Next Article in Journal
Effects of N-Acetylcysteine on the Proliferation, Hormone Secretion Level, and Gene Expression Profiles of Goat Ovarian Granulosa Cells
Previous Article in Journal
Routine Diagnostics Confirm Novel Neurodevelopmental Disorders
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Essay

Expression and Polymorphisms of SMAD1, SMAD2 and SMAD3 Genes and Their Association with Litter Size in Tibetan Sheep (Ovis aries)

College of Agriculture and Animal Husbandry/Key Laboratory of Livestock and Poultry Genetics and Breeding on the Qinghai-Tibet Plateau, Ministry of Agriculture and Rural Affairs/Plateau Livestock Genetic Resources Protection and Innovative Utilization key Laboratory of Qinghai Province, Qinghai University, Xining 810016, China
*
Author to whom correspondence should be addressed.
Genes 2022, 13(12), 2307; https://doi.org/10.3390/genes13122307
Submission received: 17 October 2022 / Revised: 30 November 2022 / Accepted: 5 December 2022 / Published: 7 December 2022
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

SMAD1, SMAD2, and SMAD3 are important transcription factors downstream of the TGF-β/SMAD signaling pathway that mediates several physiological processes. In the current study, we used cloning sequencing, RT-qPCR, bioinformatics methods and iMLDR technology to clone the coding region of Tibetan sheep genes, analyze the protein structure and detect the tissue expression characteristics of Tibetan sheep genes, and detect the polymorphisms of 433 Tibetan sheep and analyze their correlation with litter size. The results showed that the ORFs of the SMAD1, SMAD2 and SMAD3 genes were 1398 bp, 1404 bp and 1278 bp, respectively, and encoded 465, 467 and 425 amino acids, respectively. The SMAD1, SMAD2, and SMAD3 proteins were all unstable hydrophilic mixed proteins. SMAD1, SMAD2 and SMAD3 were widely expressed in Tibetan sheep tissues, and all were highly expressed in the uterus, spleen, ovary and lung tissues. Litter sizes of the genotype CC in the SMAD1 gene g.10729C>T locus were significantly higher than that of CT (p < 0.05). In the SMAD3 gene g.21447C>T locus, the genotype TT individuals showed a higher litter size than the CC and CT genotype individuals (p < 0.05). These results preliminarily demonstrated that SMAD1, SMAD2 and SMAD3 were the major candidate genes that affected litter size traits in Tibetan sheep and could be used as a molecular genetic marker for early auxiliary selection for improving reproductive traits during sheep breeding.

1. Introduction

Tibetan sheep (Ovis aries) are mainly distributed in the Qinghai–Tibet Plateau and are the main sources of income for local farmers and herdsmen. However, due to the long-term living in the low-oxygen environment of the plateau, Tibetan sheep have adapted very well to the harsh conditions. Moreover, the reproduction rate of Tibetan sheep is low, and the lambing ratio is only 105% [1]. The declining lambing rate is due to a low estrus rate and ovulation rate, but also is the result of the interaction between environmental and genetic factors [1]. Litter size is one of the most important economic traits in livestock. Because of their low heritability and the fact that the most quantitative traits are controlled by multiple genes, it is difficult to achieve rapid genetic improvement by traditional breeding methods alone [2]. An accurate performance assessment and genetic parameters estimation are the prerequisites for any successful genetic improvement program [3]. Studies have shown that the genetic improvement of livestock has been achieved by indirect selection of high-quality breeding stocks using marker-assisted selection (MAS) [4]. However, due to the influence of minor polygenes, only a small number of functional sites affecting specific traits have been identified. Therefore, it is particularly important to identify more functional genes and loci to enhance the understanding of the lambing performance of Tibetan sheep.
The TGF-β/SMADs signaling pathway is involved in early embryogenesis, bone formation, tissue repair, ovarian follicle development and follicle atresia and selection. This pathway also plays an important regulatory role in cell proliferation, differentiation, migration, apoptosis and immunity and endocrinology [5,6,7]. SMAD proteins are important transcription factors downstream of the TGF-β/SMADs signaling pathway, mediating intracellular transduction of extracellular TGF-β signals in cells [8,9]. SMAD proteins are divided into 3 categories according to their structural and functional characteristics: receptor-regulated Smads (R-Smads), including Smad1, 2, 3, 5, 8, 9; inhibitory Smads (I-Smads), including Smad6 and 7; and common mediator Smads (Co-Smad), including Smad4 [10,11]. SMAD1, SMAD2 and SMAD3 genes are widely distributed in different tissues and mediate multiple types of physiological processes [6,7,12]. SMAD1 knockout mice exhibited embryonic death at E10.5 to E11.5, no or very little formation of primordial germ cells [13,14], decreased steroid hormone production, ovulation dysfunction and infertility [15]. By knocking out the SMAD2 and SMAD3 genes in female mice, mice developed follicular development and ovulation abnormalities, with significantly reduced fertility [16]. Female mice with SMAD1/5 deletion showed endometrial defects leading to the development of cystic endometrial glands, endometrial epithelial hyperplasia during the implantation window and impaired apical–basal transformation, preventing embryo implantation and leading to infertility [17]. Tomic et al. [18] showed that SMAD3-deficient mice had significantly reduced fertility due to stunted follicle development, increased granulocyte apoptosis, and ovulation defects. The study of SMAD1, SMAD2 and SMAD3 genes has focused on mice and has also been involved in animals such as pigs [19] and cattle [20]. These genes have also been studied as candidate genes for fertility in sheep such as the small-tailed sheep [21,22] in China, the Hu sheep [23,24] in China, and the Garole × Malpura × Malpura [25,26] in India. In the current study, the structures of the genes were analyzed by cloning the SMAD1, SMAD2 and SMAD3 genes and using bioinformatics methods. RT-qPCR was used to detect the distribution and expression of SMAD1, SMAD2 and SMAD3 genes in different tissues of Tibetan sheep. The SNPs of SMAD1, SMAD2 and SMAD3 genes were genotyped by iMLDR technology, and the association between the polymorphisms and the litter size of Tibetan sheep were analyzed. The results of this study will provide a theoretical basis for the development of marker-assisted selection and breeding to improve the fertility of Tibetan sheep.

2. Materials and Methods

2.1. Experimental Animals and Sample Collection

In this experiment, 6 Tibetan ewes aged 6 months with a similar weight (35.32 ± 1.96 kg) and who were in good health were slaughtered at Xiangkameiduo Animal Husbandry Co., Ltd. in Gonghe county, Hainan Tibetan Autonomous Prefecture, Qinghai Province. The tissue samples including hypothalamus, pituitary, heart, liver, spleen, lungs, kidneys, ovaries, uterus, oviduct, rumen, duodenum and longissimus dorsi muscle were collected after slaughter. The samples were then quickly placed in liquid nitrogen, transported to the laboratory and stored in an ultra-low-temperature freezer at −80 °C. A total of 433 Tibetan ewes with a lambing record were selected from Xiangkameiduo Animal Husbandry Co., Ltd. From each Tibetan sheep, 5 mL of jugular vein blood was collected and placed in an anticoagulation vessel of heparin sodium, returned to the laboratory for low-temperature storage, and stored at −20 °C for backup.

2.2. RNA Isolation and cDNA Synthesis

Total RNA was isolated from 50 mg of tissue from the 13 samples (n = 3 for each tissue) using TRNzol Universal Reagent DP424 (TIANGEN Biotechnology, Co., Ltd., Beijing, China). The quality and integrity of the RNA was checked by agarose gel electrophoresis and the concentration of total RNA was measured by Nanodrop spectrophotometry (Gel DocTM XR+, Thermo Fisher Scientific Inc., Waltham, MA, USA). Further, cDNA was synthesized using total RNA (2 μg) by FastKing gDNA Dispelling RT SuperMix KR118 (TIANGEN Biotechnology, Co., Ltd., Beijing, China). After the termination of cDNA, each cDNA preparation was diluted four times with RNase-Free ddH2O and stored at −20 °C.

2.3. DNA Isolation

Genomic DNA was extracted from blood samples of 433 ewes using TIANamp Genomic DNA Kit DP348 (TIANGEN Biotechnology, Co., Ltd., Beijing, China) according to the instructions. The quantity and quality of DNA samples were measured with a NanoDrop2000 Nucleic Acid Protein Detector and by 1% agarose gel electrophoresis. Each DNA preparation was diluted to 10 ng/μL with RNase-Free ddH2O and stored at −20 °C.

