Expression of Heat Shock Proteins in Thermally Challenged Pacific Abalone Haliotis discus hannai
Abstract
:1. Introduction
2. Materials and Methods
2.1. Pacific Abalone Sampling
2.2. Total RNA Sequencing and Analysis
2.3. HSP Ortholog Search
2.4. Experimental Validation with qRT-PCR
2.5. Ethics Statement
3. Results
3.1. Sequencing and Differentially Expressed Genes
3.2. HSPs
3.3. HSP Expression and Co-Expression Profiles
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Kang, H.Y.; Lee, Y.-J.; Song, W.-Y.; Kim, T.-I.; Lee, W.-C.; Kim, T.Y.; Kang, C.-K. Physiological responses of the abalone Haliotis discus hannai to daily and seasonal temperature variations. Sci. Rep. 2019, 9, 8019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mateus, A.P.; Power, D.M.; Canário, A.V.M. Chapter 8—Stress and Disease in Fish. In Fish Diseases; Jeney, G., Ed.; Academic Press: London, UK, 2017; pp. 187–220. [Google Scholar] [CrossRef]
- Morash, A.J.; Alter, K. Effects of environmental and farm stress on abalone physiology: perspectives for abalone aquaculture in the face of global climate change. Rev. Aquac. 2016, 8, 342–368. [Google Scholar] [CrossRef]
- Ding, J.; Li, L.; Wu, F.; Zhang, G. Effect of chronic temperature exposure on the immunity of abalone, Haliotis discus hannai. Aquac. Res. 2016, 47, 2861–2873. [Google Scholar] [CrossRef]
- Venter, L.; Loots, D.T.; Vosloo, A.; Jansen van Rensburg, P.; Lindeque, J.Z. Abalone growth and associated aspects: now from a metabolic perspective. Rev. Aquac. 2018, 10, 451–473. [Google Scholar] [CrossRef]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [Green Version]
- IPCC. Climate Change 2007: The Physical Science Basis; Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change; Solomon, S., Qin, D., Manning, M., Chen, Z., Marquis, M., Averyt, K.B., Tignor, M., Miller, H.L., Eds.; IPCC Secretariat: Geneva, Switzerland, 2007. [Google Scholar]
- Breitburg, D.; Levin, L.A.; Oschlies, A.; Grégoire, M.; Chavez, F.P.; Conley, D.J.; Garçon, V.; Gilbert, D.; Gutiérrez, D.; Isensee, K.; et al. Declining oxygen in the global ocean and coastal waters. Science 2018, 359, eaam7240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cisneros-Montemayor, A.M.; Pauly, D.; Weatherdon, L.V.; Ota, Y. A Global Estimate of Seafood Consumption by Coastal Indigenous Peoples. PLoS ONE 2016, 11, e0166681. [Google Scholar] [CrossRef]
- Cook, P.A. The Worldwide Abalone Industry. Mod. Econ. 2014, 5, 7. [Google Scholar] [CrossRef] [Green Version]
- Shin, G.-H.; Shin, Y.; Jung, M.; Hong, J.-M.; Lee, S.; Subramaniyam, S.; Noh, E.-S.; Shin, E.-H.; Park, E.-H.; Park, J.Y.; et al. First Draft Genome for Red Sea Bream of Family Sparidae. Front. Genet. 2018, 9, 643. [Google Scholar] [CrossRef]
- Shen, Y.; Huang, Z.; Liu, G.; Ke, C.; You, W. Hemolymph and transcriptome analysis to understand innate immune responses to hypoxia in Pacific abalone. Comp. Biochem. Physiol. Part D Genom. Proteom. 2019, 30, 102–112. [Google Scholar] [CrossRef]
- Chen, N.; Huang, Z.; Lu, C.; Shen, Y.; Luo, X.; Ke, C.; You, W. Different Transcriptomic Responses to Thermal Stress in Heat-Tolerant and Heat-Sensitive Pacific Abalones Indicated by Cardiac Performance. Front. Physiol. 2019. [Google Scholar] [CrossRef] [PubMed]
- Nam, B.-H.; Jung, M.; Subramaniyam, S.; Yoo, S.-I.; Markkandan, K.; Moon, J.-Y.; Kim, Y.-O.; Kim, D.-G.; An, C.M.; Shin, Y.; et al. Transcriptome Analysis Revealed Changes of Multiple Genes Involved in Haliotis discus hannai Innate Immunity during Vibrio parahemolyticus Infection. PLoS ONE 2016, 11, e0153474. [Google Scholar] [CrossRef] [PubMed]
- Nam, B.-H.; An, C.M.; Kim, D.-G.; Kong, H.J.; Kang, J.-H.; Moon, J.-Y.; Park, J.Y.; Kim, W.-J.; Kim, Y.-O.; Yoon, J.; et al. Genome sequence of pacific abalone (Haliotis discus hannai): The first draft genome in family Haliotidae. GigaScience 2017. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Whang, I.; Lee, J.-S.; Lee, J. Molecular characterization and expression analysis of a heat shock protein 90 gene from disk abalone (Haliotis discus). Mol. Biol. Rep. 2011, 38, 3055–3060. [Google Scholar] [CrossRef]
- Park, K.; Lee, J.S.; Kang, J.-C.; Kim, J.W.; Kwak, I.-S. Cascading effects from survival to physiological activities, and gene expression of heat shock protein 90 on the abalone Haliotis discus hannai responding to continuous thermal stress. Fish Shellfish Immunol. 2015, 42, 233–240. [Google Scholar] [CrossRef]
- Tripp-Valdez, M.A.; Harms, L.; Pörtner, H.O.; Sicard, M.T.; Lucassen, M. De novo transcriptome assembly and gene expression profile of thermally challenged green abalone (Haliotis fulgens: Gastropoda) under acute hypoxia and hypercapnia. Mar. Genom. 2019, 45, 48–56. [Google Scholar] [CrossRef]
- Jaspard, E.; Hunault, G. sHSPdb: A database for the analysis of small Heat Shock Proteins. BMC Plant Biol. 2016, 16, 135. [Google Scholar] [CrossRef] [Green Version]
- Ratheesh Kumar, R.; Nagarajan, N.S.; Arunraj, S.P.; Sinha, D.; Veedin Rajan, V.B.; Esthaki, V.K.; D’Silva, P. HSPIR: A manually annotated heat shock protein information resource. Bioinformatics 2012, 28, 2853–2855. [Google Scholar] [CrossRef] [Green Version]
- Rosenzweig, R.; Nillegoda, N.B.; Mayer, M.P.; Bukau, B. The Hsp70 chaperone network. Nat. Rev. Mol. Cell Biol. 2019. [CrossRef]
- Wan, Q.; Whang, I.; Lee, J. Molecular and functional characterization of HdHSP20: A biomarker of environmental stresses in disk abalone Haliotis discus discus. Fish Shellfish. Immunol. 2012, 33, 48–59. [Google Scholar] [CrossRef]
- Bolger, A.M.; Usadel, B.; Lohse, M. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McCarthy, D.J.; Smyth, G.K.; Robinson, M.D. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2009, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
- Steinegger, M.; Söding, J. MMseqs2 enables sensitive protein sequence searching for the analysis of massive data sets. Nat. Biotechnol. 2017, 35, 1026. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, L.; Niu, B.; Zhu, Z.; Wu, S.; Li, W. CD-HIT: Accelerated for clustering the next-generation sequencing data. Bioinformatics 2012, 28, 3150–3152. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Stoeckert, C.J.; Roos, D.S. OrthoMCL: Identification of Ortholog Groups for Eukaryotic Genomes. Genome Res. 2003, 13, 2178–2189. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.; Jung, M.; Ha, J.I.; Lee, Y.M.; Lee, S.-G.; Shin, Y.; Subramaniyam, S.; Oh, J. Transcriptional Profiles of Secondary Metabolite Biosynthesis Genes and Cytochromes in the Leaves of Four Papaver Species. Data 2018. [Google Scholar] [CrossRef] [Green Version]
- Meher, P.K.; Sahu, T.K.; Gahoi, S.; Rao, A.R. ir-HSP: Improved Recognition of Heat Shock Proteins, Their Families and Sub-types Based On g-Spaced Di-peptide Features and Support Vector Machine. Front. Genet. 2018. [Google Scholar] [CrossRef] [Green Version]
- Van Dam, S.; Võsa, U.; van der Graaf, A.; Franke, L.; de Magalhães, J.P. Gene co-expression analysis for functional classification and gene–disease predictions. Brief. Bioinform. 2017, 19, 575–592. [Google Scholar] [CrossRef]
- Fang, Z.; Sun, Y.; Zhang, X.; Wang, G.; Li, Y.; Wang, Y.; Zhang, Z. Responses of HSP70 Gene to Vibrio parahaemolyticus Infection and Thermal Stress and Its Transcriptional Regulation Analysis in Haliotis diversicolor. Molecules 2019, 24, 162. [Google Scholar] [CrossRef] [Green Version]
- Brokordt, K.B.; González, R.C.; Farías, W.J.; Winkler, F.M. Potential Response to Selection of HSP70 as a Component of Innate Immunity in the Abalone Haliotis rufescens. PLoS ONE 2015, 10, e0141959. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; He, Q.; Sun, H.; Liu, X. Acclimation-dependent expression of heat shock protein 70 in Pacific abalone (Haliotis discus hannai Ino) and its acute response to thermal exposure. Chin. J. Oceanol. Limnol. 2012, 30, 146–151. [Google Scholar] [CrossRef]
- Nam, B.-H.; Park, E.-M.; Kim, Y.-O.; Kim, D.-G.; Jee, Y.-J.; Lee, S.-J.; An, C.M. Analysis of Heat, Cold or Salinity Stress-Inducible Genes in the Pacific Abalone, Haliotis Discus Hannai, by Suppression Subtractive Hybridization. Korean J. Malacol. 2013, 29, 181–187. [Google Scholar] [CrossRef] [Green Version]
- Shiel, B.P.; Hall, N.E.; Cooke, I.R.; Robinson, N.A.; Strugnell, J.M. De Novo Characterisation of the Greenlip Abalone Transcriptome (Haliotis laevigata) with a Focus on the Heat Shock Protein 70 (HSP70) Family. Mar. Biotechnol. 2015, 17, 23–32. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Accession No. |
---|---|---|---|
CCT1 | CCAAGACTGTCGTCGTTGGA | ATCTGGTGGCCAAACTACGG | HDSC01672CG00010 |
CCT5 | CTGAAGACTTCTCTGGGCCC | GTTGTTGTGCTAGCAGGTGC | HDSC01212CG00030 |
CCT6 | GCCTCCCTGATTGCAAGAGT | AGGTGAAGATTGAGCGCACA | HDSC00247CG00020 |
ClpX | AGTCTGTCGGAGGAGATGCT | CGCGCTATCATGGAGTCCAT | HDSC00459CG00020 |
HSP40_1 | AACACGGAAACTGGCTTTGC | TGTCGAGGTCAAGGGGAGAT | HDSC02032CG00030 |
HSP40_2 | AAGTGCAAGCGACGGTGATA | GGAGGGACTGAAGAACGGTG | HDSC05440CG00010 |
HSP40_3 | GAAGGTGTCCCTGGTGAAGG | CAGGAAGAGGAAGTGCTGGG | HDSC00041CG00070 |
HSP70_1 | CCTGTTCCGTTCCACCATGA | TCAACCCTGACGAAGCTGTC | HDSC05236CG00010 |
HSP21 | CGGGTTCACATTCCTGCTCT | TTGTCACTAACGAGGACGGC | HDSC01558CG00030 |
HSP40_4 | CCCGGAAAGTTCTCAACCCA | CAAACCCCACGCTCAGTTTG | HDSC01574CG00060 |
HSP60 | GTGGTCGAGAAGGTGCTTCA | AGGCGGTCGTCACAGAAATT | HDSC14552CG00010 |
HSP70_2 | ATGAAGGCGAGAGAGCGATG | ACGACAAGGGAAGGCTAAGC | HDSC00042CG00040 |
HSP70_3 | AAAGAAGGTCCGTTGCACGA | GAGTTCGTCACGGCCTACAT | HDSC30216CG00010 |
HSP90 | TTGCAGAGAGGGTGGTTGTC | GGAGCGTCGTATCAAGGAGG | HDSC00143CG00040 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kyeong, D.; Kim, J.; Shin, Y.; Subramaniyam, S.; Kang, B.-C.; Shin, E.-H.; Park, E.H.; Noh, E.S.; Kim, Y.-O.; Park, J.Y.; et al. Expression of Heat Shock Proteins in Thermally Challenged Pacific Abalone Haliotis discus hannai. Genes 2020, 11, 22. https://doi.org/10.3390/genes11010022
Kyeong D, Kim J, Shin Y, Subramaniyam S, Kang B-C, Shin E-H, Park EH, Noh ES, Kim Y-O, Park JY, et al. Expression of Heat Shock Proteins in Thermally Challenged Pacific Abalone Haliotis discus hannai. Genes. 2020; 11(1):22. https://doi.org/10.3390/genes11010022
Chicago/Turabian StyleKyeong, Dongsoo, Juyeon Kim, Younhee Shin, Sathiyamoorthy Subramaniyam, Byeong-Chul Kang, Eun-Ha Shin, Eun Hee Park, Eun Soo Noh, Young-Ok Kim, Jung Youn Park, and et al. 2020. "Expression of Heat Shock Proteins in Thermally Challenged Pacific Abalone Haliotis discus hannai" Genes 11, no. 1: 22. https://doi.org/10.3390/genes11010022
APA StyleKyeong, D., Kim, J., Shin, Y., Subramaniyam, S., Kang, B.-C., Shin, E.-H., Park, E. H., Noh, E. S., Kim, Y.-O., Park, J. Y., & Nam, B.-H. (2020). Expression of Heat Shock Proteins in Thermally Challenged Pacific Abalone Haliotis discus hannai. Genes, 11(1), 22. https://doi.org/10.3390/genes11010022