Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development
Abstract
:1. Introduction
2. Materials and Methods
2.1. Development of a Mapping Population
2.2. Seedling Tests
2.3. Molecular Mapping
2.4. Statistical Analysis
3. Results
3.1. Molecular Mapping of LrAW2
3.2. Testing of Flanking Markers for Polymorphism on a Wheat Panel
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430. [Google Scholar] [CrossRef] [PubMed]
- Kolmer, J.A. Genetics of resistance to wheat leaf rust. Annu. Rev. Phytopathol. 1996, 34, 435. [Google Scholar] [CrossRef] [PubMed]
- Bariana, H.; Brown, G.; Bansal, U.; Miah, H.; Standen, G.; Lu, M. Breeding triple rust resistant wheat cultivars for Australia using conventional and marker-assisted selection technologies. Crop Pasture Sci. 2007, 58, 576. [Google Scholar] [CrossRef]
- Bariana, H.S.; McIntosh, R.A. Genetics of adult plant stripe rust resistance in four Australian wheats and the French cultivar Hybride-de-Bersee. Plant Breed. 1995, 114, 485. [Google Scholar] [CrossRef]
- Singh, R.; Huerta-Espino, J.; Rajaram, S. Achieving near-immunity to leaf and stripe rust in wheat by combining slow rusting resistance genes. Acta Phytothol. Entomol. Hungrica 2000, 35, 133. [Google Scholar]
- McIntosh, R.; Wellings, C.R.; Park, R.F. Wheat Rusts: An Atlas of Resistance Genes; CSIRO Publishing: Melbourne, VIC, Australia, 1995; p. 204. [Google Scholar]
- Bariana, H.S.; Cupitt, C.F.; Warburton, T. Diversity of resistance to rust diseases in Australian wheat in 1999 and 2000 crop seasons. In Proceedings of the 10th Wheat Breeding Assembly, Mildura, VIC, Australia, 16–21 September 2001; pp. 230–233. [Google Scholar]
- Park, R.F. Long term surveys of pathogen populations underpin sustained control of the rust diseases of wheat. Aust. J. R. Soc. N. S. W. 2015, 148, 15. [Google Scholar]
- Park, R.F.; Burdon, J.J.; McIntosh, R.A. Studies on the origin, spread, and evolution of an important group of Puccinia recondita f. sp. tritici pathotypes in Australasia. Eur. J. Plant Pathol. 1995, 101, 613. [Google Scholar] [CrossRef]
- Park, R.F.; Bariana, H.S.; Wellings, C.R.; Wallwork, H. Detection and occurrence of a new pathotype of Puccinia triticina with virulence for Lr24 in Australia. Aust. J. Agric. Res. 2002, 53, 1. [Google Scholar] [CrossRef]
- Park, R.F. Breeding cereal for rust resistance in Australia. Plant Pathol. 2008, 57, 591. [Google Scholar] [CrossRef]
- Park, R.F.; Burdon, J.J.; Jahoor, A. Evidence for somatic hybridisation in the leaf rust pathogen of wheat (Puccinia recondita f. sp. tritici). Mycol. Res. 1999, 103, 715. [Google Scholar] [CrossRef]
- Park, R.F.; Mohler, V.; Nazari, K.; Singh, D. Characterisation and mapping of gene Lr73 conferring seedling resistance to Puccinia triticina in common wheat. Theor. Appl. Genet. 2014, 127, 2041. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Bharadwaj, S.C.; Gangwar, O.P.; Sharma, A.; Qureshi, N.; Kumaran, V.V.; Khan, H.; Prasad, P.; Miah, H.; Singh, G.P.; et al. Lr80—A new and widely effective source of leaf rust resistance of wheat to enhance diversity of resistance among modern cultivars. Theor. Appl. Genet. 2021, 134, 849. [Google Scholar] [CrossRef] [PubMed]
- Flor, H.H. Genetics of pathogenicity in Melampsora lini. J. Agric. Res. 1946, 73, 335. [Google Scholar]
- Samborski, D.J.; Dyck, P.L. Inheritance of virulence in wheat leaf rust on the standard differential wheat varieties. Can. J. Genet. Cytol. 1968, 10, 24. [Google Scholar] [CrossRef]
- Kolmer, J.A. Virulence and race dynamics of Puccinia recondita f. sp. tritici in Canada during 1956–1987. Phytopathology 1989, 79, 349. [Google Scholar] [CrossRef]
- Pathan, A.K.; Park, R.F. Evaluation of seedling and adult plant resistance to leaf rust in European wheat cultivars. Euphytica 2006, 149, 327. [Google Scholar] [CrossRef]
- Bariana, H.S.; Bansal, U.K. Breeding for disease resistance. In Encyclopedia of Applied Plant Sciences; Thomas, B., Murray, B.G., Murphy, D., Eds.; Academic Press: Waltham, MA, USA, 2017; Volume 3, pp. 69–76. [Google Scholar]
- Miller, T.E.; Reader, S.M.; Ambrose, M.J. The Watkins wheat collection. Ann. Wheat Newsl. 2000, 46, 172. [Google Scholar]
- Qureshi, N.; Bariana, H.; Forrest, K.; Hayden, M.; Keller, B.; Wicker, T.; Faris, J.; Salina, E.; Bansal, U. Fine mapping of the chromosome 5B region carrying closely linked rust resistance genes Yr47 and Lr52 in wheat. Theor. Appl. Genet. 2017, 130, 495. [Google Scholar] [CrossRef]
- Bansal, U.K.; Kazi, A.G.; Singh, B.; Hare, R.; Bariana, H.S. Mapping of durable stripe rust resistance in a durum wheat cultivar Wollaroi. Mol. Breed. 2014, 33, 51. [Google Scholar] [CrossRef]
- Nsabiyera, V.; Qureshi, N.; Bariana, H.S.; Wong, D.; Forrest, K.L.; Hayden, M.J.; Bansal, U.K. Molecular markers for adult plant leaf rust resistance gene Lr48 in wheat. Mol. Breed. 2016, 36, 1. [Google Scholar] [CrossRef]
- Lorieux, M. MapDisto: Fast and efficient computation of genetic linkage maps. Mol. Breed. 2012, 30, 1231. [Google Scholar] [CrossRef]
- Voorrips, R. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome 1993, 36, 476. [Google Scholar] [CrossRef] [PubMed]
- Singh, D.; Park, R.F.; McIntosh, R.A. Characterisation of wheat leaf rust resistance gene Lr34 in Australian wheats using components of resistance and the linked molecular marker csLV34. Aust. J. Agric. Res. 2007, 58, 1106. [Google Scholar] [CrossRef]
- Kolmer, J.A.; Singh, R.P.; Garvin, D.F.; Viccars, L.; William, H.M.; Huerta-Espino, J.H.; Obonnaya, F.C.; Raman, H.; Orford, S.; Bariana, H.S.; et al. Analysis of the Lr34/Yr18 rust resistance region in wheat germplasm. Crop Sci. 2008, 48, 1841. [Google Scholar] [CrossRef] [Green Version]
- Brown-Guedira, G.L.; Singh, S.; Fritz, A.K. Performance and mapping of leaf rust resistance transferred to wheat from Triticum timopheevii subsp. armeniacum. Phytopathology 2003, 93, 784. [Google Scholar] [CrossRef] [Green Version]
- Kuraparthy, V.; Sood, S.; Guedira, G.B.; Gill, B. Development of a PCR assay and marker-assisted transfer of leaf rust resistance gene Lr58 into adapted winter wheats. Euphytica 2011, 180, 227. [Google Scholar] [CrossRef]
- Hiebert, C.; Thomas, J.; McCallum, B. Locating the broad-spectrum wheat leaf rust resistance gene Lr52 (LrW) to chromosome 5B by a new cytogenetic method. Theor. Appl. Genet. 2005, 110, 1453. [Google Scholar] [CrossRef]
- Bansal, U.K.; Forrest, K.L.; Hayden, M.J.; Miah, H.; Singh, H.; Bariana, H.S. Characterization of a new stripe rust resistance gene Yr47 and its genetic association with the leaf rust resistance gene Lr52. Theor. Appl. Genet. 2011, 122, 1461. [Google Scholar] [CrossRef]
- Bansal, U.K.; Zwart, R.; Bhavani, S.; Wanyera, R.; Gupta, V.; Bariana, H.S. Microsatellite mapping identifies TTKST-effective stem rust resistance gene in wheat cultivar VL404 Janz. Mol. Breed. 2012, 30, 1757. [Google Scholar] [CrossRef]
- Rouse, M.N.; Nirmala, J.; Jin, Y.; Chao, S.; Fetch, T.G., Jr.; Pretorius, Z.A.; Heibert, C.W. Characterization of Sr9h, a wheat stem rust resistance allele effective to Ug99. Theor. Appl. Genet. 2014, 127, 1681. [Google Scholar] [CrossRef] [PubMed]