2.4. Molecular Cloning of SMAD1, SMAD2 and SMAD3 cDNA

The primers of SMAD1, SMAD2 and SMAD3 were designed based on sequences of SMAD1, SMAD2 and SMAD3 from sheep by using the Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) (Table 1). The primers were used for amplifying fragments of Tibetan sheep SMAD1, SMAD2 and SMAD3 cDNA. The polymerase chain reaction (PCR) amplification was performed in a total volume mixture of 25 μL, containing 12.5 μL 2 × Taq PCR Master Mix (TIANGEN Biotechnology, Co., Ltd., Beijing, China), 1 μL of cDNA template, 0.4 μL (10 μM) of forward primers, 0.4 μL (10 μM) of reverse primers and 10.7 μL of RNase-Free ddH2O. The reaction procedure involved predenaturation at 95 °C for 5 min, 30 cycles of denaturation at 95 °C for 30 s, annealing at Tm °C for 30 s and extension at 72 °C for 2 min, followed by a final extension at 72 °C for 5 min. The bands of desired sizes were excised and purified using a gel Extraction Kit (TIANGEN Biotechnology, Co., Ltd., Beijing, China) by following the instructions. The purified PCR products were then ligated with pMD19-T Vector (Takara, Japan), and transformed into competent Escherichia coli cells. Positive recombinant clones were identified by PCR and subsequently sent to a bio company (Shanghai Genesky Biotechnologies Inc., Shanghai, China) for sequencing.

2.5. Characteristics and Bioinformatics Analyses of SMAD1, SMAD2 and SMAD3 cDNA

The cDNA sequence acquired was spliced to obtain the core sequence of SMAD1, SMAD2 and SMAD3 cDNA by using DNAMAN software. Furthermore, the amino acid sequence was translated by using the DNAStar Lasergene 7.0 (Editseq). The physicochemical properties of the SMAD1, SMAD2 and SMAD3 proteins were predicted by using protparam (https://web.expasy.org/protparam/ accessed on 10 July 2022). The protein secondary structure of SMAD1, SMAD2 and SMAD3 in Tibetan sheep were predicted using SOPMA (NPS@: SOPMA secondary structure prediction (ibcp.fr)). To predict the protein structure of SMAD1, SMAD2 and SMAD3 in Tibetan sheep, comparative modeling was performed using Swiss Model (https://swissmodel.expasy.org/ accessed on 10 July 2022). The homology alignment of the amino acid sequences SMAD1, SMAD2 and SMAD3 in Tibetan sheep was compared with amino acids from other species in the GenBank database using the DNAStar Lasergene 7.0 (MegAlign). A phylogenetic tree was constructed by the neighbor-joining method by using the MEGA 6.0 software (Borland company, Scotts Valley, CA, USA).

2.6. Real-Time Quantitative PCR

For RT-qPCR of the SMAD1, SMAD2 and SMAD3 genes, the primers used for SMAD1, SMAD2, SMAD3 and GAPDH expression were designed using primer premier 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) based on the sheep sequences SMAD1, SMAD2, SMAD3 and GAPDH obtained from the NCBI database (Table 1). GAPDH was used as a housekeeping gene. The expressions of SMAD1, SMAD2, SMAD3 genes in 13 different tissues of Tibetan sheep were quantified by RT-qPCR. The RT-qPCR was performed on Bio-Rad CFX96 Real-Time PCR System (Bio-Rad Laboratories, Hercules, CA, USA) using 96-well plates. Each 20 µL real-time qPCR reaction system contained 2 µL of cDNA, 10 µL 2 × SuperReal Color PreMix (TIANGEN Biotechnology, Co., Ltd., Beijing, China), 0.5 μL 40 × Dilution Buffer, 0.6 µL of each forward and reverse primer and 6.3 µL of ddH2O. The RT-qPCR protocol was as follows: 95 °C for 15 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 32 s, melting the amplification with constant heating from 65 °C for 5 s to 95 °C to obtain the melting curve. All samples were assayed in triplicate. The obtained data were normalized by GAPDH and calculated using the 2−∆∆Ct method.

2.7. Genotyping

Genomic DNA was extracted from the venous jugular blood. The selected 10 SNPs in SMAD1, SMAD2 and SMAD3 were genotyped with the method of polymerase chain reaction (PCR) ligase detection reaction (LDR) on an ABI 3730XL Sequence Detection System (Applied Bio-systems, Waltham, MA, USA), with technical support from the Shanghai Genesky Biotechnologies Inc. The primer sequences used for the PCR reaction are described in Table 2. The PCR reaction was carried out in 20 μL of 1 × GC-I buffer (Takara), 3.0 mM Mg2+, 0.3 mM dNTP, 1U HotStarTaq polymerase (Qiagen Inc., Germantown, MD, USA), 1 μL of sample DNA and 1 µL of each primer. PCR amplification was performed as follows: 95 °C for 2 min and 11 cycles at 94 °C for 20 s, 65 °C for 40 s, 72 °C for 1.5 min, and 24 cycles at 94 °C for 20 s, 59 °C for 30 s, and 72 °C for 1.5 min and a final extension at 72 °C for 2 min. PCR products were purified with 5 U of Shrimp Alkaline Phosphatase and 2 U of Exonuclease I in a 37 °C warm bath for 1 h and then inactivated at 75 °C for 15 min to degrade excess dNTPs and primers.
Two allele-specific probes and one fluorescently-labeled probe were used for LDR (Table 2). The reader is referred to Yuan [27] for detailed principles on the typing step utilized. LDR was carried out in 1 μL of 10 × binding buffer, 0.25 μL of thermostable Taq DNA ligase, 0.4 μL of 1 mM 5′ ligation primers mixture, 0.4 μL of 2 mM 3′ ligation primers mixture, 5 μL of multiplex PCR product, and 3 μL of ddH2O. LDR was performed as follows: 38 cycles of 94 °C for 1 min and 56 °C for 4 min, followed by storage at 4 °C. Half a microliter of the reaction mixtures was denatured at 95 °C for 5 min in 9 μL Hi-Di formamide along with 0.5 μL of the LIZ-500 size standard and run on the ABI 3730XL genetic analyzer. Data analysis was achieved using GeneMapper Software v4.0 (Applied Biosystems, New York, NY, USA).

2.8. Statistical Analysis

A one-way analysis of variance (ANOVA) was used to detect whether there were statistical differences in the average mRNA expression of SMAD1, SMAD2 and SMAD3 genes in 13 tissues of Tibetan sheep. Genotype frequencies, allelic frequencies, polymorphism information content (PIC), effective allele number (Ne), gene homozygosity (Ho), gene heterozygosity (He) and Hardy–Weinberg equilibrium (HWE) were directly calculated with reference to Zhao et al. [28]. The association between SMAD1, SAMD2 and SMAD3 genotypes and the litter size of Tibetan ewes was analyzed according to a general linear model (GLM) program. Based on the characteristics of the sheep, the statistical model was as follows:
Yijn = μ + Pi + Gj + IPG + eijn
where Yijn is the phenotypic observation value; μ is the overall population mean; Pi is the fixed effect of the ith parity (i = 1, 2 or 3); Gj is the effect of the jth genotype (j = 1, 2 or 3); IPG is the interactive effect of parity and genotype and e ijn represents random error; assuming that eijkl is independent of each other, obeying the N (0, σ2) distribution. Moreover, the linkage disequilibrium (LD) of identified SNPs was performed using Haploview software [29]. Results with a p < 0.05 were considered significantly different. Results are presented as means ± standard error of means (SEM). All statistical analyses were performed by using Statistical Package for Social Science (SPSS) version 23.0 for Windows (SPSS, IBM, Armonk, NY, USA).

3. Results

3.1. Molecular Cloning and Sequence Analysis of SMAD1, SMAD2 and SMAD3

The Tibetan sheep SMAD1, SMAD2 and SMAD3 genes were successfully cloned in the experiment, and the sequence analysis results showed that the ORFs of SMAD1, SMAD2 and SMAD3 were 1398 bp, 1404 bp and 1278 bp, respectively, and encoded 465, 467 and 425 amino acids, respectively. The molecular weight of the SMAD1, SMAD2 and SMAD3 genes were 52.24 kD, 52.31 kD and 48.08 kD, respectively, and the isoelectric points were 6.90, 6.13 and 6.73, respectively. The total number of negatively-charged residues (Asp + Glu) of the SMAD1, SMAD2 and SMAD3 proteins were 44, 44 and 43, respectively, while the total number of positively-charged residues (Arg + Lys) were 42, 42, and 41, respectively. The calculated lipid index was 65.35, 74.07, and 74.52, respectively. The grand average of hydropathicity was −0.568, −0.444, and −0.447, respectively, indicating that they were all hydrophilic proteins. The instability index (II) was 60.84, 53.30, and 53.26, respectively, indicating that they were all unstable proteins.

