Next Article in Journal
Analysis of NAC Domain Transcription Factor Genes of Tectona grandis L.f. Involved in Secondary Cell Wall Deposition
Next Article in Special Issue
Estimates of Autozygosity Through Runs of Homozygosity in Farmed Coho Salmon
Previous Article in Journal
Expression of Heat Shock Proteins in Thermally Challenged Pacific Abalone Haliotis discus hannai
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Gene Profiling in the Adipose Fin of Salmonid Fishes Supports Its Function as a Flow Sensor

1
Fish Genetics Unit, Institute for Genome Biology, Leibniz Institute for Farm Animal Biology (FBN), Wilhelm-Stahl-Allee 2, 18196 Dummerstorf, Germany
2
Professorship for Molecular Biology and Fish Genetics, Faculty of Agriculture and Environmental Sciences, University of Rostock, 18055 Rostock, Germany
*
Author to whom correspondence should be addressed.
Genes 2020, 11(1), 21; https://doi.org/10.3390/genes11010021
Submission received: 6 November 2019 / Revised: 13 December 2019 / Accepted: 17 December 2019 / Published: 23 December 2019
(This article belongs to the Special Issue Genetics and Genomics of Salmonid Fishes)

Abstract

In stock enhancement and sea-ranching procedures, the adipose fin of hundreds of millions of salmonids is removed for marking purposes annually. However, recent studies proved the significance of the adipose fin as a flow sensor and attraction feature. In the present study, we profiled the specific expression of 20 neuron- and glial cell-marker genes in the adipose fin and seven other tissues (including dorsal and pectoral fin, brain, skin, muscle, head kidney, and liver) of the salmonid species rainbow trout Oncorhynchus mykiss and maraena whitefish Coregonus maraena. Moreover, we measured the transcript abundance of genes coding for 15 mechanoreceptive channel proteins from a variety of mechanoreceptors known in vertebrates. The overall expression patterns indicate the presence of the entire repertoire of neurons, glial cells and receptor proteins on the RNA level. This quantification suggests that the adipose fin contains considerable amounts of small nerve fibers with unmyelinated or slightly myelinated axons and most likely mechanoreceptive potential. The findings are consistent for both rainbow trout and maraena whitefish and support a previous hypothesis about the innervation and potential flow sensory function of the adipose fin. Moreover, our data suggest that the resection of the adipose fin has a stronger impact on the welfare of salmonid fish than previously assumed.

Graphical Abstract

1. Introduction

Salmonid fishes, including rainbow trout Oncorhynchus mykiss (Walbaum, 1792), Atlantic salmon Salmo salar L., and maraena whitefish Coregonus maraena (Bloch, 1779) are farmed in aquaculture facilities all over the world [1]. Their common characteristic is the adipose fin, which is situated on the dorsal midline between dorsal and caudal fin, although a total of 6000 species from eight orders of the Teleostei all possess an adipose fin [2]. Large numbers of artificially bred juvenile salmonids are released into sea-ranching procedures every year to produce 4.4 million tons of top-class food fish [3]. Furthermore, billions of salmonids are released in restocking or stock-enhancement projects [4]. Most of these animals are tagged to monitor the success of those research projects or indicate ownership relations [5] and to identify escapees from aquaculture farms. Those are considered as a serious problem since they reduce the natural gene pool [6].
In order to determine the most appropriate method suitable for routine large-scale screenings of all salmonids bred in Norwegian aquaculture systems, the Panel on Animal Health and Welfare of the Norwegian Scientific Committee for Food Safety evaluated all available marking techniques in 2016. These comprised (i) externally attached visible tags, (ii) visible internal tags, (iii) chemical marking, (iv) remotely detectable internal tags, (v) freeze branding, and (vi) fin clipping. The clipping of fins, especially of the adipose fin, was found to be the most applied and was evaluated as the only persistent and cost-efficient technique available. Unlike other fin structures [7], the adipose fin does not regrow when clipped completely [8,9,10,11]. In addition, fin clipping compromises the welfare of the fish [12]. Nonetheless, in European countries, such as Sweden, Estonia, and Latvia, all hatchery-reared salmon are mandatorily marked by adipose-fin clipping to facilitate the differentiation of farmed fish from natural stocks [13]. Adipose-fin clipping of Pacific salmon species is performed on a much larger scale. In the State of Washington (US) alone, more than 200 million juvenile salmonids are adipose fin-clipped every year [14]. Dozens of recapture studies reveal inconclusive influences on the growth and survival of fin-clipped animals [8,9,10,11,15,16,17,18,19,20,21]. Noteworthy in the context of fish welfare is that the resection of the adipose fin significantly reduces the swimming efficiency of O. mykiss juveniles in a flowing current [22]. Subsequent studies proved the innervation of the adipose fin in brown trout Salmo trutta [23] and a mechanoreceptive function of the adipose fin in catfish Corydoras aeneus [24]. These studies underscore that the adipose fin is not a useless body appendage, as originally claimed [25], but a mechanosensor contributing to optimal swimming performance [26].
Fin-clipping not only removes a supposedly useful organ. It can be assumed that the process itself causes pain. Nowadays, it is indisputable that fish are sentient beings [27,28,29,30], at the latest since damage- and pain-signaling nociceptors have been discovered in O. mykiss [27,29,30,31].
Somatosensory perception involves the activation of primary sensory neurons, whose somas reside within the dorsal root ganglia (DRG) or cranial sensory ganglia in the head region of the lateral line system [32,33,34] (Figure 1). The DRG neurons are pseudo-unipolar [33]. The axon has two branches, one penetrating the spinal cord to synapse with central nerve-system (CNS) neurons, and the other forms free peripheral endings or associates with peripheral targets. They respond to a wide range of stimuli comprising noxious mechanical or thermal stimuli as well as different kinds of touch [33,35]. Previous studies on higher vertebrates based on single-cell RNA-seq [35,36,37,38,39,40,41,42,43,44,45,46,47] and immunohistology [48,49,50,51,52,53,54] have identified particular sets of genes that indicate either specific sections and/or specific functions of the neuron and glial cells. The discovery of local mRNA translation within the axon outside the neuronal soma (reviewed in [55]) allows further analysis of the quality and functions of the nerves. All relevant genes selected in this study were shown to be present within the axon of sensory neurons (supplementary materials of [41]).
In order to evaluate the influence of the adipose-fin resection based on measurable and thus objective criteria, we profiled the expression of a panel of 35 genes in the adipose fins (AF) of O. mykiss and C. maraena. The obtained qPCR data were compared against the expression in a range of further tissues, including dorsal and pectoral fin, brain, skin, muscle, head kidney (HK), and liver.

2. Materials and Methods

2.1. Fish and Sampling

Juvenile O. mykiss of the German selection strain BORN at the age of 15 months (n = 7, 26.24 ± 0.78 cm, 302.71 ± 42.78 g) were selected for this analysis, as these salmonids are naturally adapted to flow regime. Fish were kept in a flow-through aquaculture system of the State Research Centre for Agriculture and Fisheries (LFA-MV). Additionally, we chose C. maraena (n = 3, 17.5 ± 1.08 cm, 64.37 ± 10.88 g) as a second salmonid species for our investigations, also kept in recirculating aquaculture systems from the LFA-MV. After stunning and killing fish by electrical flow, brain, muscle, skin, HK, and liver were sampled. In addition, we resected AF, dorsal fin, (DF), and pectoral fin (PF) as entire target tissues without removing the skin. Samples were immediately transferred to liquid nitrogen and stored at −80 °C until further processing.
The experimental protocol was approved by the Committee on the Ethics of Animal Experiments of Mecklenburg-Western Pomerania (Landesamt für Gesundheit und Soziales LAGuS; approval ID: 7221.3-1-012/19).

2.2. Gene Selection and Primer Design

We selected 35 genes, which have been described as selectively expressed by either nerve cells, glial cells, or receptor corpuscles. Unlike mammals, the common ancestor of the extant salmonid species underwent an additional teleost- and an additional salmonid-specific round of whole-genome duplication (WGD) [1,56]. These two events multiplied the number of particular genes in, for instance, O. mykiss and C. maraena. The WGD-derived paralogous genes are known as ohnologs [56], but their individual functions are largely unknown yet and it is to be expected that they are expressed to varying degrees. Our designed primer pairs detect either multiple paralogs/ohnologs or specifically a particular paralog/ohnolog. These details are listed together with the accession numbers and putative functions of the 35 target genes in Appendix A, Table A1. BLAST searches were performed using the NCBI server to identify possible gene duplicates and transcript variants in salmonids. All identified sequences were aligned using the Clustal Omega Multiple Alignment tool. Gene-specific oligonucleotides were designed applying Pyrosequencing Assay Design software v.1.0.6 (Biotage). The same primer pairs were used for the quantification of cDNA samples from O. mykiss and C. maraena.

2.3. RNA Preparation and cDNA Synthesis

The tissues were homogenized and RNA was isolated using Trizol (Life Technologies–Thermo Fisher Scientific, Karlsruhe, Germany), followed by a purification with the RNeasy Mini Kit (Qiagen, Hilden, Germany) with 15 min in-column DNase treatment. Spectrophotometry (NanoDrop One, Thermo Fisher Scientific, Karlsruhe, Germany) and gel electrophoresis were used to evaluate the quality and quantity of the isolated RNA. SuperScript II Reverse Transcriptase Kit (Thermo Fisher Scientific, Karlsruhe, Germany) was used to generate cDNA according to the manufacturer’s instructions.

2.4. Gene-Expression Profiling via qPCR

Quantitative real-time PCR (qPCR) was carried out on the LightCycler 96 system (Roche, Basel, Switzerland) to detect and quantify specific transcript amounts. The LightCycler protocol used was optimized for a 12-µl reaction volume. A ready-to-use SensiFAST SYBR No-ROX Mix (Bioline, Luckenwalde, Germany) was mixed with the cDNA aliquots and applied to Light Cycler 480 Multiwell 96 plates (Roche). The qPCR program included an initial denaturation (95 °C, 5 min.), followed by 40 cycles of denaturation (95 °C, 5 min.), annealing (60 °C, 15 s) and elongation (72 °C, 15 s) steps and the fluorescence measurement (72 °C, 10 s). All melting curves were inspected to validate the absence of unspecific amplicons. In addition, PCR products were visualized on agarose gels to assess product size and quality. Individual copy numbers were calculated based on external gene-specific standard curves (107–103 copies per 5 μL). To control for variations in isolation, reverse-transcription yield, and amplification efficiency [57], the obtained copy numbers were then normalized with a factor based on the geometric mean of the three reference genes EEF1A1, RPS5 and 18S (O. mykiss) and RPL9, RPL32, and EEF1A1b (C. maraena), respectively [58,59,60].
Due to the lack of sequence information regarding transcript variants of C. maraena, the amplicons of the C. maraena genes were sequenced. Sequencing was performed with qPCR primers using the ABI BigDye Terminator v3.1 Cycle Sequencing Kit and ABIPrism DNA sequencer (Applied Biosystems, Waltham, MA, USA), following the modified Sanger method [61].

2.5. Data Analysis

All data were evaluated for statistical significance using IBM SPSS Statistics 25. Global analysis of variance or Kruskal–Wallis H-Test was used with subsequent post-hoc tests. In all tests, a p-value of ≤ 0.05 indicated significance. Standard error of the mean (SEM) was calculated as described by [62].

3. Results

Sequences from 37 genes (including orthologue variants) were identified for O. mykiss and C. maraena, and expression profiling was performed in eight selected (strongly and weakly innervated) tissues. The gene panel was divided into two sets. Set 1 contained genes that indicate the presence of nervous cells, particularly those that are expressed exclusively in the neuronal axon, dendrites, or nucleus. Set 2 contained genes that indicate the presence of specific receptor structures. In general, expression of all analyzed marker genes was detectable in the adipose fin, often exceeding the expression levels of other nerve-traversed tissues. The presentation in this section is limited to those genes that have been identified as informative markers in previous studies and that showed significant differences in expression between tissues in the present study. (Data on other genes are given in Figure 4a and Appendix A Figure A1).

3.1. The Adipose Fin Showed High Levels of Neuron Marker Expression

The neuron-marker genes NEFL, PRPH, PVALB7, NGFR, GFAP, MPB, MPZ (Figure 2), and PMP22, S100B, NCAM1, SOX10 (Figure A1) were detectable at high levels (between 1 × 103 and 4 × 106 transcripts per 1 µg RNA) in the three fin types (AF, DF, and PF) investigated in the rainbow trout and maraena whitefish (Figure A2). In most cases, the expression represented only a fraction of that detected in brain samples. On the other hand, the expression levels of all above-mentioned neuron marker genes (except for PVALB7 in the fins) significantly surpassed the expression in the liver by >4.5-fold (PRPH) to >210.3-fold (NCAM1) and in the HK by >1.2-fold (NCAM1) to >37.2-fold (MBP). Particularly, the genes coding for neurofilament light polypeptide (NEFL) and neurofilament 4 (PRPH) (markers for small axons) showed significantly higher mRNA abundances in AF compared with skin (18.4 and 4.4-fold higher), muscle (6.4- and 1.3-fold higher), liver (41.2- and 2.9-fold higher) and HK (8.6- and 1.7-fold higher). Noteworthy, the gene encoding the high-affinity calcium ion-binding protein parvalbumin (PVALB7), a marker gene for large axons, was highly expressed (>1 × 105 copies/µg RNA) in skin, muscle, and brain (Figure 2).
NGFR transcripts encoding the neurotrophic receptors, which characterize types of neurons and neuron-associated glial cells, were detected at high levels (>1 × 105 copies/µg RNA) in brain, skin, muscle, and the three fin types, while it was virtually absent in liver and HK (Figure 2). Moreover, the NGFR copy number was >6.2-fold higher in AF compared with the copy number in skin, liver, and HK and even exceeded the values in brain samples. The glial-cell marker genes GFAP, MBP, MPZ (Figure 2), PMP22, S100B, NCAM1, and SOX10 (Figure A1a) were highly expressed (from >2 × 104 to >5.7 × 106 copies/µg RNA) in the brain, as expected. Particularly, the gene encoding the glial fibrillary acidic protein (GFAP) was strongly expressed in the brain but was also detectable in AF and DF in substantial levels. The genes coding for the myelin-forming MBP, MPZ (Figure 2), and PMP22 (Figure A1a) were strongly expressed in the skin and to a lesser but still remarkable extent in the fins. The general neuron and glial-cell marker genes S100B, NCAM1, and SOX10 (Figure 4a, Figure A1a) were strongly expressed in brain, skin, muscle, and the three fins investigated, but merely detectable in the liver.

3.2. Genes Coding for Mechanoreceptor Proteins were Expressed in the Adipose Fins

The receptor marker genes TRPC1, ASIC1, -2 and -4, KCNK2 and -4 and PIEZO2 showed distinct expression patterns in the investigated tissues (Figure 3 and Figure 4b). TRPC1 is a mechanoreceptive channel protein, whose mRNA level was extremely high in brain (~850,000 copies/µg RNA), followed by AF (~10,000 copies/µg RNA) and muscle (~8000 copies/µg RNA) (Figure 3). The genes coding for the mechanoreceptive potassium channel protein KCNK2, -4 and -10 were most strongly expressed in the brain (>2500 copies/µg RNA). Among the KCNK genes, KCNK2 revealed the highest transcript abundance (with up to ~380,000 copies/µg RNA) in brain, AF (~33,000 copies/µg RNA), PF (~20,000 copies/µg RNA), and muscle (~13,000 copies/µg RNA) (Figure 3). In the same way, ASIC transcripts were found in high amounts in the brain (>135,000 copies/µg RNA). In the remaining tissues, high levels of ASIC2 were mainly present in AF (~14,000 copies/µg RNA), DF (~8000 copies/µg RNA), skin (~11,000 copies/µg RNA), muscle (~7000 copies/µg RNA), and HK (~18,000 copies/µg RNA) (Figure 3), while ASIC4 levels were high in fins, muscle, and HK (Figure 4b and Figure A1b).
PIEZO2 was analyzed with three transcript variant-specific primer pairs. The primer pairs 1 and 4 are located on an alternatively spliced PIEZO2 variant, which is specific to neurons in mammals [63]. Primer pair 3 is specific for two PIEZO2 transcript variants including one that has not been exclusively described for neurons in mammals [63]. Transcript variant 1 was strongly expressed in AF and brain (~9200 to ~12,000 copies/µg RNA) (Figure 3). Transcript variant 4 was detectable in the AF at a level of~2000 copies/µg RNA, and to a lesser extent in the other examined tissues (>1000 copies/µg RNA in PF, skin, and muscle; <100 copies/µg RNA in DF, liver, HK, and brain) (Figure A1b). The transcript variant 3 was strongly expressed (>35,000 copies/µg RNA) in the PF, DF, brain, and, to a significantly lesser extent (~6000 copies/µg RNA), in the AF (Figure A1b).

3.3. Comparison of Gene Expression between Salmonid Species

In addition to the expression analysis of neuron- and glial-cell marker genes in O. mykiss, the expression of a subset of these genes was profiled in C. maraena. Here, a generally lower copy number level than in O. mykiss was found (Figure A2). TRPC1 showed a congruent expression pattern in C. maraena and O. mykiss, but in the latter species, it was higher expressed by a factor of 10. The general neuron-marker genes NEFL and NGFR showed almost similar expression patterns between the tissues of both species, but the expression levels are higher in the adipose fin of O. mykiss by the factor 42.6 and 6.3, respectively, in comparison to C. maraena. Interestingly, the PIEZO2 primer pair 1 generated considerably higher levels in C. maraena. Moreover, this transcript variant was more strongly expressed in C. maraena in the dorsal fin than in the adipose fin, whereas the opposite was observed in O. mykiss.

4. Discussion

4.1. Gene-Expression Profiling Indicates the Innervation of the Salmonid Adipose Fin

We established qPCR assays for 20 genes specific for neurons and glial cells (cf. Figure 1 and Figure 4a). The obtained qPCR data suggest the presence of nerve fibers in the adipose fin. This is indicated by specific gene-expression patterns of glial cells that are generally absent in tissues without direct association to neurons [51]. The transcripts coding for ten mechanoreceptors (cf. Figure 1 and Figure 4b) have been selected to cover a wide range of receptors known from vertebrates. The AF showed the most prominent expression of mechanoreceptors compared with the innervated tissues brain, skin, and muscle, all of which have well-defined mechanoreceptive potentials.
NEFL and PRPH are the most widely used marker genes for small axons [45,64]. The reception spectrum of fibers expressing these markers covers sensations from nociception to mechanoreception [35,65]. NEFL and PRPH transcripts were highly abundant in all three fin types analyzed. On the other hand, they were expressed only at low levels in brain, skin, and muscle, suggesting that other kinds of neurons are present there. PVALB7 is a marker for very large, strongly myelinated neurons [66,67] and was outstandingly high-expressed in brain and skin, but showed low expression values in fins. This might indicate that large nerve trunks do not innervate the fins.
GFAP is a marker for astrocytes in the CNS and Schwann cells in the PNS [68,69,70,71]. GFAP was most abundantly expressed in the brain and in AF. This is in line with findings from Buckland-Nicks and colleagues [23], who identified plenty of GFAP-positive cells within the AF using antibody staining. The association of GFAP-positive cells, nerve cells, and collagen was described by Buckland-Nicks [23] as common for receptor structures.
NGFR and SOX10 are highly specific marker genes of innervated tissues [37,51,65,72,73]. Both were unanimously and significantly lower transcribed in the liver and HK compared with brain and fins. The NGFR gene was even more highly expressed in the AF than in the DF or even the brain, indicating the presence of nerve structures [51,65,72,73,74].
PIEZO2 is known as key mechanotransducer, particularly in sensory afferents [39]. Orthologs in mammals and fish show a high degree of conservation of the nucleotide (nt) sequences and exon.
Borders (Figure A3). Accordingly, we found abundant PIEZO2 copy numbers in all fins, with varying copy numbers between the different salmonid-specific transcript variants. ASIC2, TPRC1, and KCNK2 build up channel proteins with mechanoreceptive function. ASIC2 mainly occurs in mechanoreceptive afferents. TPRC1 is responsible for mechanoreception in a tactile and contact-related manner [46]. KCNK2 is described as being physiologically important for tuning the activation of mechanoreceptive DRG neurons [75]. These three genes were expressed in the adipose fin to a much greater extent compared to all other innervated tissues except the brain.

4.2. The Expression of Neuron- and Glial-Cell Markers Is Tissue-Specific in Salmonids

We recorded tissue-specific expression patterns for most of the investigated genes, which are putatively involved in the proprioceptive machinery in the muscle.
The muscle tissue of rainbow trout expressed relatively high levels of ASIC1, TRPC1, KCNK10, and CACNA1H. Additionally, the copy numbers of all ASIC and PIEZO2 variants were detected at substantially high levels. Moreover, the copy numbers of SLC1A2, a glutamate transporter, and TPH2, the rate-limiting enzyme in the serotonin synthesis [76], were at high concentrations. Glutamate has several well-known and proposed functions in the muscle tissue. On the one hand, it acts as neurotransmitter within the muscle spindles [77]. On the other hand, it might be metabolized in the muscle, and SLC1A2 is necessary for its transport [78]. TPH2 is vital for efferent γ-motor neurons using serotonin in the sensory feedback of muscle spindles [79]. ASICs are involved in mammalian muscle spindle mechanotransduction [80,81], and PIEZO2 is considered as the principle mechanotransducer in proprioception [67]. Taken together, these genes indicate the presence of mechanoreceptive muscle spindles. Confirmatory, markers for nerves and glial cells, in particular, PRPH, NGFR, GFAP, MBP, MPZ, and PMP22, were also expressed in substantial levels in the muscle of rainbow trout. Furthermore, the strong expression of NCAM1 and SOX10 in the muscle indicates a higher density of glial cells, which are necessary for large nerve fibers. PVALB7, which is required in innervating muscle spindles with large neurons [67], was present in the muscle in similar high copy numbers as in brain.
The skin tissue of the rainbow trout shows a different expression pattern compared to all other tissues and appears to be interspersed with large nerve strands. This is consistent with the knowledge about the nerve supply of the skin of higher vertebrates [33,34,35,44]. The cutaneous low-threshold mechanoreceptors (LTMRs), responsible for touch sensitivity in vertebrates, possess large and highly myelinated neurons that require correspondingly high amounts of glial cells. In the skin of mammals, particularly high proportions of glial-cell-specific genes MPZ, MBP, PMP22, and S100B, as well as the neuron marker PVALB7, are expressed. This agrees with the results of this study on rainbow trout. However, only few copies were detected for the mechanoreceptive channel proteins (necessary for LTMRs), except for TPRC1, KCNK2, ASIC1, and ASIC2, and the modulator CACNA1H. We note that mechanoreception in the skin requires several other receptor proteins that have not been included in the present study.
In HK tissue, many specific nerve markers, such as TUBB3, STMN2, MAP2, and SULT4A1, revealed particularly high expression levels. The teleost HK is a lympho-myeloid compartment containing immune and endocrine cells, which secrete cortisol, thyroid hormones, and catecholamines [82], such as dopamine. Serotonin is known to stimulate the secretion of cortisol in fish [83]. In this context, we refer to two important non-immune cells with different origin, the chromaffin cells, and the interrenal cells [84]. The chromaffin cells are descendants of neural crest cells, which share many functions and secretion patterns with peripheral neurons and glial cells [85]. Above all, ASICs and PIEZO1 were strongly expressed in the HK. Both gene products are known to be involved in the fluid balance of teleost cells [86]. Of note, PIEZO1 is not associated with nerve cells and was considered rather as a reference gene in this study. In addition, the genes TH, TPH2, and SCL17A7, coding for enzymes involved in the serotonin and dopamine synthesis and the transport of glutamate, respectively, were strongly expressed in HK. The cell adhesion molecule NCAM1 is responsible for maintaining glial-neuronal connections [87] and has vital functions in natural killer cells and dendritic cells [88]. Both immune-cell populations are abundantly present in the HK since this organ is the main hematopoietic organ in fish [84]. TUBB3, a microtubule-forming gene, was included in this study as another reference gene, since its transcripts are not transported to the axons [41]. This supports our observation that the HK has by far the highest concentration of TUBB3 transcripts compared with the more innervated tissues.
In the liver, there is virtually no expression of any receptor channel protein. Only PIEZO1 was detectable at higher levels. Besides, SLC17A8 encoding a glutamate transporter was highly expressed. Glutamate transporters allow the uptake of glutamine and glutamate into the liver cells, where glutamate is involved in amino-acid metabolizing pathways [89].
The genes NTRK2, NTRK3, and GFRa2 encode neurotrophic receptors and were used in this study to distinguish between the different nerve types, as previously done in studies on mammalian models [32,33,43,45,63,67]. Neurotrophins control the differentiation and survival of nerve cells, whereby different classes of neurons depend on different neurotrophins [90]. However, the present study revealed remarkably high levels of neurotrophin-encoding transcripts in the liver and, therefore, neurotrophins might have a cross-tissue function.

4.3. Mechanosensation Is a Characteristic of the Salmonid Adipose Fin

The overall expression profile of the adipose fin (Figure 5) highly suggests the presence of nerve endings including mechanoreceptive channel proteins. PRPH, NEFL, and NGFR indicate the presence of small neurons with unmyelinated or slightly myelinated axons. This assumption is supported by the presence of the myelin-forming genes MBP, MPZ and PMP22 in the adipose fin (compared to skin and muscle tissue, for instance), although at low levels. The suggested afferent nerve endings—defined as free nerve endings, C-fibres, C-LTMRs, and Aδ-fibers—may be coupled to collagen fibers via GFAP-positive glial cells [23,91]. These are able to sense mechanical stimuli through movements of the fin structure. TRPC1, PIEZO2, and KCNKs were only recently described as markers for C-LTMRs [65]. The expression profiles of the fins of rainbow trout indicate the presence of smaller mechanoreceptive C-fibres. Besides the mechanoreceptive function, it seems moreover likely that pain signals can be perceived in the adipose fin since many smaller nerve cells are known to be nociceptors. These were, however, not included in our gene panel.

5. Conclusions

The present study suggests that the adipose fin is innervated by a high amount of small nerve fibers with, most probably, mechanoreceptive potential. In the adipose fin of rainbow trout and maraena whitefish, the entire repertoire of neurons, glial cells, and receptor proteins seems to be present on the RNA level. This supports a previous hypothesis about the adipose fin as a flow sensor [22,23], and thus its significance for the animal’s locomotion in water currents. With regard to the welfare of fish, our data accelerate the discussion about the use of adipose-fin clipping for marking purposes. On the one hand, the adipose fin is a criterion for the choice of suitable sexual partners [94] and, on the other hand, contributes to the swimming efficiency [26]. Thus, the resection of the adipose fin tissue seems to be a less suitable method, particularly from an economic point of view regarding sea ranching and large-scale aquaculture in the future.

Author Contributions

Conceptualization, T.G., R.K.; Supervision, T.G., A.R.; Experimental procedures, R.K., J.M.R., R.M.B., A.R.; Data analysis, R.K.; Visualization, R.K.; Manuscript preparation and editing, R.K., A.R., T.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by an inter-institutional PhD project of the FBN. The publication of this article was funded by the Open-Access Fund of the FBN.

Acknowledgments

We would like to acknowledge the LFA-MV Institute for Fisheries (Born, Germany) for breeding and providing the fish. F.S., N.S., B.S., I.H. and L.F. (FBN, Germany) are greatly acknowledged for helpful discussions and their excellent technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. Primer assays used in the present study.
Table A1. Primer assays used in the present study.
(A)(B)(C)(D)(E)(F)(G)
Gene SymbolLocalizationBasic FunctionAccession Code of Selected Ortholog of (A) in O. mykiss (Incl. Chromosome no.)Accession Code of Paralogs of (D) in O. mykiss (Chromosome no.; % CDS Divergence to [D])Sense and Antisense Primer Sequence (5’-3’) Derived from (D) Prediction of Specificity of Primers (F) for Selected Ortholog (D)
Neuron marker
NEFLAxonNeurofilamentXM_021605918 (6)XM_021621429 (11; 91.4%) XM_021602316 (5; 71.1%) XM_021590833 (29; 70.6%)CTTACAGGAAGCTGCTTGAAGG, GATGAGCTGTACATGCGTAGGTBinding to XM_021621429 (no mismatch), but not to XM_021602316, XM_021590833 (antisense: 6 and 7 mismatches)
NEFHMyelinated axonsNeurofilamentXM_021621725 (11)XM_021606185 (6; 91.2%)GTGAGTCACTAACACACTGCATA, TGTTTGTCTCCTGCTCTGCTCTNot binding to XM_021606185 (sense: 6 mismatches)
PRPHUnmyelinated axonsNeurofilamentXM_021610098 (7)XM_021569035 (17; 92.2%)ACGTGCAGGTGAGTGTCCAGA, AGGTCAGCAAACTTGGACTTGTABinding to both paralogs (sense: 2 mismatches)
TUBB3AxonMicrotubule assemblyXM_021607465 (6)XM_021586327 (26; 98.8%) XM_021580863 (23; 85.0%)AGGCCTCATCCTCTAAGTACGT, CCTTGGCCCAGTTGTTACCAGBinding to XM_021586327, but not to XM_021580863 (sense: 6 mismatches)
PVALB7Myelinated axonCalcium bindingXM_021557489 (13)XM_021624534 (12; 97.4%)CGCAGCGGCTGACTCTTTTGA, GAGGCAAATCCCTTCAGTACGABinding to both paralogs (sense: 1 mismatch)
STMN2AxonMicrotubule dynamicsXM_021559849 (14)XM_021598102 (3; 84.4%) XM_021585013 (3; 84.7%) XM_021572874 (18; 96.8%)TGGCTAAAACAGCAATTGCGTAC, AGAGGCACGCTTGTTGATGGGNot binding to XM_021598102 XM_021585013, XM_021572874 (3 to 10 mismatches per primer)
MAP2Neuron dendritesMicrotubule assemblyXM_021597500 (3)XM_021579611 (22; 86.9%)CGTCAAGAAGAAAAAAGCCGTGA, ACTGTAGGTTTCCTCCTAGCACBinding to both paralogs (sense: 1 mismatch)
RBFOX3Neuronal nucleusNeuronal nucleus productionXM_021581050 (23)XM_021576584 (20; 86.7%) XM_021625440 (12; 81.2%) XM_021556260 (13; 84.3%)AGTATCGCAGGCAGAAGAGGTT, CCCAAACATTTGCCTGAGGTCTBinding to XM_021576584, but not binding to XM_021625440, XM_021556260 (sense: 9-nt gap)
Glial cell and glial cell type marker
GFAPAstrocytes and Schwann cells (SC)Cell communicationXM_021558456 (13)XM_021625581 (12; 98.9%)TGACGGAGCTGACCCAACTGA, TCTCATCTTGCAGTCTCTGTTTGBinding to both paralogs (no mismatch)
ALDH1L1Astrocytes and liver cellsEnergy supplyXM_021610613 (7)――――――GAACAGCTATCTGTGATGTGTCT, TCCATCAGGTCAGCCAGCTTAT
MBPMyelinating SC and oligo-dendrocytesMyelin formationXM_021571745 (18)XM_021594735 (?; 92.8%)ATCAGATTAGCACGTTCTTTGG, AGAGGCTGTCACGCTCAAGCTNot binding to XM_021594735 (antisense: 39-nt gap)
MPZMyelinating SC and oligo-dendrocytesMyelin formationXM_021588760 (28)XM_021614027 (8; 93.3%)ATCTACACGGGCTGGGAGCG, CCGGTGTAGTGGAAGATAGAGABinding to XM_021614027 (antisense: 3 mismatches)
PMP22Myelinating SC and oligo-dendrocytesMyelin formationXM_021576248 (20)XM_021581303 (23; 92.2%) XM_021559021 (13; 77.5%)TCTTCCAGATCCTCGCCAGTC, TGACGTAGATGAGTCCGCTGATBinding to XM_021581303 (antisense: 1 mismatch), but not to XM_021559021 (antisense: 5 mismatches)
S100BGlial cells and neuronsCalcium bindingXM_021608876 (7)XM_021571442 (18; 96.5%)ATTACAAACCACAATGACTGACCT, TGGTCCTTCACTTGCCCTGTAABinding to XM_021571442 (sense: 1 mismatch)
NCAM1Glial cells and neuronsCell contact and communicationXM_021617837 (10)XM_021623770 (12; 91.5%) XM_021588052 (27; 74.7%) XM_021582629 (24; 75.7%)AGAAGCTTTTACCGAACAGACAG, TTTGGAAGATTTTCACGTTGACAGBinding to XM_021623770 (2–3 mismatches), but not to XM_021588052, XM_021582629 (sense: ≥9-nt gap)
SOX10Glial cells and neuronsNeuron survivalXM_021567709 (17)XM_021556808 (13; 98.7%) XM_021558042 (13; 75.4%) XM_021625106 (12; 75.2%)CGCGTAAACAACGGGAACAAGA, ATTCAGGAGCCTCCACAGTTTGBinding to XM_021556808 (no mismatch), but not to XM_021558042, XM_021625106 (antisense: 5–7 mismatches)
Neuron characterization
NGFRGlial cells and neuronsNeuron assembly and survivalXM_021558479 (13)XM_021625607 (12; 98.2%) XM_021565429 (16; 80.6%)CAGTGCCTAGACAGTGAGACC, CCTCATTCAGGTAGTAGTTGTAGBinding to XM_021625607 (no mismatch), but not to XM_021565429 (sense: 38-nt gap)
NTRK2A-delta LTMRSignalling and neuron survivalXM_021605433 (6)XM_021621031 (11; 93.7%) XM_021602994 (5; 84.8%) XM_021622759 (12; 85.2%)CCTCACGAATCTAACTGTGACTA, AGCGGGTTCCCTGAAAGAATCA Binding to XM_021621031 (no mismatch), but not to XM_021602994, XM_021622759 (antisense: ≥6 mismatches)
NTRK3Proprioceptors and LTMRSignalling and neuron survivalXM_021591923 (1)XM_021568341 (2; 94.9%) XM_021593111 (?; 82.3%)CAAGAACATCACCTCAATACACAT, GGTTCTTCGATAAGTTTATGTAGCNot binding to XM_021593111
GFRa2C-LTMRSignalling and neuron survivalXM_021605433 (6)XM_021621031 (11; 93.7%) XM_021602994 (5; 84.8%) XM_021622759 (12; 85.2%)ATTATCTCAGGGATGCACACTGT, TGGCAGCGCTTACGGTTACACNot binding to XM_021621031, XM_021622759, XM_021602994 (sense: ≥ 4-nt gap)
Receptor/synapse characterization
SLC1A2Glial cells, neurons, receptorsGlutamate transportXM_021600639 (1)XM_021573109 (2; 94.2%) XM_021608174 (6; 82.2%) XM_021625950 (12; 80.4%)AACAGATCCAAACGGTTACTAAGA, TAACACGTTCATGCCACTCTTGABinding to XM_021573109 (2–3 mismatches), but not to XM_021625950 (sense: 18-nt gap) and XM_021608174 (7 mismatches)
SLC17A7Glial cells, neurons, receptorsGlutamate transportXM_021575504 (20)XM_021565125 (16; 94.4%) XM_021558924 (13; 80.2%)TACGGCAGCTTTGGGATCTTCT, AAAAGGCTCTCCAAGGCGTGTTBinding to XM_021565125 (sense: 1 mismatch), but not to XM_021558924 (sense: 12-nt gap)
SLC17A8Glial cells, neurons, receptorsGlutamate transportXM_021601245 (1)XM_021574127 (2; 93.4%)TATGGTGTATTTGGGATCATATGG, GAATTTCTCAGTGGCGCTCAATABinding to XM_021574127 (sense, antisense: 1 mismatch)
THGlial cells, neurons, receptorsDopamine synthesisXM_021564247 (2)――――――TGTTCGAGACGTTTGAAGCTAAG, GTTTTGACATCCTCTGCTATCCT
TPH2Glial cells, neurons, receptorsSerotonin synthesisXM_021576444 (2)――――――GCCCTACGCCTTTTTCAGGAG, AGGCGTGTTGAAGGAGATGATAT
SULT4A1Neuron nucleusPurposed neuro-transmitter synthesisXM_021577380 (21)XM_021564205 (15; 99.5%)CCCAGATGAGATTGGTCTGATG, TCGCCATGTAGATCACCTTGGABinding to XM_021564205 (no mismatch)
Mechanoreceptor characterization
PIEZO2Afferent neuron ending and receptorsStretch-receptor channelXM_021588681 (28) XM_021590114 (28; 90%) XM_021614324 (8; 88.0%)/
XM_021614323 (8; 87.5%)/
XM_021614322 (8; 94.8%), XM_021622313 (11; 78.3%), XM_021564358 (15; 80.2%)
GATAGTATATCCAGTGCCTACAC, CTACTGCTGCTGTCAGTCGATT, AGAGAGGTCAAAAAGGGCAACG, TCCTGGCTCTCCATGCGATAG, AACTGTGATGTAACAACGGTAAG, ACGTCCTCTGGTGGTCTGTTTTPair 1 binding to XM_021588681 and XM_021614324; pair 3 binding to XM_021614324; pair 4 binding to XM_021588681; no pair binds to XM_021590114, XM_021622313, XM_021564358 (sense: >4 mismatches or 20-nt gap)
PIEZO1Non-sensory tissuesStretch-receptor channelXM_021585995 (26)XM_021607119 (6; 97.1%)ACTGTAGTTTGTGGGAGACGCT, TCTCTTCTTGACCAGCCGGTTABinding to XM_021607119 (1–3 mismatches)
ASIC1ReceptorsMechano-receptor channelXM_021615628 (9)XM_021566621 (16; 94.3%) XM_021610711 (7; 82.15%) XM_021567553 (17; 79.0%)AGACGGATGAGACCACGTTTGA, AGGGTGGGGGCAAATATATCAG Binding to XM_021566621 (sense: 3 mismatches), but not to XM_021610711, XM_021567553 (sense, antisense: ≥5 mismatches)
ASIC2ReceptorsMechano-receptor channelXM_021558500 (13)XM_021625621 (12; 98.7%)CTGCCCTTGCCAAGTTGTCAAT, TGTTATCCGTGATGTATTTCTCAGBinding to XM_021625621 (no mismatch)
ASIC4ReceptorsMechano-receptor channelXM_021579184 (22)XM_021596998 (3; 96.5%)ATATCCAACAGGACGAGTATCTC, GGTCAGCCTTTGTTCCTGACATBinding to XM_021596998 (sense: 1 mismatch)
TRPC1ReceptorsMechano-receptor channelNM_001185053 (11)――――――TAAGCCCTCCATCGCTAAACTG, GGCATTACAGAGAGTACACTCG
KCNK2ReceptorsMechano-receptor channelXM_021600681 (4)――――――GTGACTTTGTGGCCGGTGAAAA, CCCCTACCTCCTCCTTGGTTT
KCNK4ReceptorsMechano-receptor channelXM_021583157 (25)XM_021561640 (14; 87.6%)CAGCGACCTCATAAAGAGTGTG, GTCCTGGGAGAAAGGTTACCAABinding to XM_021561640 (sense, antisense: 2–3 mismatches)
KCNK10ReceptorsMechano-receptor channelXM_021574081 (19)XM_021583031 (25; 90.5%), XM_021611349 (8; 72.7%)GTGGAGAAGATATACAGGCAAAAA, TGATAGCGTGATGATGACAAAGTANot binding to XM_021583031 (sense or antisense: ≥4 mismatches)
CACNA1HAction potential generation zoneModulation of firing patternsXM_021593500 (?)――――――CGCTAGAGTGTTGAAGCTGTTG, TCTCCTCGGAACACTCCAGTTT
Figure A1. (a). Expression levels of the remaining neuron and glial cell marker genes from Set 1 across tissues in O. mykiss. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in the brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM. (b). Expression levels of mechanoreceptor-encoding and synapse marker genes from Set 2 across tissues in O. mykiss. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM.
Figure A1. (a). Expression levels of the remaining neuron and glial cell marker genes from Set 1 across tissues in O. mykiss. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in the brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM. (b). Expression levels of mechanoreceptor-encoding and synapse marker genes from Set 2 across tissues in O. mykiss. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM.
Genes 11 00021 g0a1aGenes 11 00021 g0a1b
Figure A2. Expression levels of Set 1 and Set 2 marker genes across tissues in C. maraena. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM.
Figure A2. Expression levels of Set 1 and Set 2 marker genes across tissues in C. maraena. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM.
Genes 11 00021 g0a2
Figure A3. Part of the Clustal Omega Alignment of mouse, zebrafish Danio rerio (Hamilton, 1822), and O. mykiss PIEZO2 CDS (European Bioinformatics Institute, 2018). Shown are exons 39 through 41 with high identity across the species. Exon-exon boundaries are labeled in blue and red. Position of primer pair 1 is shown by grey underlay. Exon 40 of the murine ortholog is alternatively spliced and deleted in non-neural tissues [63]. Sequence and exon-exon borders were provided by [63]. (Accession number D. rerio XM_021468270).
Figure A3. Part of the Clustal Omega Alignment of mouse, zebrafish Danio rerio (Hamilton, 1822), and O. mykiss PIEZO2 CDS (European Bioinformatics Institute, 2018). Shown are exons 39 through 41 with high identity across the species. Exon-exon boundaries are labeled in blue and red. Position of primer pair 1 is shown by grey underlay. Exon 40 of the murine ortholog is alternatively spliced and deleted in non-neural tissues [63]. Sequence and exon-exon borders were provided by [63]. (Accession number D. rerio XM_021468270).
Genes 11 00021 g0a3

References

  1. Macqueen, D.J.; Primmer, C.R.; Houston, R.D.; Nowak, B.F.; Bernatchez, L.; Bergseth, S.; Davidson, W.S.; Gallardo-Escárate, C.; Goldammer, T.; Guiguen, Y.; et al. Functional Annotation of All Salmonid Genomes (FAASG): An international initiative supporting future salmonid research, conservation and aquaculture. BMC Genom. 2017, 18, 484. [Google Scholar] [CrossRef]
  2. Stewart, T.A.; Smith, W.L.; Coates, M.I. The origins of adipose fins: An analysis of homoplasy and the serial homology of vertebrate appendages. Proc. R. Soc. B Biol. Sci. 2014, 281, 20133120. [Google Scholar] [CrossRef] [PubMed]
  3. FAO. The State of World Fisheries and Aquaculture (SOFIA) 2014; Fisheries and Aquaculture Department: Rome, Italy, 2014. [Google Scholar]
  4. North Pacific Anadromous Fish Comission (NPAFC). ICES ICES WGBAST Report 2018. In Proceedings of the Report of the Baltic Salmon and Trout Working Group (WGBAST), Turku, Finland, 20–28 March 2018; pp. 11–20. [Google Scholar]
  5. ICES. ICES WGBAST Report 2018 Report of the Baltic Salmon and Trout Working Group (WGBAST); Ices Advisory Committee: Turku, Finland, 2018. [Google Scholar]
  6. Bourret, V.; O’Reilly, P.T.; Carr, J.W.; Berg, P.R.; Bernatchez, L. Temporal change in genetic integrity suggests loss of local adaptation in a wild Atlantic salmon (Salmo salar) population following introgression by farmed escapees. Heredity 2011, 106, 500–510. [Google Scholar] [CrossRef] [PubMed]
  7. Akimenko, M.A.; Marí-Beffa, M.; Becerra, J.; Géraudie, J. Old questions, new tools, and some answers to the mystery of fin regeneration. Dev. Dyn. 2003, 226, 190–201. [Google Scholar] [CrossRef] [PubMed]
  8. Armstrong, G.C. Mortality, rate of growth, and fin regeneration of marked and unmarked lake trout fingerlings at the provincial fish hatchery, Port Arthur, Ontario. Trans. Am. Fish. Soc. 1949, 77, 129–131. [Google Scholar] [CrossRef]
  9. Stauffer, T.M.; Hansen, M.J. Mark retention, survival, and growth of jaw-tagged and fin- clipped rainbow trout. Trans. Am. Fish. Soc. 1969, 98, 225–229. [Google Scholar] [CrossRef]
  10. Weber, D.; Wahle, R.J. Effect of Finclipping on Survival of Sockeye Salmon (Oncorhynchus nerka). J. Fish. Res. Board Can. 1969, 26, 1263–1271. [Google Scholar] [CrossRef]
  11. Johnsen, B.O.; Ugedal, O. Effects of different kinds of fin-clipping on over-winter survival and growth of fingerling brown trout, Salmo trutta L., stocked in small streams in Norway. Aquac. Res. 1988, 19, 305–311. [Google Scholar] [CrossRef]
  12. VKM. Risk Assessment of Marking and Tracing Methods with Regards to the Welfare of Farmed Salmonids. Opinion of the Panel on Animal Health and Welfare, Oslo, Norway; Norwegian Scientific Committee for Food Safety (VKM): Oslo, Norway, 2016; ISBN 9788282592574. [Google Scholar]
  13. ICES. ICES WGBAST Report 2007. In Proceedings of the Report of the Baltic Salmon and Trout Working Group ( WGBAST), Riga, Latvia, 27 March–4 April 2017; pp. 11–20. [Google Scholar]
  14. Washington Department of Fish and Wildlife (WDFW). Hatchery Fish. Mass-Marking; Washington Department of Fish and Wildlife (WDFW): Takoma Park, MD, USA, 2019. [Google Scholar]
  15. Saunders, R.L.; Allen, K.R. Effects of tagging and fin-clipping on the survival and growth of Atlantic salmon between smolt and adult stages. J. Fish. Res. Board Can. 1967, 24, 2595–2611. [Google Scholar] [CrossRef]
  16. Nicola, S.J.; Cordone, A.J. Effects of fin removal on survival and growth of rainbow trout (Salmo gairdneri) in a natural environment. Trans. Am. Fish. Soc. 1973, 102, 753–758. [Google Scholar] [CrossRef]
  17. O’Grady, M.F. The Effects of Fin-Clipping, Floy-Tagging and Fin-Damage on the Survival and Growth of Brown Trout (Salmo trutta L.) Stocked in Irish Lakes. Fish. Manag. 1984, 152, 49–58. [Google Scholar] [CrossRef]
  18. Gjerde, B.; Refstie, T. The effect of fin-clipping on growth rate, survival and sexual maturity of rainbow trout. Aquaculture 1988, 73, 383–389. [Google Scholar] [CrossRef]
  19. Hansen, L.P. Effects of Carlin tagging and fin clipping on survival of Atlantic salmon (Salmo salar L.) released as smolts. Aquaculture 1988, 70, 391–394. [Google Scholar] [CrossRef]
  20. Vander Haegen, G.E.; Blankenship, H.L.; Hoffmann, A.; Thompson, D.A. The Effects of Adipose Fin Clipping and Coded Wire Tagging on the Survival and Growth of Spring Chinook Salmon. N. Am. J. Fish. Manag. 2005, 25, 1161–1170. [Google Scholar] [CrossRef]
  21. Bumgarner, J.D.; Schuck, M.L.; Blankenship, H.L. Returns of Hatchery Steelhead with Different Fin Clips and Coded Wire Tag Lengths. N. Am. J. Fish. Manag. 2009, 29, 903–913. [Google Scholar] [CrossRef]
  22. Reimchen, T.E.; Temple, N.F. Hydrodynamic and phylogenetic aspects of the adipose fin in fishes. Can. J. Zool. 2004, 82, 910–916. [Google Scholar] [CrossRef]
  23. Buckland-Nicks, J.A. New details of the neural architecture of the salmonid adipose fin. J. Fish. Biol. 2016, 89, 1991–2003. [Google Scholar] [CrossRef]
  24. Aiello, B.R.; Stewart, T.A.; Hale, M.E. Mechanosensation in an adipose fin. Proc. R. Soc. B Biol. Sci. 2016, 283, 20152794. [Google Scholar] [CrossRef]
  25. Garstang, W. The phyletic classification of Teleostei. Proc. Leeds Philos. Lit. Soc. Sci. Sect. 1931, 2, 240–261. [Google Scholar]
  26. Temple, N.F.; Reimchen, T.E. Adipose fin condition and flow regime in catfish. Can. J. Zool. 2008, 86, 1079–1082. [Google Scholar] [CrossRef]
  27. Sneddon, L.U.; Elwood, R.W.; Adamo, S.A.; Leach, M.C. Defining and assessing animal pain. Anim. Behav. 2014, 97, 201–212. [Google Scholar] [CrossRef]
  28. Sneddon, L.U. Trigeminal somatosensory innervation of the head of a teleost fish with particular reference to nociception. Brain Res. 2003, 972, 44–52. [Google Scholar] [CrossRef]
  29. Ashley, P.J.; Sneddon, L.U.; McCrohan, C.R. Nociception in fish: Stimulus-response properties of receptors on the head of trout Oncorhynchus mykiss. Brain Res. 2007, 1166, 47–54. [Google Scholar] [CrossRef] [PubMed]
  30. Sneddon, L.U. Pain perception in fish: Indicators and endpoints. ILAR J. 2009, 50, 338–342. [Google Scholar] [CrossRef]
  31. Sneddon, L.U.; Braithwaite, V.A.; Gentle, M.J. Do fishes have nociceptors? Evidence for the evolution of a vertebrate sensory system. Proc. R. Soc. B Biol. Sci. 2003, 270, 1115–1121. [Google Scholar] [CrossRef]
  32. Li, L.; Rutlin, M.; Abraira, V.E.; Cassidy, C.; Kus, L.; Gong, S.; Jankowski, M.P.; Luo, W.; Heintz, N.; Koerber, H.R.; et al. The functional organization of cutaneous low-threshold mechanosensory neurons. Cell 2011, 147, 1615–1627. [Google Scholar] [CrossRef]
  33. Victoria, E.A.; David, D. Ginty Neuron The Sensory Neurons of Touch. Neuron 2013, 79, 1–44. [Google Scholar]
  34. François, A.; Schüetter, N.; Laffray, S.; Sanguesa, J.; Pizzoccaro, A.; Dubel, S.; Mantilleri, A.; Nargeot, J.; Noël, J.; Wood, J.N.; et al. The Low-Threshold Calcium Channel Cav3.2 Determines Low-Threshold Mechanoreceptor Function. Cell Rep. 2015, 10, 370–382. [Google Scholar] [CrossRef]
  35. Lechner, S.G. Neue Einsichten in die spinalen und peripheren Signalwege der Schmerzentstehung. e-Neuroforum 2017, 23, 173–178. [Google Scholar] [CrossRef]
  36. Brierley, S.M. Molecular basis of mechanosensitivity. Auton. Neurosci. Basic Clin. 2010, 153, 58–68. [Google Scholar] [CrossRef]
  37. Wilson, R.I.; Corey, D.P. The Force Be With You: A Mechanoreceptor Channel in Proprioception and Touch. Neuron 2010, 67, 349–351. [Google Scholar] [CrossRef] [PubMed][Green Version]
  38. Gumy, L.F.; Yeo, G.S.H.; Tung, Y.L.; Zivraj, K.H.; Willis, D.; Coppola, G.; Lam, B.Y.H.; Twiss, J.L.; Holt, C.E.; Fawcett, J.W. Transcriptome analysis of embryonic and adult sensory axons reveals changes in mRNA repertoire localization Transcriptome analysis of embryonic and adult sensory axons reveals changes in mRNA repertoire localization. RNA 2011, 17, 85–98. [Google Scholar] [CrossRef] [PubMed]
  39. Chiu, I.M.; Barrett, L.B.; Williams, E.K.; Strochlic, D.E.; Lee, S.; Weyer, A.D.; Lou, S.; Bryman, G.S.; Roberson, D.P.; Ghasemlou, N.; et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife 2014, 3, 1–32. [Google Scholar] [CrossRef] [PubMed]
  40. Le Pichon, C.E.; Chesler, A.T. The functional and anatomical dissection of somatosensory subpopulations using mouse genetics. Front. Neuroanat. 2014, 8, 1–18. [Google Scholar] [CrossRef] [PubMed]
  41. Ranade, S.S.; Syeda, R.; Patapoutian, A. Mechanically Activated Ion Channels. Neuron 2015, 87, 1162–1179. [Google Scholar] [CrossRef]
  42. Usoskin, D.; Furlan, A.; Islam, S.; Abdo, H.; Lönnerberg, P.; Lou, D.; Hjerling-Leffler, J.; Haeggström, J.; Kharchenko, O.; Kharchenko, P.V.; et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 2015, 18, 145–153. [Google Scholar] [CrossRef]
  43. Li, C.L.; Li, K.C.; Wu, D.; Chen, Y.; Luo, H.; Zhao, J.R.; Wang, S.S.; Sun, M.M.; Lu, Y.J.; Zhong, Y.Q.; et al. Somatosensory neuron types identified by high-coverage single-cell RNA-sequencing and functional heterogeneity. Cell Res. 2016, 26, 83–102. [Google Scholar] [CrossRef]
  44. Schlosser, G. A Short History of Nearly Every Sense—The Evolutionary History of Vertebrate Sensory Cell Types. Integr. Comp. Biol. 2018, 58, 301–316. [Google Scholar] [CrossRef]