- Chemayek, B.; Bansal, U.K.; Qureshi, N.; Zhang, P.; Wagoire, W.W.; Bariana, H.S. Tight repulsion linkage revealed between Sr36 and Sr39 revealed by genetic, cytogenetic and molecular analyses. Theor. Appl. Genet. 2017, 130, 587–595. [Google Scholar] [CrossRef] [PubMed]
- Marchal, C.; Zhang, J.; Zhang, P.; Fenwick, P.; Steuernagel, B.; Adamski, N.M.; Boyd, L.; McIntosh, R.; Wulff, B.B.H.; Berry, S.; et al. BED-domain-containing immune receptors confer diverse resistance spectra to yellow rust. Nat. Plants 2018, 4, 662–668. [Google Scholar] [CrossRef] [PubMed]
- Cheng, P.; Chen, X.M. Molecular mapping of a gene for stripe rust resistance in spring wheat cultivar IDO377s. Theor. Appl. Genet. 2010, 121, 195. [Google Scholar] [CrossRef]
- Xu, L.S.; Wang, M.N.; Cheng, P.; Kang, Z.; Hulbert, S.; Chen, X. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat. Theor. Appl. Genet. 2013, 126, 523. [Google Scholar] [CrossRef]
- Chhetri, M. Molecular Mapping and Genetic Characterization of Rust Resistance in Wheat. Ph.D. Thesis, University of Sydney, Sydney, NSW, Australia, 2015. [Google Scholar]
- Chhetri, M.; Bariana, H.; Wong, D.; Sohail, Y.; Hayden, M.; Bansal, U.K. Development of robust molecular markers for marker-assisted selection of leaf rust resistance gene Lr23 in common and durum wheat breeding programs. Mol. Breed. 2017, 37, 21. [Google Scholar] [CrossRef]
- Mago, R.; Bariana, H.S.; Dundas, I.S.; Spielmeyer, W.; Lawrence, G.J.; Pryor, A.J.; Ellis, J.G. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor. Appl. Genet. 2005, 111, 496. [Google Scholar] [CrossRef]
- Liu, Y.; Chen, H.; Li, C.; Zhang, L.; Shao, M.; Pang, Y.; XU, X.; Bai, G. development of disgnostic markers for a wheat leaf rust resistance gene Lr42 using RNA-sequencing. Crop J. 2021, 9, 1357. [Google Scholar] [CrossRef]
- Dadkhodaie, N.A.; Karaoglou, H.; Wellings, C.R.; Park, R.F. Mapping genes Lr53 and Yr35 on the short arm of chromosome 6B of common wheat with microsatellite markers and studies of their association with Lr36. Theor. Appl. Genet. 2011, 122, 479. [Google Scholar] [CrossRef]
- Bansal, M.; Adamski, N.M.; Toor, P.I.; Kaur, S.; Sharma, A.; Srivastava, P.; Bansal, U.; Uauy, C.; Chhuneja, P. A robust KASP marker for selection of four pairs of linked leaf rust and stripe rust resistance genes introgressed on chromosome arm 5DS from different wheat genomes. Mol. Biol. Rep. 2021, 48, 5209. [Google Scholar] [CrossRef]
- Lagudah, E.; McFadden, H.; Singh, R.; Huerta-Espino, J.; Bariana, H.; Spielmeyer, W. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet. 2006, 114, 21. [Google Scholar] [CrossRef] [PubMed]
- Nsabiyera, V.; Baranwal, D.; Qureshi, N.; Kay, P.; Forrest, K.; Valárik, M.; Doležel, J.; Hayden, M.J.; Bariana, H.S.; Bansal, U.K. Fine mapping of Lr49 using 90K SNP chip array and flow sorted chromosome sequencing in wheat. Front. Plant Sci. 2020, 10, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moore, J.W.; Herrera-Foessel, S.; Lan, C.; Schnippenkoetter, W.; Ayliffe, M.; Huerta-Espino, J.; Lillemo, M.; Viccars, L.; Milne, R.; Periyannan, S. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat. Genet. 2015, 47, 1494. [Google Scholar] [CrossRef] [PubMed]
- Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; Rosewarne, G.M.; Periyannan, S.K.; Viccar, L.; Calvo-Salazar, V.; Lan, C.; Lagudah, E.S. Lr68: A new gene conferring slow rusting resistance to leaf rust in wheat. Theor. Appl. Genet. 2012, 124, 1475. [Google Scholar] [CrossRef] [PubMed]
Pathotype ^ | Culture Number * | Aus27352 | Avocet S |
---|---|---|---|
104-2,3,6,(7) | 231 | 3+ | 23- |
10-1,2,3,4 | 348 | 3+ | 23- |
104-1,(2),3,(6),(7),11,13 | 547 | 3+ | 23- |
10-1,3,9,10,11,12 | 592 | 3+ | ; |
104-1,3,4,6,7,8,10,12+Lr37 | 634 | ;11+c | 3+ |
76-3,5,7,9,10,12,13+Lr37 | 625 | 11- | 3+ |
Leaf Rust Response | Infection Type | No. of Lines | χ2 (1:1) | |
---|---|---|---|---|
Observed | Expected | |||
Homozygous resistant | ;11+ | 88 | 100 | 1.44 |
Homozygous susceptible | 3+ | 112 | 100 | 1.44 |
Total | 200 | 200 | 2.88 |
Marker | Physical Distance (bp) | Allele 1 a | Allele 2 b | Common |
---|---|---|---|---|
KASP_77643 | 785,138,741 | gagccactgatctgatcactt | gagccactgatctgatcactc | tcgtcggtgtttccctgttt |
KASP_5978 | 784,551,365 | ctgaagcacttcgcccca | ctgaagcacttcgccccg | gaatctacgacgaggctgc |
KASP_48388 | 785,890,263 | ttgtgtatgtatgttcatttggca | ttgtgtatgtatgttcatttggcg | tctttgtaggttgaaagggct |
KASP_78325 | 786,230,653 | tgacccatactttgcaacacaa | tgacccatactttgcaacacag | acacgtgatggaaaaggttct |
KASP_54389 | 786,105,954 | gacatggcggggtcgact | gacatggcggggtcgacc | gaactgacgtgagccatgct |
KASP_78057 | 786,229,479 | ttacaacgataaggccaccaa | ttacaacgataaggccaccag | cagtgaacttcttcaggcgg |
KASP_28691 | 789,608,961 | cggatttctggacatcgtca | cggatttctggacatcgtcg | tcaaactttccttgttgttcgtac |
KASP_12117 | 788,524,814 | tccaccatcccgcagcaa | tccaccatcccgcagcag | aggccttggggacacaatcc |
KASP_12118 | 788,524,885 | ccccaaggcctctttcgt | ccccaaggcctctttcgg | gccagtttgatgtcgaagagat |
KASP_81209 | 788,657,195 | tggtagtgctgcaaaacga | tggtagtgctgcaaaacgg | ggtgttggttactacagcagc |
KASP_53122 | 788,655,517 | gtccaaggccgaggaggat | gtccaaggccgaggaggac | cctgctcagccaacaccattatg |
KASP_22131 | 788,656,700 | ggctagtgttgtttttgtacca | ggctagtgttgtttttgtaccg | catacaggtagcagatacgcaa |
KASP_11333 | 790,751,851 | cacggaaccagactggca | cacggaaccagactggcg | gaacccgttctcagcgaat |
KASP_8699 | 793,148,680 | cagatgatggtggatggtatgtatt | cagatgatggtggatggtatgtatc | atggttgtgggaagcacgaa |
Cultivars * | KASP_22131 | KASP_11333 |
---|---|---|
Aus27352 | G:G | A:A |
Avocet S | A:A | G:G |
AGT Katana, Axe, Baxter, Bolac, Carnamah, Catalina, Chara, Cobra, Corack, Crusader, Dart, Derrimut, EGA Bonnie Rock, EGA Burke, EGA Gregory, EGA Wedgetail, EGA Wylie, Elmore CL PLus, Emu Rock, Envoy, Estoc, Forrest, Gauntlet, Gazelle, GBA Sapphire, Giles, Grenade CL Plus, Harper, Impala, Janz, Justica CL Plus, King Rock, Kord CL Plus, Kunjin, Lancer, Lang, Lincoln, Livingston, LRPB Reliant, Mace, Magenta, Mansfield, Merinda, Preston, SF Adagio, SF Scenario, Shield, Sunco, Sunguard, SunMax, Sunvale, Sunzell, Wallup, Westonia, Wyalkatchem, Wylah, Yandanooka, Yitpi, Young | A:A | G:G |
Beaufort, Calingiri, Coolah, DS Faraday, EGA Bounty, Fortune, LRPB Flanker, Mackellar, Merlin, Naparoo, Ninja, Phantom, Scout, Sentinel, Spitfire, SQP Revenue, Strzelecki, Suntop, Trojan, Ventura, Waagan | A:A | A:A |
Correll, Espada, LRPB Kittyhawk, Orion | G:G | A:A |
Chief CL Plus, Gladius, Impose CL Plus, LRPB Arrow, Wedin | G:G | G:G |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bariana, H.S.; Babu, P.; Forrest, K.L.; Park, R.F.; Bansal, U.K. Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development. Genes 2022, 13, 964. https://doi.org/10.3390/genes13060964
Bariana HS, Babu P, Forrest KL, Park RF, Bansal UK. Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development. Genes. 2022; 13(6):964. https://doi.org/10.3390/genes13060964
Chicago/Turabian StyleBariana, Harbans S., Prashanth Babu, Kerrie L. Forrest, Robert F. Park, and Urmil K. Bansal. 2022. "Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development" Genes 13, no. 6: 964. https://doi.org/10.3390/genes13060964
APA StyleBariana, H. S., Babu, P., Forrest, K. L., Park, R. F., & Bansal, U. K. (2022). Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development. Genes, 13(6), 964. https://doi.org/10.3390/genes13060964