3.2. Multiple Sequences Alignment and Phylogenetic Analysis

The SMAD1, SMAD2 and SMAD3 polypeptide sequences of Tibetan sheep were compared with those of other animals by MegAlign software (Figure 1). The Tibetan sheep SMAD1 polypeptide sequence displayed a high percentage of identity with other species such as Ovis aries (100.0%), Bos mutus (100.0%), Bos taurus (99.8%), Homo sapiens (99.8%), Sus scrofa (99.8%), Macaca mulatta (99.8%), Canis lupus familiaries (99.6%), Pan troglodytes (99.4%), Mus musculus (98.9%), Gallus gallus (97.2%) and Maylandia zebra (90.9%) (Figure 1A). The percentage of the peptide sequences homology of Tibetan sheep SMAD2 displayed a high proportion of identity with Ovis aries (100.0%), Homo sapiens (100.0%), Sus scrofa (100.0%), Canis lupus familiaries (100.0%), Pan troglodytes (100.0%), Macaca mulatta (100.0%), Bos mutus (99.8%), Mus musculus (99.6%), Bos taurus (99.6%), Gallus gallus (99.4%), Maylandia zebra (90.8%) and a few more with over 90% similarity (Figure 1B). The Tibetan sheep SMAD3 was most similar to Ovis aries (100.0%), Homo sapiens (100.0%), Sus scrofa (100.0%), Mus musculus (100.0%), Canis lupus familiaries (100.0%), Pan troglodytes (100.0%), Bos taurus (99.8%), Macaca mulatta (99.8%), Bos mutus (99.8%), Gallus gallus (99.1%) and Maylandia zebra (96.5%) (Figure 1C).
The phylogenetic analyses of the SMAD1, SMAD2 and SMAD3 nucleotide sequences were performed using MEGA 6.0 through the neighbor-joining method (Figure 2). In the phylogenetic tree of SMAD1 (Figure 2A), SMAD2 (Figure 2B) and SMAD3 (Figure 2C) genes, the sequence identity at the nucleotide level of Tibetan sheep (red text) showed a closer similarity with Ovis aries than with other ruminants such as Bos taurus and Bos mutus. Furthermore, the sequence of the Tibetan sheep showed a divergence with Homo sapiens, Sus scrofa, Mus musculus, Canis lupus familiaries, Pan troglodytes, Macaca mulatta, Gallus gallus and Maylandia zebra.

3.3. Protein Structure Prediction of SMAD1, SMAD2 and SMAD3

The secondary structures of SMAD1, SMAD2 and SMAD3 proteins were predicted using the online software SOPMA (Figure 3), and the secondary structures of SMAD1 (Figure 3A) proteins included 252 random coils, 105 α helixes, 83 extended strands and 25 β turns, accounting for 54.19%, 22.58%, 17.85% and 5.38%, respectively. The secondary structure of SMAD2 (Figure 3B) proteins included 269 random coils, 95 α helixes, 83 extended strands and 20 β turns, accounting for 57.60%, 20.34%, 17.77% and 4.28%, respectively. The secondary structure of SMAD3 (Figure 3C) proteins included 232 random coils, 100 α helixes, 77 extended strands and 16 β turns, accounting for 54.59%, 23.53%, 18.12% and 3.76%, respectively. It could be inferred that the four structures of the random coil, α helix, extended strand and β turn were the main bodies that made up the secondary structure of the SMAD1, SMAD2 and SMAD3 proteins. The tertiary structural models of the SMAD1 (Figure 4A), SMAD2 (Figure 4B) and SMAD3 (Figure 4C) proteins were established by the SWISS-MODEL software, and the results showed that they were consistent with the predicted secondary structures.

3.4. The mRNA Expression of SMAD1, SMAD2 and SMAD3 Genes in the Different Tissues of Tibetian Sheep

The RT-qPCR was used to investigate the tissue distributions of the SMAD1, SMAD2 and SMAD3 genes in Tibetan sheep. The results showed that the mRNA of the SMAD1, SMAD2 and SMAD3 genes exhibited a widespread expression in all thirteen tissues including the hypothalamus, pituitary, heart, liver, spleen, lung, kidney, ovary, uterus, oviduct, rumen, duodenum and longissimus dorsi (Figure 5).
The expression of the SMAD1 gene in the spleen was significantly higher than in other tissues (p < 0.05) and its expression was significantly higher in the uterus than in the hypothalamus, ovary, oviduct, duodenum, rumen, pituitary, heart, liver, kidney and longissimus dorsi (p < 0.05). SMAD1 gene expression in the lung was significantly higher than in the oviduct, duodenum, rumen, pituitary, heart, liver, kidney, heart and longissimus dorsi (p < 0.05). SMAD1 gene expression in the oviduct was significantly higher than in the kidney, heart and longissimus dorsi (p < 0.05). However there were not significant differences among the lung, hypothalamus and ovary (p > 0.05). The mRNA expression of the SMAD2 gene was significantly higher in the lung than in other tissues (p < 0.05), and SMAD2 gene expression in the spleen was significantly higher than in the uterus, duodenum, liver, kidney, oviduct, rumen, pituitary, heart, hypothalamus and longissimus dorsi (p < 0.05). However, there were not significant differences among the ovary and uterus (p > 0.05).
The mRNA expression of the SMAD3 gene in the uterus was significantly higher than in other tissues (p < 0.05). SMAD3 gene expression in the spleen was significantly higher than in the ovary, lung, oviduct, duodenum, pituitary, kidney, rumen, hypothalamus, liver, heart and longissimus dorsi muscle (p < 0.05). SMAD3 gene expression in the ovary was significantly higher than that in the lung, oviduct, duodenum, pituitary, kidney, rumen, hypothalamus, liver, heart and longissimus dorsi muscle (p < 0.05). SMAD3 gene expression in the lungs was significantly higher than in the oviduct, duodenum, pituitary, kidney, rumen, hypothalamus, liver, heart and longissimus dorsi muscle (p < 0.05), and the expression in the oviduct was significantly higher than in the pituitary, kidney, rumen, hypothalamus, liver, heart and longissimus dorsi muscle (p < 0.05).

3.5. Population Genetic Analysis of Polymorphisms in Tibetan Sheep SMAD1, SMAD2 and SMAD3

Four SNPs of the SMAD1 gene were screened: g.45975G>A and g.45823T>C were located in the 2nd exon region; g.10729C>T was located in the 5th exon; and g.440G>A was located in the 7th exon, all of which were synonical mutations (Table 3). Three genotypes were detected in g.45975G>A including GG, GA and AA, of which the dominant genotypes were GG and the dominant alleles were G (Table 3). The homozygosity (Ho), heterozygosity (He) and effective allele numbers (Ne) for g.45975G>A were 0.75, 0.25 and 1.34, respectively (Table 4). Only two genotypes were detected at the g.440G>A, namely GG and GA, with the dominant genotype being GG and the dominant allele being G (Table 3). The Ho, He and Ne were 0.92, 0.08, and 1.08, respectively (Table 4). TT, TC and CC genotypes were detected at the g.45823T>C mutation site, where the dominant genotype was CC and the dominant allele was C (Table 3). The Ho, He, and Ne were 0.63, 0.37 and 1.58, respectively (Table 4). Only CC and CT were detected at the g.10729C>T mutation site, with the dominant genotype being CC and the dominant allele being C (Table 3). The Ho, He and Ne were 0.96, 0.04 and 1.04, respectively (Table 4). SMAD2 gene screening obtained a synonical mutation site located in exon 8, and three genotypes were detected at the g.14946G>A mutation site, namely, GG, GA and AA. The dominant genotype was GG and the dominant allele was G (Table 3). The Ho, He and Ne were 0.58, 0.42 and 1.73, respectively (Table 4). SMAD3 gene screening yielded a total of 5 SNPs, of which g.5133C>T was located in the 4th exon region, g.18965C>T and g.18905T>C were located in the 6th exon region and g.21447C>T and g.21551A>G were located in the 7th exon region. Except for g.18905T>C, which was a missense mutation, the rest of the SNPs were synonical mutations. Three genotypes were detected at the three mutant loci of g.21447C>T, g.18965C>T and g.5133C>T, namely, CC, CT, and TT. The dominant genotype of the first two was CC and the dominant allele was C, while the dominant genotype at the third mutant site was CT and dominant allele was C (Table 3). On these three SNPs, the Ho was 0.69, 0.75 and 0.54, the He was 0.31, 0.25 and 0.46 and the Ne was 1.45, 1.34 and 1.85, respectively (Table 4). At the g.18905T>C mutation site, three genotypes of TT, TC and CC were detected, with the dominant genotype being CC and the dominant allele being C (Table 3). At this mutation site, the Ho, He, and Ne were 0.56, 0.44, and 1.79, respectively (Table 4). At the g.21551A>G mutation site, AA, AG and GG were detected, with the dominant genotype being GG and the dominant allele being G (Table 3). At this mutation site, the Ho, He, and Ne were 0.56, 0.44, and 1.79, respectively (Table 4). The results of the PIC analysis showed that the SMAD1 gene g.45823T>C locus, the SMAD2 gene g.14946G>A locus and the SMAD3 gene g.21447C>T, g.5133C>T, g.18905T>C and g.21551A>G loci were all moderate polymorphic (0.25 < PIC < 0.5). The SMAD1 gene g.45975G>A, g.440G>A and g.10729C>T sites and the SMAD3 gene g.18965C>T sites were all in low-degree polymorphism (PIC < 0.25) (Table 4). The χ2 test showed that the genotype distribution of all the mutation loci of all genes were in a Hardy–Weinberg equilibrium state (p > 0.05) (Table 4).

3.6. Association Analysis of SMAD1, SMAD2 and SMAD3 Genes between SNPs and Litter Size in Tibetian Sheep

The association analysis of the genotypes with litter size was conducted in this study (Table 5). For g.10729C>T in the SMAD1 gene, individuals with genotype CC had a significantly higher litter size compared with genotype CT (p < 0.05). For g.45975G>A, g.45823T>C and g.440G>A in SMAD1, there was no significant difference between disparate genotypes in relation to the litter size (p > 0.05). The g.14946G>A locus genotype in the SMAD2 gene was not significantly correlated with the litter size in Tibetan sheep. Ewes carrying genotype TT of the g.21447C>T locus in the SMAD3 gene had a significantly higher litter size than those carrying genotype CT and CC (p < 0.05). For g.5133C>T, g.18965C>T, g.18905T>C and g.21551A>G in the SMAD3 gene, there was no significant difference between disparate genotypes in relation to the litter sizes (p > 0.05).

3.7. Linkage Disequilibrium and Haplotype Analysis of SNPs in SMAD1 and SMAD3 Genes in Tibetan Sheep

The results of the linkage disequilibrium analysis of SNPs loci of the SMAD1 and SMAD3 gene are shown in Figure 6. Two blocks were found in the SMAD1 gene (Figure 6A). The first block with g.440G>A and g.10729C>T variants of the SMAD1 gene was completely linked; three haplotypes (AC, GC and GT) were found in the Tibetan sheep population, and the frequency of the GC haplotype was the highest (0.94), whereas that of the GT haplotype was the lowest (0.02) (Table 6). The second block with g.45823T>C and g.45975G>A variants of the SMAD1 gene was completely linked; three haplotypes (CA, CG and TG) were found in the Tibetan sheep population, and the frequency of the CG haplotype was the highest (0.71), whereas that of the CA haplotype was the lowest (0.16) (Table 6). Seven blocks were found in the SMAD3 gene (Figure 6B). The first block with g.5133C>T and g.18905T>C variants of the SMAD3 gene was completely linked; three haplotypes (CC, CT and TC) were found in the Tibetan sheep population, and the frequency of the TC haplotype was the highest (0.61) (Table 6). The other six blocks between g.18905T>C, g.18965C>T, g.21447C>T and g.21551A>G variants of the SMAD3 gene were completely linked; four haplotypes (CCCG, CCTG, CTCG and TCCA) were found in the Tibetan sheep population, and the frequency of the CCCG haplotype was the highest (0.59), whereas that of the CTCG haplotype was the lowest (0.20) (Table 6).

4. Discussion

SMADs genes are involved in important physiological processes such as disease, immune regulation, growth and development, wound healing, cartilage and bone development and maintenance through the TGFβ superfamily. These genes also regulate the proliferation, differentiation, maturation, adhesion, atresia, apoptosis and steroid hormone production of germ cells [6,7,30]. Therefore, understanding the structure and function of SMADs genes is of great significance for the study of animal growth, development and reproduction, and can avoid the differences caused by artificial selection on gene evolution. In this study, the SMAD1, SMAD2 and SMAD3 genes of Tibetan sheep were successfully cloned. The ORFs were found to contain 1398 bp, 1404 bp and 1278 bp, respectively, and encoded 465, 467 and 425 amino acids, respectively. The detection of ORFs is an important step in finding protein-coding genes in genomic sequences [31]. The amino acid sequences of SMAD1, SMAD2 and SMAD3 in Tibetan sheep were more than 90% homologous to the 11 selected species and 100% similar to sheep. Compared with non-ruminants, the SMAD1, SMAD2, and SMAD3 genes are more conserved in ruminants. The average hydrophilic indices of the SMAD1, SMAD2 and SMAD3 proteins were all negative, and the instability coefficients were all >40, all of which were unstable hydrophilic proteins. The SMAD1, SMAD2 and SMAD3 proteins were all composed of a random coil, α helix, extended strand and β turns, all of which were mixed proteins. Thus, the SMAD1, SMAD2, and SMAD3 proteins were all unstable hydrophilic mixed proteins.
SMAD1, as an important transcription factor downstream of the TGF-β/SMADs signaling pathway, is widely distributed in different tissues and mediates several types of physiological processes [12]. Tian et al. [22] found that the SMAD1 gene was expressed in the whole-body tissues of small-tailed Han sheep with different fecundity, and the expression of ovaries in the single-lamb population of small-tailed Han sheep was significantly higher than that of the multi-lamb population (p < 0.01). The expression of the hypothalamus and pituitary in the small-tailed Han sheep population was also significantly higher than that of the multi-lamb population (p < 0.05). Niu et al. [32] used RT-PCR technology to detect the expression profile of SMAD1 mRNA in yak tissue and found that the SMAD1 gene was broadly expressed. Ao et al. [33] found that the SMAD1 gene was expressed in various tissues of Qianbei Ma Goats. The above is consistent with the use of RT-qPCR to detect extensive expression in various tissues of Tibetan sheep in this study. The relative mRNA expression of the SMAD1 gene in the ovary and uterus differed from that found by Tian et al. [22], possibly due to different varieties. SMAD2/SMAD3 is a key molecule in the classic TGF-β/Smads signaling pathway, which can directly regulate the growth and development of follicles and ovulation by regulating the maturation of oocytes, the proliferation, differentiation and apoptosis of granulocytes, the regulation of human FSHβ promoter activity, the maintenance of normal aromatase expression levels, and the maintenance of the normal secretory function of the ovaries [34,35]. Researchers have found in cultured ovarian cells that activating the SMAD2/3 signal transduction pathway induces cell expansion and protects amplified ovulus cells from apoptosis, while also inducing the expression of expansion-related genes [36]. Zheng [37] detected the results of the SMAD2 gene expression profiling in various tissues of Hu sheep, which was consistent with our results. The relative expression of SMAD1, SMAD2 and SMAD3 genes in Tibetan sheep lung may be related to the hypoxic fitness of Tibetan sheep.
Single nucleotide polymorphisms (SNPs) are nucleotide changes at individual genomic loci between important subgroups of populations and are the main source of genomic variation. As molecular markers, SNPs are becoming increasingly attractive because they are associated with many important productive traits in livestock [38]. Missense mutations lead to defective protein translation and are associated with many diseases [39]. Synonymous mutations do not usually cause changes in the function of the coding protein, but some synonymous mutations have been shown to affect the secondary structure of the mRNA, the folding and conformation of proteins, etc., [40], which in turn leads to changes in gene function and phenotype. Recent studies have shown that synonymous mutations play a role in the regulation of sheep production traits [41,42,43]. In the present study, through the association analysis of a total of 10 SNPs genotypes of the SMAD1, SMAD2 and SMAD3 genes and litter size in Tibetan sheep population, it was found that the two synonymous mutation sites of the SMAD1 gene g.10729C>T and the SMAD3 gene g.21447C>T were significantly associated with litter size, while the SMAD3 gene g.18905T>C was not significantly associated with the litter size. A population genetic analysis found that the SMAD1 gene g.45823T>C locus, SMAD2 gene g.14946G>A locus and SMAD3 gene g.21447C>T, g.5133C>T, g.18905T>C and g.21551A>G loci were all moderate polymorphisms (0.25 < PIC < 0.5). The 10 SNPs loci were all in the Hardy–Weinberg equilibrium state in the Tibetan sheep population, indicating that the different genotypes of the 10 SNPs were widely present in the Tibetan sheep and could be stably passed on to future generations. Xu et al. [23] have found that the rs40635766 mutation located in the intron region of the SMAD1 gene is closely related to the fertility of Hu sheep and may be a dominant gene that controls the multi-lamb reproduction of Hu sheep. Tian et al. [22] found that the litter size in the first three parities of the g.12487190G>T locus TT genotype small-tailed Han sheep ewes located in the intron 5 region was significantly higher than that of the GT and GG genotype ewes (p < 0.05). In this study, for g.10729C>T in the SMAD1 gene, individuals with genotype CC had a significantly larger litter size compared with genotype CT (p < 0.05). Ewes carrying genotype TT of the g.21447C>T locus in the SMAD3 gene had a significantly larger litter size than those carrying genotype CT and CC (p < 0.05). Therefore, the SMAD1 and SMAD3 gene could be used as molecular markers for improving litter size in Tibetan sheep. Linkage disequilibrium analysis can detect the interplay between multiple genetic loci, and haplotypes include the simple addition and interaction of multiple SNPs to more effectively interpret the genetic information of phenotypic traits [44]. A total of six kinds of haplotypes in SMAD1 and seven in SMAD3 were obtained in this study, respectively. However, further studies on the mechanism of SMADs affecting the litter size of Tibetan sheep are required.

5. Conclusions

In this study, we found that the ORFs of the SMAD1, SMAD2 and SMAD3 genes were 1398 bp, 1404 bp and 1278 bp, respectively, and encoded 465, 467 and 425 amino acids, respectively. The SMAD1, SMAD2, and SMAD3 proteins were all unstable hydrophilic mixed proteins and had the closest relationship to the sheep. The SMAD1, SMAD2 and SMAD3 genes were widely expressed in Tibetan sheep tissues, and all were highly expressed in the uterus, spleen, ovary and lung tissues. The litter size of the genotype CC in the SMAD1 gene g.10729C>T locus was significantly higher than that of CT (p < 0.05), and in the SMAD3 gene g.21447C>T locus, the genotype TT individuals showed higher litter sizes than the CC and CT genotype individuals (p < 0.05). Therefore, the SMAD1 and SMAD3 genes may be important candidate genes affecting litter size in Tibetan sheep, and the SMAD1 gene g.10729C>T locus and the SMAD3 gene g.21447C>T locus have important values for molecular marking assistant selection of litter sizes in Tibetan sheep.

Author Contributions

Conceptualization, J.Z. and X.W.; methodology, M.L. and J.Z.; software, M.L. and N.H.; validation, M.L.; data curation, J.Z. and X.W.; writing—original draft preparation, M.L. and J.Z.; writing—review and editing, M.L., N.H., R.S., Y.D., X.W. and J.Z.; visualization, M.L. and N.H.; supervision, J.Z.; project administration, J.Z.; funding acquisition, J.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the funds of the Science and Technology Planning Program of Qinghai (Science and Technology Department of Qinghai Province) (Grant No. 2020-ZJ-786); Outstanding person of Kunlong· rural revitalization Program (Grant No.(2020)9).

Institutional Review Board Statement

All experiments in this study were carried out in accordance with the approved guidelines of the Regulation of the Standing Committee of Qinghai People’s Congress. All experimental protocols and the collection of samples were approved by the Ethics Committee of Qinghai University under permission no. SL-2021027.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Qingwei Wu for the help with experiments. We are grateful to Yuting Deng and Shengwei Jin for the assistance with sample collections.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Guo, Y.J.; Liu, M.M.; Fu, D.H.; Ran, X.R.; Wang, X.R. Obseration of ovary histology and ultrastructure of follicles in Tibetan sheep. Acta Vet. Zootech. Sinica 2021, 52, 389–398. [Google Scholar] [CrossRef]
  2. Abd, E.M.E.; Abdelnour, S.A.; Swelum, A.A.; Arif, M. The application of gene marker-assisted selection and proteomics for the best meat quality criteria and body measurements in Qinchuan cattle breed. Mol. Biol. Rep. 2018, 45, 1445–1456. [Google Scholar] [CrossRef] [Scilit]
  3. Tesema, Z.; Alemayehu, K.; Getachew, T.; Kebede, D.; Deribe, B.; Taye, M.; Tilahun, M.; Lakew, M.; Kefale, A.; Belayneh, N.; et al. Estimation of genetic parameters for growth traits and Kleiber ratios in Boer x Central Highland goat. Trop. Anim. Health Prod. 2020, 52, 3195–3205. [Google Scholar] [CrossRef] [Scilit]
  4. Raina, V.S.; Kour, A.; Chakravarty, A.K.; Vohra, V. Marker-assisted selection vis-à-vis bull fertility: Coming full circle-a review. Mol. Biol. Rep. 2020, 47, 9123–9133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Xu, J.; Oakley, J.; Mc, G.E.A. Stage-specific expression of Smad2 and Smad3 during folliculogenesis. Biol. Reprod. 2002, 66, 1571–1578. [Google Scholar] [CrossRef] [Scilit]
  6. Heldin, C.H.; Moustakas, A. Role of Smads in TGFβ signaling. Cell Tissue Res. 2012, 347, 21–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Sakaki-Yumoto, M.; Liu, J.; Ramalho-Santos, M.; Yoshida, N.; Derynck, R. Smad2 is essential for maintenance of the human and mouse primed pluripotent stem cell state. J. Biol. Chem. 2013, 288, 18546–18560. [Google Scholar] [CrossRef] [Scilit]
  8. Lan, H.Y. Transforming growth factor-β/Smad signalling in diabetic nephropathy. Clin. Exp. Pharmacol. Physiol. 2012, 39, 731–738. [Google Scholar] [CrossRef] [Scilit]
  9. Wakefield, L.M.; Hill, C.S. Beyond TGFβ: Roles of other TGFβ superfamily members in cancer. Nat. Rev. Cancer 2013, 13, 328–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Rodriguez, A.; Tripurani, S.K.; Burton, J.C.; Clementi, C.; Larina, I.; Pangas, S.A. SMAD signaling is required for structural integrity of the female reproductive tract and uterine function during early pregnancy in mice. Biol. Reprod. 2016, 95, 44–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Budi, E.H.; Duan, D.; Derynck, R. Transforming growth factor-β receptors and Smads: Regulatory complexity and functional versatility. Trends Cell Biol. 2017, 27, 658–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Massagué, J.; Wotton, D. Transcriptional control by the TGF-β/Smad signaling system. EMBO J. 2000, 19, 1745–1754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Okamura, D.; Hayashi, K.; Matsui, Y. Mouse epiblasts change responsiveness to BMP4 signal required for PGC formation through functions of extraembryonic ectoderm. Mol. Reprod. Dev. 2005, 70, 20–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Hayashi, K.; Kobayashi, T.; Umino, T.; Goitsuka, R.; Matsui, Y.; Kitamura, D. SMAD1 signaling is critical for initial commitment of germ cell lineage from mouse epiblast. Mech. Dev. 2002, 118, 99–109. [Google Scholar] [CrossRef] [Scilit]
  15. Pangas, S.A.; Li, X.; Umans, L.; Zwijsen, A.; Huylebroeck, D.; Gutierrez, C.; Wang, D.; Martin, J.F.; Jamin, S.P.; Behringer, R.R.; et al. Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice. Mol. Cell. Biol. 2008, 28, 248–257. [Google Scholar] [CrossRef] [Scilit]
  16. Li, Q.; Pangas, S.A.; Jorgez, C.J.; Graff, J.M.; Weinstein, M.; Matzuk, M.M. Redundant roles of SMAD2 and SMAD3 in ovarian granulosa cells in vivo. Mol. Cell. Biol. 2008, 28, 7001–7711. [Google Scholar] [CrossRef] [Scilit]
  17. Monsivais, D.; Nagashima, T.; Prunskaite-Hyyryläinen, R.; Nozawa, K.; Shimada, K.; Tang, S.; Hamor, C.; Agno, J.E.; Chen, F.; Masand, R.P.; et al. Endometrial receptivity and implantation require uterine BMP signaling through an ACVR2A-SMAD1/SMAD5 axis. Nat. Commun. 2021, 12, 3386. [Google Scholar] [CrossRef] [Scilit]
  18. Tomic, D.; Miller, K.P.; Kenny, H.A.; Woodruff, T.K.; Hoyer, P.; Flaws, J.A. Ovarian follicle development requires Smad3. Mol. Endocrinol. 2004, 18, 2224–2240. [Google Scholar] [CrossRef] [Scilit]
  19. Martinez, C.A.; Cambra, J.M.; Gil, M.A.; Parrilla, I.; Alvarez-Rodriguez, M.; Rodriguez-Martinez, H.; Cuello, C.; Martinez, E.A. Seminal Plasma Induces Overexpression of Genes Associated with Embryo Development and Implantation in Day-6 Porcine Blastocysts. Int. J. Mol. Sci. 2020, 21, 3662. [Google Scholar] [CrossRef] [Scilit]
  20. Fernandes, C.A.C.; Lopes, A.C.; Gonçalves, F.C.; Pereira, J.R.; Guimarães, J.P.A.; Castilho, A.C.S.; Caixeta, E.S. Improvement in early antral follicle development and gene expression modulation prior to follicle aspiration in bovine cumulus-oocyte complexes by equine chorionic gonadotropin. Theriogenology 2021, 172, 281–288. [Google Scholar] [CrossRef] [Scilit]
  21. Xia, Q.; Li, Q.; Gan, S.; Guo, X.; Zhang, X.; Zhang, J.; Chu, M. Exploring the roles of fecundity-related long non-coding RNAs and mRNAs in the adrenal glands of small-tailed Han Sheep. BMC Genet. 2020, 21, 39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Tian, Z.L.; Tang, J.S.; Sun, Q.; Wang, Y.Q.; Zhang, X.S.; Zhang, J.L.; Chu, M.X. Tissue expression of SMAD1 gene in sheep and its correlation between polymorphisms and lambing number. Chin. J. Agric. Sci. 2019, 52, 755–766. [Google Scholar] [CrossRef]
  23. Xu, S.S.; Gao, L.; Xie, X.L.; Ren, Y.L.; Shen, Z.Q.; Wang, F.; Shen, M.; Eyϸórsdóttir, E.; Hallsson, J.H.; Kiseleva, T.; et al. Genome-Wide Association Analyses Highlight the Potential for Different Genetic Mechanisms for Litter Size Among Sheep Breeds. Front. Genet. 2018, 9, 118. [Google Scholar] [CrossRef] [Scilit]
  24. Zheng, J.; Wang, Z.B.; Yang, H.; Yao, X.L.; Yang, P.C.; Ren, C.F.; Wang, F.; Zhang, Y.L. Pituitary Transcriptomic Study Reveals the Differential Regulation of lncRNAs and mRNAs Related to Prolificacy in Different FecB Genotyping Sheep. Genes 2019, 10, 157. [Google Scholar] [CrossRef] [Scilit]
  25. Kumar, S.; Rajput, P.K.; Bahire, S.V.; Jyotsana, B.; Kumar, V.; Kumar, D. Differential expression of BMP/SMAD signaling and ovarian-associated genes in the granulosa cells of FecB introgressed GMM sheep. Syst. Biol. Reprod. Med. 2020, 66, 185–201. [Google Scholar] [CrossRef] [Scilit]
  26. Bahire, S.V.; Rajput, P.K.; Kumar, V.; Kumar, D.; Kataria, M.; Kumar, S. Quantitative expression of mRNA encoding BMP/SMAD signalling genes in the ovaries of Booroola carrier and non-carrier GMM sheep. Reprod. Domest. Anim. 2019, 54, 1375–1383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Yuan, Z.H.; Luo, J.; Wang, L.; Li, F.D.; Li, W.H.; Yue, X.P. Expression of DAZL Gene in Selected Tissues and Association of Its Polymorphisms with Testicular Size in Hu Sheep. Animals 2020, 10, 740. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Zhao, H.Y.; Wu, X.F.; Cai, H.F.; Pan, C.Y.; Lei, C.; Chen, H.; Lan, X.Y. Genetic variants and effects on milk traits of the caprine paired-like homeodomain transcription factor 2 (PITX2) gene in dairy goats. Gene 2013, 532, 203–210. [Google Scholar] [CrossRef] [Scilit]