  45. Zeisel, A.; Hochgerner, H.; Lönnerberg, P.; Johnsson, A.; Memic, F.; Van der Zwan, J.; Häring, M.; Braun, E.; Borm, L.E.; La Manno, G.; et al. Molecular Architecture of the Mouse Nervous System. Cell 2018, 174, 999–1014. [Google Scholar] [CrossRef]
  46. Hockley, J.R.F.; Taylor, T.S.; Callejo, G.; Wilbrey, A.L.; Gutteridge, A.; Bach, K.; Winchester, W.J.; Bulmer, D.C.; McMurray, G.; Smith, E.S.J. Single-cell RNAseq reveals seven classes of colonic sensory neuron. Gut 2018, 68, 633–644. [Google Scholar] [CrossRef]
  47. Martinac, B.; Poole, K. Mechanically activated ion channels. Int. J. Biochem. Cell Biol. 2018, 97, 104–107. [Google Scholar] [CrossRef] [PubMed]
  48. Zaccone, G. Neuron-specific enolase and serotonin in the Merkel cells of conger-eel (Conger conger) epidermis—An immunohistochemical study. Histochemistry 1986, 85, 29–34. [Google Scholar] [CrossRef] [PubMed]
  49. Reeves, S.; Helman, L.; Allison, A.; Israel, M. Molecular cloning and primary structure of human glial fibrillary acidic protein. Proc. Natl. Acad. Sci. USA 1989, 86, 5178–5182. [Google Scholar] [CrossRef] [PubMed]
  50. Genever, P.G.; Maxfield, S.J.; Kennovin, G.D.; Maltman, J.; Bowgen, C.J.; Raxworthy, M.J.; Skerry, T.M. Evidence for a novel glutamate-mediated signaling pathway in keratinocytes. J. Investig. Dermatol. 1999, 112, 337–342. [Google Scholar] [CrossRef]
  51. Reinisch, C.M.; Tschachler, E. The dimensions and characteristics of the subepidermal nerve plexus in human skin—Terminal Schwann cells constitute a substantial cell population within the superficial dermis. J. Dermatol. Sci. 2012, 65, 162–169. [Google Scholar] [CrossRef]
  52. Abbate, F.; Catania, S.; Germanà, A.; González, T.; Diaz-Esnal, B.; Germanà, G.; Vega, J.A. S-100 protein is a selective marker for sensory hair cells of the lateral line system in teleosts. Neurosci. Lett. 2002, 329, 133–136. [Google Scholar] [CrossRef]
  53. Feito, J.; García-Suárez, O.; García-Piqueras, J.; García-Mesa, Y.; Pérez-Sánchez, A.; Suazo, I.; Cabo, R.; Suárez-Quintanilla, J.; Cobo, J.; Vega, J.A. The development of human digital Meissner’s and Pacinian corpuscles. Ann. Anat. 2018, 219, 8–24. [Google Scholar] [CrossRef]
  54. García-Mesa, Y.; García-Piqueras, J.; García, B.; Feito, J.; Cabo, R.; Cobo, J.; Vega, J.A.; García-Suárez, O. Merkel cells and Meissner’s corpuscles in human digital skin display Piezo2 immunoreactivity. J. Anat. 2017, 231, 978–989. [Google Scholar] [CrossRef]
  55. Jung, H.; Yoon, B.C.; Holt, C.E. Axonal mRNA localization and local protein synthesis in nervous system assembly, maintenance and repair. Nat. Rev. Neurosci. 2012, 13, 308–324. [Google Scholar] [CrossRef]
  56. Berthelot, C.; Brunet, F.; Chalopin, D.; Juanchich, A.; Bernard, M.; Noël, B.; Bento, P.; Da Silva, C.; Labadie, K.; Alberti, A.; et al. The rainbow trout genome provides novel insights into evolution after whole-genome duplication in vertebrates. Nat. Commun. 2014, 5, 3657. [Google Scholar] [CrossRef]
  57. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Müller, R.; Nolan, T.; Pfaffl, M.; Shipley, G.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
  58. Altmann, S.; Rebl, A.; Kühn, C.; Goldammer, T. Identification and de novo sequencing of housekeeping genes appropriate for gene expression analyses in farmed maraena whitefish (Coregonus maraena) during crowding stress. Fish. Physiol. Biochem. 2015, 41, 397–412. [Google Scholar] [CrossRef] [PubMed]
  59. Rebl, A.; Köbis, J.M.; Fischer, U.; Takizawa, F.; Verleih, M.; Wimmers, K.; Goldammer, T. MARCH5 gene is duplicated in rainbow trout, but only fish-specific gene copy is up-regulated after VHSV infection. Fish. Shellfish Immunol. 2011, 31, 1041–1050. [Google Scholar] [CrossRef] [PubMed]
  60. Köbis, J.M.; Rebl, H.; Goldammer, T.; Rebl, A. Multiple gene and transcript variants encoding trout C-polysaccharide binding proteins are differentially but strongly induced after infection with Aeromonas salmonicida. Fish. Shellfish Immunol. 2017, 60, 509–519. [Google Scholar] [CrossRef] [PubMed]
  61. Sanger, F.; Coulson, A.R. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol. 1975, 94, 441–448. [Google Scholar] [CrossRef]
  62. Bookout, A.L.; Mangelsdorf, D.J. Quantitative real-time PCR protocol for analysis of nuclear receptor signaling pathways. Nucl. Recept. Signal. 2003, 1, nrs-01012. [Google Scholar] [CrossRef]
  63. Szczot, M.; Pogorzala, L.A.; Solinski, H.J.; Young, L.; Yee, P.; Le Pichon, C.E.; Chesler, A.T.; Hoon, M.A. Cell-Type-Specific Splicing of Piezo2 Regulates Mechanotransduction. Cell Rep. 2017, 21, 2760–2771. [Google Scholar] [CrossRef]
  64. Lariviere, R.C.; Julien, J.P. Functions of Intermediate Filaments in Neuronal Development and Disease. J. Neurobiol. 2004, 58, 131–148. [Google Scholar] [CrossRef]
  65. Li, C.; Wang, S.; Chen, Y.; Zhang, X. Somatosensory Neuron Typing with High-Coverage Single-Cell RNA Sequencing and Functional Analysis. Neurosci. Bull. 2018, 34, 200–207. [Google Scholar] [CrossRef]
  66. De Nooij, J.C.; Doobar, S.; Jessell, T.M. Etv1 Inactivation Reveals Proprioceptor Subclasses that Reflect the Level of NT3 Expression in Muscle Targets. Neuron 2013, 77, 1055–1068. [Google Scholar] [CrossRef]
  67. Woo, S.H.; Lukacs, V.; De Nooij, J.C.; Zaytseva, D.; Criddle, C.R.; Francisco, A.; Jessell, T.M.; Wilkinson, K.A.; Patapoutian, A. Piezo2 is the principal mechanotransduction channel for proprioception. Nat. Neurosci. 2015, 18, 1756–1762. [Google Scholar] [CrossRef] [PubMed]
  68. Zhang, Y.; Chen, K.; Sloan, S.A.; Bennett, M.L.; Scholze, A.R.; O’Keeffe, S.; Phatnani, H.P.; Guarnieri, P.; Caneda, C.; Ruderisch, N.; et al. An RNA-Sequencing Transcriptome and Splicing Database of Glia, Neurons, and Vascular Cells of the Cerebral Cortex. J. Neurosci. 2014, 34, 11929–11947. [Google Scholar] [CrossRef] [PubMed]
  69. Sun, W.; Cornwell, A.; Li, J.; Peng, S.; Osorio, M.J.; Aalling, N.; Wang, S.; Benraiss, A.; Lou, N.; Goldman, S.A.; et al. SOX9 Is an Astrocyte-Specific Nuclear Marker in the Adult Brain Outside the Neurogenic Regions. J. Neurosci. 2017, 37, 4493–4507. [Google Scholar] [CrossRef] [PubMed]
  70. Weil, M.-T.; Heibeck, S.; Töpperwien, M.; Tom Dieck, S.; Ruhwedel, T.; Salditt, T.; Rodicio, M.C.; Morgan, J.R.; Nave, K.-A.; Möbius, W.; et al. Axonal Ensheathment in the Nervous System of Lamprey: Implications for the Evolution of Myelinating Glia. J. Neurosci. 2018, 38, 6586–6596. [Google Scholar] [CrossRef] [PubMed]
  71. Jessen, K.R.; Morgan, L.; Stewart, H.J.; Mirsky, R. Three markers of adult non-myelin-forming Schwann cells, 217c(Ran-1), A5E3 and GFAP: Development and regulation by neuron-Schwann cell interactions. Development 1990, 109, 91–103. [Google Scholar] [PubMed]
  72. Bhatheja, K.; Field, J. Schwann cells: Origins and role in axonal maintenance and regeneration. Int. J. Biochem. Cell Biol. 2006, 38, 1995–1999. [Google Scholar] [CrossRef]
  73. Wewetzer, K.; Verdú, E.; Angelov, D.N.; Navarro, X. Olfactory ensheathing glia and Schwann cells: Two of a kind? Cell Tissue Res. 2002, 309, 337–345. [Google Scholar] [CrossRef]
  74. Hartmann, M. Truncated TrkB receptor-induced outgrowth of dendritic filopodia involves the p75 neurotrophin receptor. J. Cell Sci. 2004, 117, 5803–5814. [Google Scholar] [CrossRef]
  75. Brohawn, S.G.; Su, Z.; MacKinnon, R. Mechanosensitivity is mediated directly by the lipid membrane in TRAAK and TREK1 K + channels. Proc. Natl. Acad. Sci. USA 2014, 111, 3614–3619. [Google Scholar] [CrossRef]
  76. Berman, N.E.J.; Puri, V.; Chandrala, S.; Puri, S.; Macgregor, R.; Liverman, C.S.; Klein, R.M. Serotonin in trigeminal ganglia of female rodents: Relevance to menstrual migraine. Headache 2006, 46, 1230–1245. [Google Scholar] [CrossRef]
  77. Lund, J.P.; Sadeghi, S.; Athanassiadis, T.; Salas, N.C.; Auclair, F.; Thivierge, B.; Arsenault, I.; Rompré, P.; Westberg, K.G.; Kolta, A. Assessment of the potential role of muscle spindle mechanoreceptor afferents in chronic muscle pain in the rat masseter muscle. PLoS ONE 2010, 5, e11131. [Google Scholar] [CrossRef] [PubMed]
  78. Berger, U.V.; Hediger, M.A. Distribution of the glutamate transporters GLT-1 (SLC1A2) and GLAST (SLC1A3) in peripheral organs. Anat. Embryol. 2006, 211, 595–606. [Google Scholar] [CrossRef] [PubMed]
  79. Enjin, A.; Leão, K.E.; Mikulovic, S.; Le Merre, P.; Tourtellotte, W.G.; Kullander, K. Sensorimotor function is modulated by the serotonin receptor 1d, a novel marker for gamma motor neurons. Mol. Cell. Neurosci. 2012, 49, 322–332. [Google Scholar] [CrossRef] [PubMed]
  80. Chen, W.N.; Lee, C.H.; Lin, S.H.; Wong, C.W.; Sun, W.H.; Wood, J.N.; Chen, C.C. Roles of ASIC3, TRPV1, and NaV1.8 in the transition from acute to chronic pain in a mouse model of fibromyalgia. Mol. Pain 2014, 10, 1744–8069. [Google Scholar] [CrossRef]
  81. Simon, A.; Shenton, F.; Hunter, I.; Banks, R.W.; Bewick, G.S. Amiloride-sensitive channels are a major contributor to mechanotransduction in mammalian muscle spindles. J. Physiol. 2010, 588, 171–185. [Google Scholar] [CrossRef]
  82. Geven, E.J.W.; Klaren, P.H.M. The teleost head kidney: Integrating thyroid and immune signalling. Dev. Comp. Immunol. 2017, 66, 73–83. [Google Scholar] [CrossRef]
  83. Lim, J.E.; Porteus, C.S.; Bernier, N.J. Serotonin directly stimulates cortisol secretion from the interrenals in goldfish. Gen. Comp. Endocrinol. 2013, 588, 171–185. [Google Scholar] [CrossRef]
  84. Abdel-Aziz, E.S.H.; Ali, T.E.S.; Abdu, S.B.S.; Fouad, H.F. Chromaffin cells and interrenal tissue in the head kidney of the grouper, Epinephilus tauvina (Teleostei, Serranidae): A morphological (optical and ultrastructural) study. J. Appl. Ichthyol. 2010, 26, 522–527. [Google Scholar] [CrossRef]
  85. Schreck, C.B.; Tort, L.; Farrell, A.P.; Brauner, C.B. Biology of Stress in Fish. In Biology of Stress in Fish; Academic Press: London, UK, 2016; ISBN 9780128027288. [Google Scholar]
  86. Dymowska, A.K.; Boyle, D.; Schultz, A.G.; Goss, G.G. The role of acid-sensing ion channels in epithelial Na+ uptake in adult zebrafish (Danio rerio). J. Exp. Biol. 2015, 218, 1244–1251. [Google Scholar] [CrossRef]
  87. Maness, P.F.; Schachner, M. Neural recognition molecules of the immunoglobulin superfamily: Signaling transducers of axon guidance and neuronal migration. Nat. Neurosci. 2007, 10, 19–26. [Google Scholar] [CrossRef]
  88. Van Acker, H.H.; Capsomidis, A.; Smits, E.L.; Van Tendeloo, V.F. CD56 in the immune system: More than a marker for cytotoxicity? Front. Immunol. 2017, 8, 892. [Google Scholar] [CrossRef] [PubMed]
  89. Ferrara, C.T.; Wang, P.; Neto, E.C.; Stevens, R.D.; Bain, J.R.; Wenner, B.R.; Ilkayeva, O.R.; Keller, M.P.; Blasiole, D.A.; Kendziorski, C.; et al. Genetic networks of liver metabolism revealed by integration of metabolic and transcriptional profiling. PLoS Genet. 2008, 4, e1000034. [Google Scholar] [CrossRef]
  90. Yuan, J.; Yankner, B.A. Apoptosis in the nervous system. Nature 2000, 407, 802–809. [Google Scholar] [CrossRef] [PubMed]
  91. Djouhri, L.; Lawson, S.N. Aβ-fiber nociceptive primary afferent neurons: A review of incidence and properties in relation to other afferent A-fiber neurons in mammals. Brain Res. Rev. 2004, 46, 131–145. [Google Scholar] [CrossRef] [PubMed]
  92. Abbate, F.; Madrigrano, M.; Scopitteri, T.; Levanti, M.; Cobo, J.L.; Germanà, A.; Vega, J.A.; Laurà, R. Acid-sensing ion channel immunoreactivities in the cephalic neuromasts of adult zebrafish. Ann. Anat. 2016, 207, 27–31. [Google Scholar] [CrossRef]
  93. Buckland-Nicks, J.A.; Gillis, M.; Reimchen, T.E. Neural network detected in a presumed vestigial trait: Ultrastructure of the salmonid adipose fin. Proc. R. Soc. B Biol. Sci. 2012, 279, 553–563. [Google Scholar] [CrossRef]
  94. Westley, P.A.H.; Carlson, S.M.; Quinn, T.P. Among-population variation in adipose fin size parallels the expression of other secondary sexual characteristics in sockeye salmon (Oncorhynchus nerka). Environ. Biol. Fishes 2008, 81, 439–446. [Google Scholar] [CrossRef]
Figure 1. The pseudo-unipolar dorsal root ganglion (DRG) of a vertebrate neuron cell. Dendrites and synaptic connections within the spinal cord (green) are shown on the left side. The soma (pink) lies within the DRG beside the spinal colon. The axon (yellow) connects dendrites and soma to the peripheral ending (red) where the axon ramifies into free nerve endings or builds up receptor structures like Merkel, Ruffini, Meissner, or Pacinian corpuscles. The signal transmission between the peripheral ending and receptor structures is similar to synapses, which use equal neurotransmitters. The axon can be enveloped by myelinating Schwann cells (turquoise). The panel of genes selected for the present study and the expected site of translation are listed below the illustration. The graph is based on a free illustration (Wikipedia) by Mariana Ruiz Villarreal.
Figure 1. The pseudo-unipolar dorsal root ganglion (DRG) of a vertebrate neuron cell. Dendrites and synaptic connections within the spinal cord (green) are shown on the left side. The soma (pink) lies within the DRG beside the spinal colon. The axon (yellow) connects dendrites and soma to the peripheral ending (red) where the axon ramifies into free nerve endings or builds up receptor structures like Merkel, Ruffini, Meissner, or Pacinian corpuscles. The signal transmission between the peripheral ending and receptor structures is similar to synapses, which use equal neurotransmitters. The axon can be enveloped by myelinating Schwann cells (turquoise). The panel of genes selected for the present study and the expected site of translation are listed below the illustration. The graph is based on a free illustration (Wikipedia) by Mariana Ruiz Villarreal.
Genes 11 00021 g001
Figure 2. Expression levels of selected neuron and glial cell marker genes from Set 1 across tissues. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM.
Figure 2. Expression levels of selected neuron and glial cell marker genes from Set 1 across tissues. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM.
Genes 11 00021 g002
Figure 3. Expression levels of selected mechanoreceptor marker genes from Set 2 across tissues. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM. The presentation is limited to those genes which have proven to be particularly significant and meaningful in literature research, all others are listed in Appendix A Figure A1b and Figure 4b.
Figure 3. Expression levels of selected mechanoreceptor marker genes from Set 2 across tissues. The expression levels are given as absolute copy numbers (per 1 µg RNA) normalized against three reference genes. Statistically significant deviations are indicated only between AF and the other tissues. Expression values determined in brain were excluded from the statistical evaluation. Significance levels are indicated by * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars indicate the SEM. The presentation is limited to those genes which have proven to be particularly significant and meaningful in literature research, all others are listed in Appendix A Figure A1b and Figure 4b.
Genes 11 00021 g003
Figure 4. Expression profile of (a) neuron and glial cell- and (b) mechanoreceptor-specific marker genes across all the tissues investigated in O. mykiss. Field numbers indicate the absolute copy number per 1 μg RNA. Color codes range from low abundance (dark blue) to high abundance (bright yellow) relative to the mean expression value of each particular gene. Expression in the brain was mostly excluded from the HeatMap illustration due to extremely high expression levels.
Figure 4. Expression profile of (a) neuron and glial cell- and (b) mechanoreceptor-specific marker genes across all the tissues investigated in O. mykiss. Field numbers indicate the absolute copy number per 1 μg RNA. Color codes range from low abundance (dark blue) to high abundance (bright yellow) relative to the mean expression value of each particular gene. Expression in the brain was mostly excluded from the HeatMap illustration due to extremely high expression levels.
Genes 11 00021 g004
Figure 5. Summary of the possible presence of somatosensory receptors in the adipose fin of rainbow trout. Listed are the genes indicating the presence of nociceptors with free nerve endings (red, orange) and with specialized receptor structures (green) and cutaneous LTRMs with receptor corpuscles (blue) as well as neuromasts (light red). Marker genes identified in the adipose fin in ample amounts are printed in black. Marker gene names are printed in white if the expression in the AF was not outstandingly high in the comparison of the tissues analyzed. The specific cell types for which the listed genes are characteristic are labeled as follows: Non-peptideric C-fibre mechano-heat receptor (non-pep.-C-MH), peptideric mechano-cold nociceptor (pep. C-MC), peptideric C-fibre mechano-heat nociceptor (pep. C-MH), A-fibre mechanonociceptor (AM), C-fiber low-threshold mechanoreceptor (C-LTMR), Aβ-fiber slowly-adapting type I and type II LTMR (SA-I LTMR and SA-II LTMR), Aβ-fibre rapidly-adapting type I and type II LTMR (RA-I LTMR and RA-II LTMR). Marker genes were extracted from literature [35,36,37,38,39,40,41,42,43,44,45,46,47,65,92,93], figure is adapted from [35].
Figure 5. Summary of the possible presence of somatosensory receptors in the adipose fin of rainbow trout. Listed are the genes indicating the presence of nociceptors with free nerve endings (red, orange) and with specialized receptor structures (green) and cutaneous LTRMs with receptor corpuscles (blue) as well as neuromasts (light red). Marker genes identified in the adipose fin in ample amounts are printed in black. Marker gene names are printed in white if the expression in the AF was not outstandingly high in the comparison of the tissues analyzed. The specific cell types for which the listed genes are characteristic are labeled as follows: Non-peptideric C-fibre mechano-heat receptor (non-pep.-C-MH), peptideric mechano-cold nociceptor (pep. C-MC), peptideric C-fibre mechano-heat nociceptor (pep. C-MH), A-fibre mechanonociceptor (AM), C-fiber low-threshold mechanoreceptor (C-LTMR), Aβ-fiber slowly-adapting type I and type II LTMR (SA-I LTMR and SA-II LTMR), Aβ-fibre rapidly-adapting type I and type II LTMR (RA-I LTMR and RA-II LTMR). Marker genes were extracted from literature [35,36,37,38,39,40,41,42,43,44,45,46,47,65,92,93], figure is adapted from [35].
Genes 11 00021 g005

Share and Cite

MDPI and ACS Style

Koll, R.; Martorell Ribera, J.; Brunner, R.M.; Rebl, A.; Goldammer, T. Gene Profiling in the Adipose Fin of Salmonid Fishes Supports Its Function as a Flow Sensor. Genes 2020, 11, 21. https://doi.org/10.3390/genes11010021

AMA Style

Koll R, Martorell Ribera J, Brunner RM, Rebl A, Goldammer T. Gene Profiling in the Adipose Fin of Salmonid Fishes Supports Its Function as a Flow Sensor. Genes. 2020; 11(1):21. https://doi.org/10.3390/genes11010021

Chicago/Turabian Style

Koll, Raphael, Joan Martorell Ribera, Ronald M. Brunner, Alexander Rebl, and Tom Goldammer. 2020. "Gene Profiling in the Adipose Fin of Salmonid Fishes Supports Its Function as a Flow Sensor" Genes 11, no. 1: 21. https://doi.org/10.3390/genes11010021

APA Style

Koll, R., Martorell Ribera, J., Brunner, R. M., Rebl, A., & Goldammer, T. (2020). Gene Profiling in the Adipose Fin of Salmonid Fishes Supports Its Function as a Flow Sensor. Genes, 11(1), 21. https://doi.org/10.3390/genes11010021

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop