 00871 g002
Figure 3. The effects of MeJA on TPC (A) and TFC (B) in two species of the genus Salvia, subgenus Perovskia Kar. Means and standard deviations (n = 3) are shown for the data. Duncan’s test claims that if there are different letters in each column, then it is statistically significant at the 1% level. Error bars depict the standard error values. Means followed by the same letters in each column are not significantly different (p < 0.01).
Figure 3. The effects of MeJA on TPC (A) and TFC (B) in two species of the genus Salvia, subgenus Perovskia Kar. Means and standard deviations (n = 3) are shown for the data. Duncan’s test claims that if there are different letters in each column, then it is statistically significant at the 1% level. Error bars depict the standard error values. Means followed by the same letters in each column are not significantly different (p < 0.01).
Genes 14 00871 g003
Figure 4. The relative expression of PAL (A), 4CL (B), and RAS (C) genes in the control and MeJA-treated Salvia plants (fold-changed). Duncan’s test indicates a statistically significant (p ≤ 0.01) difference between bars labeled with different letters. Error bars depict the standard error values. Means followed by the same letters in each column are not significantly different (p < 0.01).
Figure 4. The relative expression of PAL (A), 4CL (B), and RAS (C) genes in the control and MeJA-treated Salvia plants (fold-changed). Duncan’s test indicates a statistically significant (p ≤ 0.01) difference between bars labeled with different letters. Error bars depict the standard error values. Means followed by the same letters in each column are not significantly different (p < 0.01).
Genes 14 00871 g004
Figure 5. Quantitative analysis of total phenolic (A) and flavonoid content using a standard curve (B).
Figure 5. Quantitative analysis of total phenolic (A) and flavonoid content using a standard curve (B).
Genes 14 00871 g005
Table 1. Primers applied to real-time PCR analysis.
Table 1. Primers applied to real-time PCR analysis.
Real-Time PrimersSequences (5′ to 3′)
PAL F
PAL R
ACATCCTGGCCGTCCTATC
GTCCTGCTCGTGCAGCTT
4CL F
4CL R
GCGATCTTGATCATGCAGAA
AAGGTCATATTTGCCCACCA
RAS F
RAS R
TCGATTTCTTGGAGCTGCAG
GCACCCAACTAATCACCCAAAG
Actin
Actin
ACCTCAAAATAGCATGGGGAAGT
GGCCGTTCTCTCACTTTATGCTA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kianersi, F.; Amin Azarm, D.; Fatemi, F.; Jamshidi, B.; Pour-Aboughadareh, A.; Janda, T. The Influence of Methyl Jasmonate on Expression Patterns of Rosmarinic Acid Biosynthesis Genes, and Phenolic Compounds in Different Species of Salvia subg. Perovskia Kar L. Genes 2023, 14, 871. https://doi.org/10.3390/genes14040871

AMA Style

Kianersi F, Amin Azarm D, Fatemi F, Jamshidi B, Pour-Aboughadareh A, Janda T. The Influence of Methyl Jasmonate on Expression Patterns of Rosmarinic Acid Biosynthesis Genes, and Phenolic Compounds in Different Species of Salvia subg. Perovskia Kar L. Genes. 2023; 14(4):871. https://doi.org/10.3390/genes14040871

Chicago/Turabian Style

Kianersi, Farzad, Davood Amin Azarm, Farzaneh Fatemi, Bita Jamshidi, Alireza Pour-Aboughadareh, and Tibor Janda. 2023. "The Influence of Methyl Jasmonate on Expression Patterns of Rosmarinic Acid Biosynthesis Genes, and Phenolic Compounds in Different Species of Salvia subg. Perovskia Kar L." Genes 14, no. 4: 871. https://doi.org/10.3390/genes14040871

APA Style

Kianersi, F., Amin Azarm, D., Fatemi, F., Jamshidi, B., Pour-Aboughadareh, A., & Janda, T. (2023). The Influence of Methyl Jasmonate on Expression Patterns of Rosmarinic Acid Biosynthesis Genes, and Phenolic Compounds in Different Species of Salvia subg. Perovskia Kar L. Genes, 14(4), 871. https://doi.org/10.3390/genes14040871

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop