Prenatal Environmental Stressors and DNA Methylation Levels in Placenta and Peripheral Tissues of Mothers and Neonates Evaluated by Applying Artificial Neural Networks
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Samples Collection and DNA Extraction
2.3. Study Questionnaire
2.4. DNA Methylation Analyses (HRM and Global Methylation)
2.5. Evaluation of Metals and Dioxins Concentrations in the Placenta
2.6. Artificial Neural Networks
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hoffman, D.J.; Reynolds, R.M.; Hardy, D.B. Developmental origins of health and disease: Current knowledge and potential mechanisms. Nutr. Rev. 2017, 75, 951–970. [Google Scholar] [CrossRef] [PubMed]
- Barker, D.J.P. The developmental origins of adult disease. Eur. J. Epidemiol. 2003, 18, 733–736. [Google Scholar] [CrossRef] [PubMed]
- Caspersen, I.H.; Aase, H.; Biele, G.; Brantsæter, A.L.; Haugen, M.; Kvalem, H.E.; Skogan, A.H.; Zeiner, P.; Alexander, J.; Meltzer, H.M.; et al. The influence of maternal dietary exposure to dioxins and PCBs during pregnancy on ADHD symptoms and cognitive functions in Norwegian preschool children. Environ. Int. 2016, 94, 649–660. [Google Scholar] [CrossRef] [PubMed]
- Dórea, J.G. Environmental exposure to low-level lead (Pb) co-occurring with other neurotoxicants in early life and neurodevelopment of children. Environ. Res. 2019, 177, 108641. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Roig, M.D.; Pascal, R.; Cahuana, M.J.; García-Algar, O.; Sebastiani, G.; Andreu-Fernández, V.; Martínez, L.; Rodríguez, G.; Iglesia, I.; Ortiz-Arrabal, O.; et al. Environmental Exposure during Pregnancy: Influence on Prenatal Development and Early Life: A Comprehensive Review. Fetal Diagn. Ther. 2021, 48, 245–257. [Google Scholar] [CrossRef] [PubMed]
- Jirtle, R.L.; Skinner, M.K. Environmental epigenomics and disease susceptibility. Nat. Rev. Genet. 2007, 8, 253–262. [Google Scholar] [CrossRef]
- Feil, R.; Fraga, M.F. Epigenetics and the environment: Emerging patterns and implications. Nat. Rev. Genet. 2012, 13, 97–109. [Google Scholar] [CrossRef]
- Cavalli, G.; Heard, E. Advances in epigenetics link genetics to the environment and disease. Nature 2019, 571, 489–499. [Google Scholar] [CrossRef]
- Marsit, C.J. Placental Epigenetics in Children’s Environmental Health. Semin. Reprod. Med. 2016, 34, 36–41. [Google Scholar] [CrossRef]
- Jedynak, P.; Tost, J.; Calafat, A.M.; Bourova-Flin, E.; Busato, F.; Forhan, A.; Heude, B.; Jakobi, M.; Rousseaux, S.; Schwartz, J.; et al. Pregnancy exposure to synthetic phenols and placental DNA methylation—An epigenome-wide association study in male infants from the EDEN cohort. Environ. Pollut. 2021, 290, 118024. [Google Scholar] [CrossRef]
- Cosin-Tomas, M.; Cilleros-Portet, A.; Aguilar-Lacasaña, S.; Fernandez-Jimenez, N.; Bustamante, M. Prenatal Maternal Smoke, DNA Methylation, and Multi-omics of Tissues and Child Health. Curr. Environ. Health Rep. 2022, 9, 502–512. [Google Scholar] [CrossRef]
- Lapehn, S.; Paquette, A.G. The Placental Epigenome as a Molecular Link Between Prenatal Exposures and Fetal Health Outcomes Through the DOHaD Hypothesis. Curr. Environ. Health Rep. 2022, 9, 490–501. [Google Scholar] [CrossRef]
- Mortillo, M.; Marsit, C.J. Select Early-Life Environmental Exposures and DNA Methylation in the Placenta. Curr. Environ. Health Rep. 2022, 10, 22–34. [Google Scholar] [CrossRef]
- Hogg, K.; Blair, J.D.; von Dadelszen, P.; Robinson, W.P. Hypomethylation of the LEP gene in placenta and elevated maternal leptin concentration in early onset pre-eclampsia. Mol. Cell. Endocrinol. 2013, 367, 64–73. [Google Scholar] [CrossRef]
- Lesseur, C.; Armstrong, D.A.; Paquette, A.G.; Li, Z.; Padbury, J.F.; Marsit, C.J. Maternal obesity and gestational diabetes are associated with placental leptin DNA methylation. Am. J. Obstet. Gynecol. 2014, 211, 654.e1–654.e9. [Google Scholar] [CrossRef]
- Allard, C.; Desgagné, V.; Patenaude, J.; Lacroix, M.; Guillemette, L.; Battista, M.; Doyon, M.; Ménard, J.; Ardilouze, J.; Perron, P.; et al. Mendelian randomization supports causality between maternal hyperglycemia and epigenetic regulation of leptin gene in newborns. Epigenetics 2015, 10, 342–351. [Google Scholar] [CrossRef]
- Kadakia, R.; Zheng, Y.; Zhang, Z.; Zhang, W.; Hou, L.; Josefson, J.L. Maternal pre-pregnancy BMI downregulates neonatal cord bloodLEPmethylation. Pediatr. Obes. 2017, 12 (Suppl. 1), 57–64. [Google Scholar] [CrossRef]
- Tobi, E.W.; Slieker, R.C.; Luijk, R.; Dekkers, K.F.; Stein, A.D.; Xu, K.M.; Slagboom, P.E.; van Zwet, E.W.; Lumey, L.H.; Heijmans, B.T.; et al. DNA methylation as a mediator of the association between prenatal adversity and risk factors for metabolic disease in adulthood. Sci. Adv. 2018, 4, eaao4364. [Google Scholar] [CrossRef]
- Shen, L.; Li, C.; Wang, Z.; Zhang, R.; Shen, Y.; Miles, T.; Wei, J.; Zou, Z. Early-life exposure to severe famine is associated with higher methylation level in the IGF2 gene and higher total cholesterol in late adulthood: The Genomic Research of the Chinese Famine (GRECF) study. Clin. Epigenetics 2019, 11, 88. [Google Scholar] [CrossRef]
- Mansell, T.; Ponsonby, A.-L.; Collier, F.; Burgner, D.; Vuillermin, P.; Lange, K.; Ryan, J.; Saffery, R.; Barwon Infant Study Investigator Team. Genetic variation, intrauterine growth, and adverse pregnancy conditions predict leptin gene DNA methylation in blood at birth and 12 months of age. Int. J. Obes. 2020, 44, 45–56. [Google Scholar] [CrossRef]
- Joubert, B.R.; Håberg, S.E.; Nilsen, R.M.; Wang, X.; Vollset, S.E.; Murphy, S.K.; Huang, Z.; Hoyo, C.; Midttun, Ø.; Cupul-Uicab, L.A.; et al. 450K Epigenome-Wide Scan Identifies Differential DNA Methylation in Newborns Related to Maternal Smoking during Pregnancy. Environ. Health Perspect. 2012, 120, 1425–1431. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, C.H.; Larsen, A.; Nielsen, A.L. DNA methylation alterations in response to prenatal exposure of maternal cigarette smoking: A persistent epigenetic impact on health from maternal lifestyle? Arch. Toxicol. 2016, 90, 231–245. [Google Scholar] [CrossRef] [PubMed]
- Braithwaite, E.; Kundakovic, M.; Ramchandani, P.; Murphy, S.; Champagne, F. Maternal prenatal depressive symptoms predict infantNR3C11F andBDNFIV DNA methylation. Epigenetics 2015, 10, 408–417. [Google Scholar] [CrossRef] [PubMed]
- Joubert, B.R.; Felix, J.F.; Yousefi, P.; Bakulski, K.M.; Just, A.C.; Breton, C.; Reese, S.E.; Markunas, C.A.; Richmond, R.C.; Xu, C.-J.; et al. DNA Methylation in Newborns and Maternal Smoking in Pregnancy: Genome-wide Consortium Meta-analysis. Am. J. Hum. Genet. 2016, 98, 680–696. [Google Scholar] [CrossRef]
- Unternaehrer, E.; Meyer, A.H.; Burkhardt, S.C.A.; Dempster, E.; Staehli, S.; Theill, N.; Lieb, R.; Meinlschmidt, G. Childhood maternal care is associated with DNA methylation of the genes for brain-derived neurotrophic factor (BDNF) and oxytocin receptor (OXTR) in peripheral blood cells in adult men and women. Stress 2015, 18, 451–461. [Google Scholar] [CrossRef]
- Vidrascu, E.M.; Bashore, A.C.; Howard, T.D.; Moore, J.B. Effects of early- and mid-life stress on DNA methylation of genes associated with subclinical cardiovascular disease and cognitive impairment: A systematic review. BMC Med. Genet. 2019, 20, 39. [Google Scholar] [CrossRef]
- Xu, R.; Hong, X.; Zhang, B.; Huang, W.; Hou, W.; Wang, G.; Wang, X.; Igusa, T.; Liang, L.; Ji, H. DNA methylation mediates the effect of maternal smoking on offspring birthweight: A birth cohort study of multi-ethnic US mother–newborn pairs. Clin. Epigenetics 2021, 13, 47. [Google Scholar] [CrossRef]
- Kutlay, A.; Son, Y.A. Integrative Predictive Modeling of Metastasis in Melanoma Cancer Based on MicroRNA, mRNA, and DNA Methylation Data. Front. Mol. Biosci. 2021, 8, 637355. [Google Scholar] [CrossRef]
- Thong, Z.; Tan, J.Y.Y.; Loo, E.S.; Phua, Y.W.; Chan, X.L.S.; Syn, C.K.-C. Artificial neural network, predictor variables and sensitivity threshold for DNA methylation-based age prediction using blood samples. Sci. Rep. 2021, 11, 1744. [Google Scholar] [CrossRef]
- Zhao, T.; Zeng, J.; Cheng, H. Extend mixed models to multilayer neural networks for genomic prediction including intermediate omics data. Genetics 2022, 221, iyac034. [Google Scholar] [CrossRef]
- Coppedè, F.; Grossi, E.; Lopomo, A.; Spisni, R.; Buscema, M.; Migliore, L. Application of artificial neural networks to link genetic and environmental factors to DNA methylation in colorectal cancer. Epigenomics 2015, 7, 175–186. [Google Scholar] [CrossRef]
- Gallucci, M.; Pallucca, C.; Di Battista, M.E.; Fougère, B.; Grossi, E. Artificial Neural Networks Help to Better Understand the Interplay Between Cognition, Mediterranean Diet, and Physical Performance: Clues from TRELONG Study. J. Alzheimer’s Dis. 2019, 71, 1321–1330. [Google Scholar] [CrossRef]
- Stoccoro, A.; Gallo, R.; Calderoni, S.; Cagiano, R.; Muratori, F.; Migliore, L.; Grossi, E.; Coppedè, F. Artificial neural networks reveal sex differences in gene methylation, and connections between maternal risk factors and symptom severity in autism spectrum disorder. Epigenomics 2022, 14, 1181–1195. [Google Scholar] [CrossRef]
- Grossi, E.; Migliore, L.; Muratori, F. Pregnancy risk factors related to autism: An Italian case–control study in mothers of children with autism spectrum disorders (ASD), their siblings and of typically developing children. J. Dev. Orig. Health Dis. 2018, 9, 442–449. [Google Scholar] [CrossRef]
- Migheli, F.; Stoccoro, A.; Coppedè, F.; Omar, W.A.W.; Failli, A.; Consolini, R.; Seccia, M.; Spisni, R.; Miccoli, P.; Mathers, J.C.; et al. Comparison Study of MS-HRM and Pyrosequencing Techniques for Quantification of APC and CDKN2A Gene Methylation. PLoS ONE 2013, 8, e52501. [Google Scholar] [CrossRef]
- Van Den Berg, M.; Birnbaum, L.S.; Denison, M.; De Vito, M.; Farland, W.; Feeley, M.; Fiedler, H.; Håkansson, H.; Hanberg, A.; Haws, L.; et al. The 2005 World Health Organization Reevaluation of Human and Mammalian Toxic Equivalency Factors for Dioxins and Dioxin-Like Compounds. Toxicol. Sci. 2006, 93, 223–241. [Google Scholar] [CrossRef]
- Buscema, M.; Grossi, E.; Snowdon, D.; Antuono, P. Auto-Contractive Maps: An Artificial Adaptive System for Data Mining. An Application to Alzheimer Disease. Curr. Alzheimer Res. 2008, 5, 481–498. [Google Scholar] [CrossRef]
- Schanton, M.; Maymó, J.L.; Pérez-Pérez, A.; Sánchez-Margalet, V.; Varone, C.L. Involvement of leptin in the molecular physiology of the placenta. Reproduction 2018, 155, R1–R12. [Google Scholar] [CrossRef]
- Buckberry, S.; Bianco-Miotto, T.; Roberts, C.T. Imprinted and X-linked non-coding RNAs as potential regulators of human placental function. Epigenetics 2014, 9, 81–89. [Google Scholar] [CrossRef]
- Torres-Andrade, R.; Moldenhauer, R.; Gutierrez-Bertín, N.; Soto-Covasich, J.; Mancilla-Medina, C.; Ehrenfeld, C.; Kerr, B. The increase in body weight induced by lack of methyl CpG binding protein-2 is associated with altered leptin signalling in the hypothalamus. Exp. Physiol. 2014, 99, 1229–1240. [Google Scholar] [CrossRef]
- Wang, X.; Lacza, Z.; Sun, Y.E.; Han, W. Leptin resistance and obesity in mice with deletion of methyl-CpG-binding protein 2 (MeCP2) in hypothalamic pro-opiomelanocortin (POMC) neurons. Diabetologia 2014, 57, 236–245. [Google Scholar] [CrossRef] [PubMed]
- Bourque, D.; Avila, L.; Peñaherrera, M.; von Dadelszen, P.; Robinson, W. Decreased Placental Methylation at the H19/IGF2 Imprinting Control Region is Associated with Normotensive Intrauterine Growth Restriction but not Preeclampsia. Placenta 2010, 31, 197–202. [Google Scholar] [CrossRef] [PubMed]
- St-Pierre, J.; Hivert, M.-F.; Perron, P.; Poirier, P.; Guay, S.-P.; Brisson, D.; Bouchard, L. IGF2 DNA methylation is a modulator of newborn’s fetal growth and development. Epigenetics 2012, 7, 1125–1132. [Google Scholar] [CrossRef] [PubMed]
- Su, R.; Wang, C.; Feng, H.; Lin, L.; Liu, X.; Wei, Y.; Yang, H. Alteration in Expression and Methylation of IGF2/H19 in Placenta and Umbilical Cord Blood Are Associated with Macrosomia Exposed to Intrauterine Hyperglycemia. PLoS ONE 2016, 11, e0148399. [Google Scholar] [CrossRef] [PubMed]
- Kappil, M.A.; Green, B.B.; Armstrong, D.A.; Sharp, A.J.; Lambertini, L.; Marsit, C.J.; Chen, J. Placental expression profile of imprinted genes impacts birth weight. Epigenetics 2015, 10, 842–849. [Google Scholar] [CrossRef]
- Zhang, S.; Zhai, G.; Wang, J.; Shi, W.; Zhang, R.; Chen, C. IGF-II expression and methylation in small for gestational age infants. J. Pediatr. Endocrinol. Metab. 2015, 28, 613–618. [Google Scholar] [CrossRef]
- Murphy, R.; Thompson, J.; Tost, J.; Mitchell, E.A.; Auckland Birthweight Collaborative Study Group. No evidence for copy number and methylation variation in H19 and KCNQ10T1 imprinting control regions in children born small for gestational age. BMC Med. Genet. 2014, 15, 67. [Google Scholar] [CrossRef]
- Leeuwerke, M.; Eilander, M.S.; Pruis, M.G.; Lendvai, Á.; Erwich, J.J.H.; Scherjon, S.A.; Plösch, T.; Eijsink, J.J. DNA Methylation and Expression Patterns of Selected Genes in First-Trimester Placental Tissue from Pregnancies with Small-for-Gestational-Age Infants at Birth. Biol. Reprod. 2016, 94, 37. [Google Scholar] [CrossRef]
- Piyasena, C.; Reynolds, R.; Khulan, B.; Seckl, J.R.; Menon, G.; Drake, A.J. Placental 5-methylcytosine and 5-hydroxymethylcytosine patterns associate with size at birth. Epigenetics 2015, 10, 692–697. [Google Scholar] [CrossRef]
- Tsunoda, Y.; Kudo, M.; Wada, R.; Ishino, K.; Kure, S.; Sakatani, T.; Takeshita, T.; Naito, Z. Expression level of long noncoding RNA H19 of normotensive placentas in late pregnancy relates to the fetal growth restriction. J. Obstet. Gynaecol. Res. 2020, 46, 1025–1034. [Google Scholar] [CrossRef]
- Kertes, D.A.; Bhatt, S.S.; Kamin, H.S.; Hughes, D.A.; Rodney, N.C.; Mulligan, C.J. BNDF methylation in mothers and newborns is associated with maternal exposure to war trauma. Clin. Epigenetics 2017, 9, 68. [Google Scholar] [CrossRef]
- Oberlander, T.F.; Weinberg, J.; Papsdorf, M.; Grunau, R.; Misri, S.; Devlin, A.M. Prenatal exposure to maternal depression, neonatal methylation of human glucocorticoid receptor gene (NR3C1) and infant cortisol stress responses. Epigenetics 2008, 3, 97–106. [Google Scholar] [CrossRef]
- Li, J.; Zhang, X.; He, Z.; Sun, Q.; Qin, F.; Huang, Z.; Zhang, X.; Sun, X.; Liu, L.; Chen, L.; et al. MGMThypomethylation is associated with DNA damage in workers exposed to low-dose benzene. Biomarkers 2017, 22, 470–475. [Google Scholar] [CrossRef]
- Ren, J.; Cui, J.-P.; Luo, M.; Liu, H.; Hao, P.; Wang, X.; Zhang, G.-H. The prevalence and persistence of aberrant promoter DNA methylation in benzene-exposed Chinese workers. PLoS ONE 2019, 14, e0220500. [Google Scholar] [CrossRef]
- Rusiecki, J.A.; Freeman, L.E.B.; Bonner, M.R.; Alexander, M.; Chen, L.; Andreotti, G.; Barry, K.H.; Moore, L.E.; Byun, H.-M.; Kamel, F.; et al. High pesticide exposure events and DNA methylation among pesticide applicators in the agricultural health study. Environ. Mol. Mutagen. 2017, 58, 19–29. [Google Scholar] [CrossRef]
- Zhang, X.; Li, J.; He, Z.; Duan, H.; Gao, W.; Wang, H.; Yu, S.; Chen, W.; Zheng, Y. Associations between DNA methylation in DNA damage response-related genes and cytokinesis-block micronucleus cytome index in diesel engine exhaust-exposed workers. Arch. Toxicol. 2016, 90, 1997–2008. [Google Scholar] [CrossRef]
- Rapado-González, Ó.; Martínez-Reglero, C.; Salgado-Barreira, Á.; Santos, M.; López-López, R.; Díaz-Lagares, Á.; Suárez-Cunqueiro, M. Salivary DNA Methylation as an Epigenetic Biomarker for Head and Neck Cancer. Part II: A Cancer Risk Meta-Analysis. J. Pers. Med. 2021, 11, 606. [Google Scholar] [CrossRef]
- Appleton, A.A.; Jackson, B.P.; Karagas, M.; Marsit, C.J. Prenatal exposure to neurotoxic metals is associated with increased placental glucocorticoid receptor DNA methylation. Epigenetics 2017, 12, 607–615. [Google Scholar] [CrossRef]
- Everson, T.; Punshon, T.; Jackson, B.P.; Hao, K.; Lambertini, L.; Chen, J.; Karagas, M.R.; Marsit, C.J. Cadmium-Associated Differential Methylation throughout the Placental Genome: Epigenome-Wide Association Study of Two U.S. Birth Cohorts. Environ. Health Perspect. 2018, 126, 017010. [Google Scholar] [CrossRef]
- Maccani, J.Z.; Koestler, D.C.; Lester, B.; Houseman, E.A.; Armstrong, D.A.; Kelsey, K.T.; Marsit, C.J. Placental DNA Methylation Related to Both Infant Toenail Mercury and Adverse Neurobehavioral Outcomes. Environ. Health Perspect. 2015, 123, 723–729. [Google Scholar] [CrossRef]
- Llanos, M.N.; Ronco, A.M. Fetal growth restriction is related to placental levels of cadmium, lead and arsenic but not with antioxidant activities. Reprod. Toxicol. 2009, 27, 88–92. [Google Scholar] [CrossRef] [PubMed]
- Svoboda, L.K.; Neier, K.; Wang, K.; Cavalcante, R.G.; Rygiel, C.A.; Tsai, Z.; Jones, T.R.; Liu, S.; Goodrich, J.M.; Lalancette, C.; et al. Tissue and sex-specific programming of DNA methylation by perinatal lead exposure: Implications for environmental epigenetics studies. Epigenetics 2021, 16, 1102–1122. [Google Scholar] [CrossRef] [PubMed]
- McCabe, C.F.; Padmanabhan, V.; Dolinoy, D.C.; Domino, S.E.; Jones, T.R.; Bakulski, K.M.; Goodrich, J.M. Maternal environmental exposure to bisphenols and epigenome-wide DNA methylation in infant cord blood. Environ. Epigenetics 2020, 6, dvaa021. [Google Scholar] [CrossRef] [PubMed]
- Laufer, B.I.; Neier, K.; Valenzuela, A.E.; Yasui, D.H.; Schmidt, R.J.; Lein, P.J.; LaSalle, J.M. Placenta and fetal brain share a neurodevelopmental disorder DNA methylation profile in a mouse model of prenatal PCB exposure. Cell Rep. 2022, 38, 110442. [Google Scholar] [CrossRef]
- Monk, D. Genomic imprinting in the human placenta. Am. J. Obstet. Gynecol. 2015, 213, S152–S162. [Google Scholar] [CrossRef]
- Jima, D.D.; Skaar, D.A.; Planchart, A.; Motsinger-Reif, A.; Cevik, S.E.; Park, S.S.; Cowley, M.; Wright, F.; House, J.; Liu, A.; et al. Genomic map of candidate human imprint control regions: The imprintome. Epigenetics 2022, 17, 1920–1943. [Google Scholar] [CrossRef]
- Cassidy, F.C.; Charalambous, M. Genomic imprinting, growth and maternal–fetal interactions. J. Exp. Biol. 2018, 221 (Suppl. 1), jeb164517. [Google Scholar] [CrossRef]
- Coppedè, F.; Grossi, E.; Migheli, F.; Migliore, L. Polymorphisms in folate-metabolizing genes, chromosome damage, and risk of Down syndrome in Italian women: Identification of key factors using artificial neural networks. BMC Med. Genom. 2010, 3, 42. [Google Scholar] [CrossRef][Green Version]
- Grossi, E.; Stoccoro, A.; Tannorella, P.; Migliore, L.; Coppedè, F. Artificial Neural Networks Link One-Carbon Metabolism to Gene-Promoter Methylation in Alzheimer’s Disease. J. Alzheimer’s Dis. 2016, 53, 1517–1522. [Google Scholar] [CrossRef]
- Gagliano, A.; Galati, C.; Ingrassia, M.; Ciuffo, M.; Alquino, M.A.; Tanca, M.G.; Carucci, S.; Zuddas, A.; Grossi, E. Pediatric Acute-Onset Neuropsychiatric Syndrome: A Data Mining Approach to a Very Specific Constellation of Clinical Variables. J. Child Adolesc. Psychopharmacol. 2020, 30, 495–511. [Google Scholar] [CrossRef]
Mothers | Newborns | ||
---|---|---|---|
Number | n = 28 | Males | n = 17 |
Age (years) | 34.10 ± 4.43 | Females | n = 11 |
Pregravid BMI (Kg/m2) | 21.77 ± 2.63 | Gestational age (days) | 38.88 ± 0.48 |
Previous pregnancies | 92% | Weight (g) | 3247.42 ± 382.45 |
Previous miscarriages | 19% | Length (cm) | 50.07 ± 1.84 |
Placental weight (g) | 587.96 ± 134.11 | Head circumference (cm) | 35.14 ± 1.43 |
Apgar score | >7 |
Inclusion Criteria | Exclusion Criteria |
---|---|
Italian nationality | Family history of metabolic disorders (e.g., gestational diabetes, autoimmune diseases) |
Age (from 18 to 40 years) | Preeclampsia |
Pre-pregnancy BMI 18.5–25 kg/m2 | Twin pregnancy |
Ability to understand the study protocol and willingness to accept it | Chromosomopathies |
Propensity to breastfeed | Maternal infections |
Singleton birth | Pharmacological treatments |
Natural pregnancy | Drugs or alcohol abuse |
Elective caesarean delivery | Labour |
Gestational age ≥ 34 weeks | General anesthesia |
Parameter | Outcome | |
---|---|---|
Birth weight | Suboptimal (2500–3000 g) | Adequate (3000–4000 g) |
(n = 6) 21.4% | (n = 22) 78.6% | |
Stressful events during pregnancy | Yes | No |
(n = 9) 32.2% | (n = 19) 67.8% | |
Maternal age at birth | <40 years old | ≥40 years old |
(n = 25) 89.3% | (n = 3) 10.7% | |
Environmental exposure | Yes | No |
(n = 3) 10.7% | (n = 25) 89.3% | |
Fever or flu during pregnancy | Yes | No |
(n = 8) 28.6% | (n = 20) 71.4% | |
Living context | Rural | Urban |
(n = 9) 32.2% | (n = 19) 67.8% | |
Smoking before conception | Yes | No |
(n = 7) 25% | (n = 21) 75% | |
Exposure to passive smoking | Yes | No |
(n = 6) 21.4% | (n = 22) 78.6% |
Gene | Primer Sequence | Ta | Amplicon Size | CpG Sites | Accession Number and Nucleotide Position |
---|---|---|---|---|---|
LEP | F 5′-GGGTGGGATTTTAGAATTTTTAATT-3′ R 5′- AAACCAACCCCTTAAAAAAATACTT-3′ | 55° | 259 bp | 28 | NG_007450. From 14444 to 14703 bp |
MECP2 | F 5′-AATTAAGGTTTTTTAGTTGGGGTAA-3′ R 5′-TTAACCCTCTATCCACAAATACACC-3′ | 62° | 145 bp | 5 | NC_000023.11 From 154097160 to 154097350 bp |
IGF2 | F 5′- GGAGGGGGTTTATTTTTTTAGGAAG -3′ R 5′- AACCCCAACAAAAACCACTAAACAC-3′ | 60° | 93 bp | 3 | NG_008849.1 From 6281 to 6374 bp |
MTHFR | F 5′-TTTTAATTTTTGTTTGGAGGGTAGT-3′ R 5′-AAAAAAACCACTTATCACCAAATTC-3′ | 54° | 155 bp | 7 | NM_005957.4 From 30 to 184 bp |
DNMT3B | F 5′-TGGTGTTGTGTGATTATAGTGG-3′ R 5′-TCACCCTAAAAAATCAAAAACC-3′ | 55° | 174 bp | 6 | NG_007290.1 from −397 to −223 bp |
OXTR | F5′-AATTATTGTAAAATAAATTTATTTGTTAAG-3′ R 5′-AACTAAAATCTCTCACTAAAACCTC-3′ | 53° | 274 bp | 26 | NC_000003.11 From 8812437 to 8812711 bp |
H19 | F 5′-TGGGTATTTTTGGAGGTTTTTTT-3′ R 5′-ATAAATATCCTATTCCCAAATAA-3′ | 56° | 216 bp | 17 | NG_041945.1 From 3549 to 3764 bp |
HSD11B2 | F 5′-TAGGTTTAAGTTTTGGAAGGAAAG-3′ R 5′-ACCACAAAACCTACCTAAAACAAAA-3′ | 59° | 107 bp | 5 | NG_016549.1 From 4302 to 4409 bp |
BDNF | F 5′-GGGTTGTTAATTTATATTTGGGAAGT-3′ R 5′-ACCACTAATTACCCACAAAACC-3′ | 58° | 119 bp | 4 | CM000673.2 From 46058 to 46177 bp |
CYP1A1 | F 5′-TGTTATAGGGTTTTTAGGAAAAA-3′ R 5′-AAATTATTTTCTAACCTAAACCAAC-3′ | 54.8° | 147 bp | 4 | GRCh37/hg19 From 75013061 to 75017877 bp |
Erα | F 5′-GGGAGATTAGTATTTAAAGTTGGAGGT-3′ R 5′-CAAAACAAAAAACTCAAAAACC-3′ | 55.4° | 233 bp | 22 | NG_008493.2 From 155951 to 156184 bp |
MGMT | F 5′-GCGTTTCGGATATGTTGGGATAAGT -3′ R 5′-AACGACCCAAACACTCACCAAA -3′ | 58° | 110 | 12 | NC_000010.11 From 129467205 to 129467315 bp |
RELN | F: 5′-TTGAAGAGTTTAGAAGTAATGAATAATAGA-3′ R: 5′-ACCTCATCTATAAAAAATTTTAAAATAAAA-3′ | 56 °C | 192 | 7 | NG 011877.2 (4053–4244) |
NR3C1 | F 5′-TTTTATAAAAATTTTTTTGGTTGAGG -3′ R 5′-TAAACTTTCAACAAACCTCTTATCC -3′ | 54° | 167 | 9 | NG_009062.1 From 33776 to 33943 |
COMT | F 5′-GTTTATGGGTGATATTAAGGAGTAG -3′ R 5′-AATAAATATCAATAACCTCCAACAC -3′ | 55° | 101 | 6 | NG_011526.1 From 25933 to 2634 |
Investigated Genes | DNA Methylation Levels (%, Mean ± Standard Deviation) | ||
---|---|---|---|
Placenta (n = 28) | Maternal Buccal Cells (n = 28) | Neonatal Buccal Cells (n = 28) | |
BDNF | 6.92 ± 7.94 | 10.47 ± 10.13 | 7.71 ± 8.22 |
CYP1A1 | 19.65 ± 9.90 | 26.71 ± 6.92 | 15.23 ± 7.31 |
DNMT3B | 5.02 ± 5.58 | 7.36 ± 11.00 | 7.41 ± 7.76 |
Erα | 0.55 ± 1.11 | 5.97 ± 6.95 | 8.48 ± 11.34 |
H19 | 58.32 ± 10.57 | 73.60 ± 11.80 | 66.56 ± 16.52 |
HSD11β2 | 5.16 ± 4.22 | 0.99 ± 2.62 | 1.96 ± 3.60 |
IGF2 | 50.35 ± 8.00 | 39.64 ± 11.38 | 33.88 ± 11.03 |
LEP | 65.62 ± 17.96 | 11.48 ± 6.06 | 4.93 ± 4.62 |
MECP2 | 7.04 ± 5.86 | 34.22 ± 13.88 | 11.44 ± 9.65 |
MGMT | 0.47 ± 0.56 | 0.16 ± 0.30 | 0.33 ± 0.59 |
MTHFR | 10.47 ± 3.73 | 17.76 ± 7.91 | 9.41 ± 6.88 |
OXTR | 1.23 ± 1.72 | 1.85 ± 3.17 | 1.20 ± 1.28 |
RELN | 2.42 ± 3.10 | 3.45 ± 4.14 | 4.02 ± 3.71 |
NR3C1 | 23.81 ± 18.57 | 5.95 ± 4.35 | 6.75 ± 4.74 |
COMT | 30.56 ± 9.77 | 49.43 ± 23.67 | 8.32 ± 8.60 |
Global methylation (5-mC content) | 4.90 ± 2.74 | 3.53 ± 2.69 | 3.55 ± 2.57 |
Global hydroxymethylation (5-hmC content) | 0.38 ± 0.49 | 0.18 ± 0.24 | 0.24 ± 0.31 |
Silver (Ag) mg/kg | Nickel (Ni) mg/kg | Vanadium (V) mg/kg | Mercury (Hg) mg/kg | Arsenic (As) mg/kg | Chrome (Cr) mg/kg | Cadmium (Cd) mg/kg | Lead (Pb) mg/kg | Dioxins (PCDD/F) + PCBDL pg TEQ/g | |
---|---|---|---|---|---|---|---|---|---|
Placenta concentration (mean ± SD) | 0.004 ± 0.007 | 0.03 ± 0.02 | 0 ± 0 | 0.029 ± 0.02 | 0.001 ± 0.003 | 0.09 ± 0.07 | 0.033 ± 0.017 | 0.052 ± 0.058 | 0.07 ± 0.11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stoccoro, A.; Nicolì, V.; Coppedè, F.; Grossi, E.; Fedrizzi, G.; Menotta, S.; Lorenzoni, F.; Caretto, M.; Carmignani, A.; Pistolesi, S.; et al. Prenatal Environmental Stressors and DNA Methylation Levels in Placenta and Peripheral Tissues of Mothers and Neonates Evaluated by Applying Artificial Neural Networks. Genes 2023, 14, 836. https://doi.org/10.3390/genes14040836
Stoccoro A, Nicolì V, Coppedè F, Grossi E, Fedrizzi G, Menotta S, Lorenzoni F, Caretto M, Carmignani A, Pistolesi S, et al. Prenatal Environmental Stressors and DNA Methylation Levels in Placenta and Peripheral Tissues of Mothers and Neonates Evaluated by Applying Artificial Neural Networks. Genes. 2023; 14(4):836. https://doi.org/10.3390/genes14040836
Chicago/Turabian StyleStoccoro, Andrea, Vanessa Nicolì, Fabio Coppedè, Enzo Grossi, Giorgio Fedrizzi, Simonetta Menotta, Francesca Lorenzoni, Marta Caretto, Arianna Carmignani, Sabina Pistolesi, and et al. 2023. "Prenatal Environmental Stressors and DNA Methylation Levels in Placenta and Peripheral Tissues of Mothers and Neonates Evaluated by Applying Artificial Neural Networks" Genes 14, no. 4: 836. https://doi.org/10.3390/genes14040836
APA StyleStoccoro, A., Nicolì, V., Coppedè, F., Grossi, E., Fedrizzi, G., Menotta, S., Lorenzoni, F., Caretto, M., Carmignani, A., Pistolesi, S., Burgio, E., Fanos, V., & Migliore, L. (2023). Prenatal Environmental Stressors and DNA Methylation Levels in Placenta and Peripheral Tissues of Mothers and Neonates Evaluated by Applying Artificial Neural Networks. Genes, 14(4), 836. https://doi.org/10.3390/genes14040836