  29. Barrett, J.C.; Fry, B.; Maller, J.; Daly, M.J. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics 2005, 21, 263–265. [Google Scholar] [CrossRef] [Scilit]
  30. Tan, B.; Yang, S.L.; Yang, R.C.; Wang, X.P.; Zhou, M.D.; Zhou, X.; Yang, S.H. Research progress on the application of SMAD3 gene in animal husbandry production. China Anim. Husb. Vet. Med. 2019, 46, 185–193. [Google Scholar] [CrossRef]
  31. Sieber, P.; Platzer, M.; Schuster, S. The Definition of Open Reading Frame Revisited. Trends Genet. 2018, 34, 167–170. [Google Scholar] [CrossRef] [Scilit]
  32. Niu, J.Q.; Suo, L.S.Z.; Xu, Y.F.; Wang, Y.H.; Shang, P.; Qiang, B.Y.D.; Guo, M.; Xi, G.Y.; Zhao, L.D. Tissue expression profiling of bta-miR-1434-5p and Smad1 genes and construction of luciferase reporter vectors in yak. J. China Agric. Univ. 2018, 23, 52–59. [Google Scholar] [CrossRef]
  33. Ao, Y.; Chen, X.; Zhou, Z.N.; Zhang, Y.; Hong, L.; Wei, S.N.; Wu, Y.; Tang, W. Effect of SMAD1 gene on ovarian granule cells and tissue expression analysis of Sheep. J. Anim. Husb. Vet. Med. 2020, 51, 1607–1618. [Google Scholar] [CrossRef]
  34. Massagué, J.; Gomis, R.R. The logic of TGFbeta signaling. FEBS Lett. 2006, 580, 2811–2820. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Wang, Y.; Fortin, J.; Lamba, P.; Bonomi, M.; Persani, L.; Roberson, M.S.; Bernard, D.J. Activator protein-1 and smad proteins synergistically regulate human follicle-stimulating hormone β-promoter activity. Endocrinology 2008, 149, 5577–5591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Wu, F.J.; Wang, Y.W.; Luo, C.W. Human bone morphogenetic protein 8A promotes expansion and prevents apoptosis of cumulus cells in vitro. Mol. Cell. Endocrinol. 2021, 522, 111121. [Google Scholar] [CrossRef] [Scilit]
  37. Zheng, J. Differential Expression of lncRNA/mRNA in Sheep with High and Low Fertility Lakes and Related Studies on Candidate Gene SMAD2. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, June 2019. [Google Scholar] [CrossRef]
  38. Benavides, M.V.; Sonstegard, T.S.; Van, T.C. Genomic Regions Associated with Sheep Resistance to Gastrointestinal Nematodes. Trends Parasitol. 2016, 32, 470–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Lee, S.T.; Choi, K.W.; Yeo, H.T.; Kim, J.W.; Ki, C.S.; Cho, Y.D. Identification of an Arg35X mutation in the PDCD10 gene in a patient with cerebral and multiple spinal cavernous malformations. J. Neurol. Sci. 2008, 267, 177–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Kimchi-Sarfaty, C.; Oh, J.M.; Kim, I.W.; Sauna, Z.E.; Calcagno, A.M.; Ambudkar, S.V.; Gottesman, M.M. A “silent” polymorphism in the MDR1 gene changes substrate specificity. Science 2007, 315, 525–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Wang, W.; La, Y.; Li, F.; Liu, S.; Pan, X.; Li, C.; Zhang, X. Molecular Characterization and Expression Profiles of the Ovine LHβ Gene and Its Association with Litter Size in Chinese Indigenous Small-Tailed Han Sheep. Animals 2020, 10, 460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Zhang, D.; Zhang, X.; Li, F.; La, Y.; Li, G.; Zhang, Y.; Li, X.; Zhao, Y.; Song, Q.; Wang, W. The association of polymorphisms in the ovine PPARGC1B and ZEB2 genes with body weight in Hu sheep. Anim. Biotechnol. 2022, 33, 90–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Zhao, L.; Li, F.; Yuan, L.; Zhang, X.; Zhang, D.; Li, X.; Zhang, Y.; Zhao, Y.; Song, Q.; Wang, J.; et al. Expression of ovine CTNNA3 and CAP2 genes and their association with growth traits. Gene 2022, 807, 145949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Akey, J.; Jin, L.; Xiong, M. Haplotypes vs single marker linkage disequilibrium tests: What do we gain? Eur. J. Hum. Genet. 2001, 9, 291–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. SMAD1 (A), SMAD2 (B) and SMAD3 (C) polypeptide sequence identity of Tibetan sheep with 11 other species. The red highlight text is the species studied in this article.
Figure 1. SMAD1 (A), SMAD2 (B) and SMAD3 (C) polypeptide sequence identity of Tibetan sheep with 11 other species. The red highlight text is the species studied in this article.
Genes 13 02307 g001aGenes 13 02307 g001b
Figure 2. Phylogenetic tree of SMAD1 (A), SMAD2 (B) and SMAD3 (C) of Tibetan sheep with 11 other species. The red highlighted text is the species studied in this article.
Figure 2. Phylogenetic tree of SMAD1 (A), SMAD2 (B) and SMAD3 (C) of Tibetan sheep with 11 other species. The red highlighted text is the species studied in this article.
Genes 13 02307 g002aGenes 13 02307 g002b
Figure 3. Protein secondary structure of SMAD1 (A), SMAD2 (B) and SMAD3 (C) in Tibetan sheep. The α helix is in blue, the β turn is in green, the random coil is in yellow, and the extended strand is in red.
Figure 3. Protein secondary structure of SMAD1 (A), SMAD2 (B) and SMAD3 (C) in Tibetan sheep. The α helix is in blue, the β turn is in green, the random coil is in yellow, and the extended strand is in red.
Genes 13 02307 g003aGenes 13 02307 g003b
Figure 4. Protein tertiary structure of SMAD1 (A), SMAD2 (B) and SMAD3 (C) in Tibetan sheep.
Figure 4. Protein tertiary structure of SMAD1 (A), SMAD2 (B) and SMAD3 (C) in Tibetan sheep.
Genes 13 02307 g004
Figure 5. The mRNA expression of SMAD1, SMAD2 and SMAD3 genes in different tissues of Tibetan sheep. Bars with different letters indicate values with significant differences (n = 3) (p < 0.05).
Figure 5. The mRNA expression of SMAD1, SMAD2 and SMAD3 genes in different tissues of Tibetan sheep. Bars with different letters indicate values with significant differences (n = 3) (p < 0.05).
Genes 13 02307 g005aGenes 13 02307 g005b
Figure 6. Linkage disequilibrium analysis of single nucleotide polymorphisms (SNPs) in SMAD1 (A) and SMAD3 (B) genes. The number in the blank indicates the D′ value (%).
Figure 6. Linkage disequilibrium analysis of single nucleotide polymorphisms (SNPs) in SMAD1 (A) and SMAD3 (B) genes. The number in the blank indicates the D′ value (%).
Genes 13 02307 g006
Table 1. The primer sequence information used for the cDNA cloning and expression analysis of Smad1, Smad2 and Smad3.
Table 1. The primer sequence information used for the cDNA cloning and expression analysis of Smad1, Smad2 and Smad3.
GeneGenBank IDPrimer Sequence (5′~3′)Product Size (bp)Tm (°C)Application
SMAD1XM_027956253.2TTTCAGGACCTCCGCACGAA
CTGAATCCGACAGTTGGTCAC
165759Cloning
SMAD2XM_027960887.2CCACCGCTTTTGGTAAGAACA
ACCAATTCCACAAGGTGCTTT
149056Cloning
SMAD3XM_042252071.1AACCAGCAAGTTCGCCGAGA
GCCCTCTTCCCCAGATCCAC
147362Cloning
SMAD1XM_027961247.1F:TCATCCCGGGAGGTGGCAGA
R:GACCTCCTTCAGCCGCTGGT
7564qPCR
SMAD2XM_027960887.1F:AGGGTGGGGAGCAGAATACCG
R:TTGTCCAACCACTGTAGAGGTCCA
9363qPCR
SMAD3XM_027971520.1F:CCCAGCCACCGTCTGCAAGAT
R:CCAAGAGGGCGGCGAACTCC
7765qPCR
GAPDHNM_001190390.1F:GCGAGATCCTGCCAACATCAAGT
R:CCCTTCAGGTGAGCCCCAGC
10565Reference gene
Table 2. iMLDR genotyping primer.
Table 2. iMLDR genotyping primer.
GeneLocusPCR Primer Sequence (5′~3′)LDR Primer Sequence (5′~3′)
SMAD1g.45975G>AF: 5′ACACAGATCTGCTCAATGCCTCTAC3′
R: 5′GAAGAGACTTCTTGGCTGGAAACAG3′
3′-end marker:TGAGCTGCCCGGGCCAGCTTTTTTTTTTTTTTTTTTTTTTT
Allele 1:TGTTCGTGGGCCGGATTAGTTTCATGGAGGAACTGGAAAAGGACT
Allele 2:TGTTCGTGGGCCGGATTAGTCATGGAGGAACTGGAAAAGGACC
g.440G>AF:5′GTGAGCCCATCTGGGTAAGGAC3′
R: 5′GCAGGTTAAATGACTCCCACTCTTG3′
3′-end marker:GAGATCCATCTGCACGGCCCTTTTTTTTTTTTTTTTTTT
Allele 1:TGTTCGTGGGCCGGATTAGTTTCCAGCACSCCCTGCTGGCTT
Allele 2:TGTTCGTGGGCCGGATTAGTCCAGCACSCCCTGCTGGTTC
g.45823T>CF: 5′ACACAGATCTGCTCAATGCCTCTAC3′
R: 5′GAAGAGACTTCTTGGCTGGAAACAG3′
3′-end marker:GGYTTCAGTTCRTGGTGGCTTTTTTTTTTTTTTTTTTTTTTTT
Allele 1:TCTCTCGGGTCAATTCGTCCTTAAGGGAAACTCGCAGCATTCCTAC
Allele 2:TCTCTCGGGTCAATTCGTCCAAGGGAAACTCGCAGCATTCCTAT
g.10729C>TF: 5′GTTGGAAGGATCGGTGAAACCAT3′
R: 5′CCAACTTTACGCCACAGTTTCAGT3′
3′-end marker:GGCTCCTCATARGCAACCGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
Allele 1:TTCCGCGTTCGGACTGATATGAGCTCATAGTAGACAATAGAGCACCAGTGTGTC
Allele 2:TTCCGCGTTCGGACTGATATTTGAGCTCATAGTAGACAATAGAGCACCAGTGTGTT
SMAD2g.14946G>AF: 5′CGTTGGAGAGTAAACCTAGGCAGAAC3′
R: 5′CAGACTTGCAGCCAGTTACTTACTCAG3′
3′-end marker:TCTACGGTGAGTGAGGGCTGTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
Allele 1:TTCCGCGTTCGGACTGATATTTCAGAATTTGATGGATCTGTGAAGACA
Allele 2:TTCCGCGTTCGGACTGATATCAGAATTTGATGGATCTGTGAAGACG
SMAD3g.21447C>TF: 5′AAGATCTTCAACAACCAGGAGTTC3′
R: 5′GGCCARCCTAGCTCATCTCTG3′
3′-end marker:GTCAACCAGGGCTTCGAGGCTTTTTTTTTTTTTTTTT
Allele 1:TTCCGCGTTCGGACTGATATCCGCCCTCTTGGCTCAGACC
Allele 2:TTCCGCGTTCGGACTGATATTTCCGCCCTCTTGGCTCAGACT
g.5133C>TF:5′ACTGTGATGTACACATCCTGTCATCTG 3′
R: 5′AGGGCTACAGCTAAAGGGGGTTC3′
3′-end marker:TGGGTAAGTAGYTCCTTATCTGTATGATTTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
Allele 1:TACGGTTATTCGGGCTCCTGCGATGTCCCCAGCACACAATATCC
Allele 2:TACGGTTATTCGGGCTCCTGTTCGATGTCCCCAGCACACAATACCT
g.18965C>TF: 5′- CCTAGTTTAGCAGCCCAGCATCAC3′
R: 5′GGTACCTGGTGGAATCTTGCAGAC3′
3′-end marker:TTGGGAGACTGCACAAAGATGGTTTTTTTTTTTTTTTTTTTTTTTTT
Allele 1:TGTTCGTGGGCCGGATTAGTCCAGCCATAGCGCTGGTTAGAG
Allele 2:TGTTCGTGGGCCGGATTAGTTTCCAGCCATAGCGCTGGTTAGAA
g.18905T>CF: 5′CCTAGTTTAGCAGCCCAGCATCAC3′
R: 5′GGTACCTGGTGGAATCTTGCAGAC3′
3′-end marker:ATGTAGTACAGCCGCACRCCTTTTTTTTTTTTTTTT
Allele 1:TACGGTTATTCGGGCTCCTGTTCTGCGAAGACCTCCCCTACG
Allele 2:TACGGTTATTCGGGCTCCTGCTGCGAAGACCTCCCCTGCA
g.21551A>GF: 5′AAGATCTTCAACAACCAGGAGTTC3′
R: 5′GGCCARCCTAGCTCATCTCTG3′
3′-end marker:CCTGTCCTAGGGSCGCAGTTTTTTTTTTTTTT
Allele 1:TACGGTTATTCGGGCTCCTGTACAGGTGGGTGCTGGGAYA
Allele 2:TACGGTTATTCGGGCTCCTGTTTACAGGTGGGTGCTGGGAYG
Note: in primers, Y, R and S represent annexed bases, which are, respectively, C/T, G/A, and C/G.
Table 3. Genotype and allele frequencies of SNPs loci of SMAD1, SMAD2 and SMAD3 genes in Tibetan sheep.
Table 3. Genotype and allele frequencies of SNPs loci of SMAD1, SMAD2 and SMAD3 genes in Tibetan sheep.
GeneLocusExonMutation TypeGenotypeGenotype Frequency (No.)AlleleAllele Frequency
SMAD1g.45975G>A2Synonymous mutationsGG0.73 (318)G0.85
GA0.23 (101)A0.15
AA0.03 (14)
g.440G>A7Synonymous mutationsGG0.92 (397)G0.96
GA0.08 (36)A0.04
AA0.00 (0)
g.45823T>C2Synonymous mutationsTT0.07 (29)T0.24
TC0.35 (149)C0.76
CC0.58 (245)
g.10729C>T5Synonymous mutationsCC0.96 (417)C0.98
CT0.04 (16)T0.02
TT0.00 (0)
SMAD2g.14946G>A8Synonymous mutationsGG0.47 (205)G0.70
GA0.46 (193)A0.30
AA0.08 (35)
SMAD3g.21447C>T7Synonymous mutationsCC0.65 (283)C0.81
CT0.31 (135)T0.19
TT0.03 (15)
g.5133C>T4Synonymous mutationsCC0.42 (184)C0.64
CT0.45 (200)T0.36
TT0.13 (59)
g.18965C>T6Synonymous mutationsCC0.73 (315)C0.85
CT0.25 (108)T0.15
TT0.02 (10)
g.18905T>C6Missense mutationTT0.12 (50)T0.33
TC0.42 (184)C0.67
CC0.46 (199)
g.21551A>G7Synonymous mutationsAA0.12 (50)A0.33
AG0.43 (186)G0.67
GG0.45 (197)
Table 4. Population genetic analysis of SNPs loci of SMAD1, SMAD2 and SMAD3 genes in Tibetan sheep.
Table 4. Population genetic analysis of SNPs loci of SMAD1, SMAD2 and SMAD3 genes in Tibetan sheep.
GeneLocusHomozygosity (Ho)Heterozygosity (He)Effective Allele Numbers (Ne)Polymorphic Information Content (PIC)χ2 Test
SMAD1g.45975G>A0.750.251.340.220.23
g.440G>A0.920.081.080.071.00
g.45823T>C0.630.371.580.300.79
g.10729C>T0.960.041.040.041.00
SMAD2g.14946G>A0.580.421.730.330.31
SMAD3g.21447C>T0.690.311.450.261.00
g.5133C>T0.540.461.850.350.40
g.18965C>T0.750.251.340.220.85
g.18905T>C0.560.441.790.340.51
g.21551A>G0.560.441.790.340.51
df = 1, χ20.05 = 3.841; df = 2, χ20.05 = 5.991.
Table 5. Association analysis between SNPs polymorphism of SMAD1, SAMD2 and SMAD3 genes and litter size in Tibetan sheep.
Table 5. Association analysis between SNPs polymorphism of SMAD1, SAMD2 and SMAD3 genes and litter size in Tibetan sheep.
GeneLocusGenotypeNo. of IndividualsLitter Size
SMAD1g.45975G>AGG3181.07 ± 0.25
GA1011.06 ± 0.24
AA141.14 ± 0.36
g.440G>AGG3971.07 ± 0.25
GA361.11 ± 0.32
AA00.00 ± 0.00
g.45823T>CTT291.07 ± 0.26
TC1591.05 ± 0.22
CC2451.08 ± 0.27
g.10729C>TCC4171.07 ± 0.26 a
CT161.00 ± 0.00 b
TT00.00 ± 0.00
SMAD2g.14946G>AGG2051.07 ± 0.25
GA1931.08 ± 0.28
AA351.00 ± 0.00
SMAD3g.21447C>TCC2831.06 ± 0.24 b
CT1351.06 ± 0.24 b
TT151.27 ± 0.46 a
g.5133C>TCC1841.09 ± 0.28
CT1901.04 ± 0.20
TT591.10 ± 0.30
g.18965C>TCC3151.07 ± 0.26
CT1081.07 ± 0.26
TT101.00 ± 0.00
g.18905T>CTT501.12 ± 0.33
TC1841.05 ± 0.23
CC1991.07 ± 0.26
g.21551A>GAA501.12 ± 0.33
AG1861.05 ± 0.23
GG1971.07 ± 0.26
At the same site, different lowercase letters of shoulder tags in the same column data indicate significant differences (p < 0.05); the same letters or no letters on the shoulder tags indicate that the differences are not significant (p > 0.05).
Table 6. Haplotypes of SMAD1 and SMAD3 genes SNPs loci.
Table 6. Haplotypes of SMAD1 and SMAD3 genes SNPs loci.
GeneSNPS LociHaplotypeHaplotype FrequencyORStd_Errorp-Value
SMAD1g.440G>A,
g.10729C>T
AC0.041.8550.56916160.2776538
GC0.94---
GT0.020.00000030.98904510.9879198
g.45823T>C,
g.45975G>A
CA0.161.1938680.3516370.6243151
CG0.71---
TG0.260.80582560.33591070.5204223
SMAD3g.5133C>T, g.18905T>CCC0.360.96274070.31818580.9050088
CT0.361.4923680.30588670.1905804
TC0.61---
g.18905T>C,
g.18965C>T,
g.21447C>T,
g.21551A>G
CCCG0.59---
CCTG0.231.9324290.35713370.06509204
CTCG0.201.5003280.44241840.3591594
TCCA0.371.5995930.31278250.1331385
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, M.; He, N.; Sun, R.; Deng, Y.; Wen, X.; Zhang, J. Expression and Polymorphisms of SMAD1, SMAD2 and SMAD3 Genes and Their Association with Litter Size in Tibetan Sheep (Ovis aries). Genes 2022, 13, 2307. https://doi.org/10.3390/genes13122307

AMA Style

Li M, He N, Sun R, Deng Y, Wen X, Zhang J. Expression and Polymorphisms of SMAD1, SMAD2 and SMAD3 Genes and Their Association with Litter Size in Tibetan Sheep (Ovis aries). Genes. 2022; 13(12):2307. https://doi.org/10.3390/genes13122307

Chicago/Turabian Style

Li, Mingming, Na He, Ruizhe Sun, Yuting Deng, Xiaocheng Wen, and Junxia Zhang. 2022. "Expression and Polymorphisms of SMAD1, SMAD2 and SMAD3 Genes and Their Association with Litter Size in Tibetan Sheep (Ovis aries)" Genes 13, no. 12: 2307. https://doi.org/10.3390/genes13122307

APA Style

Li, M., He, N., Sun, R., Deng, Y., Wen, X., & Zhang, J. (2022). Expression and Polymorphisms of SMAD1, SMAD2 and SMAD3 Genes and Their Association with Litter Size in Tibetan Sheep (Ovis aries). Genes, 13(12), 2307. https://doi.org/10.3390/genes13122307

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop