Identification of Glyceraldehyde-3-Phosphate Dehydrogenase Gene as an Alternative Safe Harbor Locus in Pig Genome
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmids
2.2. Cell Culture and Transfection
2.3. T7EN1 Detection Assay and Sequencing
2.4. Fluorescence-Activated Cell Sorting (FACS)
2.5. Immunofluorescence Assay (IFA)
2.6. Western Blot Analysis
2.7. Off-Target Analysis of sgRNA
2.8. Cell Proliferation Assay
2.9. Quantitative RT-PCR (qPCR) and Statistical Analysis
3. Results
3.1. Generation of a Reporter System in Pig Genome
3.2. Quantification of HR-Mediated Knock-in in Various Pig Cells
3.3. Identification of the Protein Expression of GAPDH Gene
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Golovan, S.P.; Meidinger, R.G.; Ajakaiye, A.; Cottrill, M.; Wiederkehr, M.Z.; Barney, D.J.; Plante, C.; Pollard, J.W.; Fan, M.Z.; Hayes, M.A.; et al. Pigs expressing salivary phytase produce low-phosphorus manure. Nat. Biotechnol. 2001, 19, 741–745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, L.X.; Kang, J.X.; Li, R.F.; Wang, J.D.; Witt, W.T.; Yong, H.Y.; Hao, Y.H.; Wax, D.M.; Murphy, C.N.; Rieke, A.; et al. Generation of cloned transgenic pigs rich in omega-3 fatty acids. Nat. Biotechnol. 2006, 24, 435–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, Q.; Zhao, C.Z.; Lin, R.Y.; Li, G.L.; Li, C.C.; Wang, H.Y.; Xu, J.; Xie, S.S.; Yu, M.; Zhao, S.H. Production of homeobox A10 gene transgenic pigs by somatic cell nuclear transfer. J. Integr. Agric. 2019, 18, 1072–1079. [Google Scholar] [CrossRef] [Scilit]
- Yang, D.; Wang, C.E.; Zhao, B.; Li, W.; Ouyang, Z.; Liu, Z.; Yang, H.; Fan, P.; O’Neill, A.; Gu, W.; et al. Expression of Huntington’s disease protein results in apoptotic neurons in the brains of cloned transgenic pigs. Hum. Mol. Genet. 2010, 19, 3983–3994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, C.J.; Steinfeld, J.B.; Greene, E.C. Single-Stranded DNA Curtains for Studying Homologous Recombination. Methods Enzymol. 2017, 582, 193–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, L.; Kolber-Simonds, D.; Park, K.W.; Cheong, H.T.; Greenstein, J.L.; Im, G.S.; Samuel, M.; Bonk, A.; Rieke, A.; Day, B.N.; et al. Production of α-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 2002, 295, 1089–1092. [Google Scholar] [CrossRef] [Scilit]
- Dai, Y.; Vaught, T.D.; Boone, J.; Chen, S.H.; Phelps, C.J.; Ball, S.; Monahan, J.A.; Jobst, P.M.; McCreath, K.J.; Lamborn, A.E.; et al. Targeted disruption of the alpha1,3-galactosyltransferase gene in cloned pigs. Nat. Biotechnol. 2002, 20, 251–255. [Google Scholar] [CrossRef] [Scilit]
- Komor, A.C.; Kim, Y.B.; Packer, M.S.; Zuris, J.A.; Liu, D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 2016, 533, 420–424. [Google Scholar] [CrossRef] [Scilit]
- Meyer, M.; de Angelis, M.H.; Wurst, W.; Kuhn, R. Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases. Proc. Natl. Acad. Sci. USA 2010, 107, 15022–15026. [Google Scholar] [CrossRef] [Scilit]
- Mahfouz, M.M.; Li, L.X.; Shamimuzzaman, M.; Wibowo, A.; Fang, X.Y.; Zhu, J.K. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks. Proc. Natl. Acad. Sci. USA 2011, 108, 2623–2628. [Google Scholar] [CrossRef] [Scilit]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.L.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.B.; Jiang, W.Y.; Marraffini, L.A.; et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; DiCarlo, J.E.; Norville, J.E.; Church, G.M. RNA-guided human genome engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.Y.; Yang, H.; Shivalila, C.S.; Dawlaty, M.M.; Cheng, A.W.; Zhang, F.; Jaenisch, R. One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering. Cell 2013, 153, 910–918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, N.N.; Sun, C.H.; Gao, L.; Zhu, D.; Xu, X.F.; Zhu, X.J.; Xiong, J.W.; Xi, J.J. Genome editing with RNA-guided Cas9 nuclease in Zebrafish embryos. Cell Res. 2013, 23, 465–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Mashhadi, R.H.; Sorensen, C.B.; Kragh, P.M.; Christoffersen, C.; Mortensen, M.B.; Tolbod, L.P.; Thim, T.; Du, Y.T.; Li, J.; Liu, Y.; et al. Familial Hypercholesterolemia and Atherosclerosis in Cloned Minipigs Created by DNA Transposition of a Human PCSK9 Gain-of-Function Mutant. Sci. Transl. Med. 2013, 5, 166ra1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.P.; Yang, Y.; Bu, L.; Guo, X.G.; Tang, C.C.; Song, J.; Fan, N.N.; Zhao, B.T.; Ouyang, Z.; Liu, Z.M.; et al. Rosa26-targeted swine models for stable gene over-expression and Cre-mediated lineage tracing. Cell Res. 2014, 24, 501–504. [Google Scholar] [CrossRef] [Scilit]
- Ruan, J.; Li, H.; Xu, K.; Wu, T.; Wei, J.; Zhou, R.; Liu, Z.; Mu, Y.; Yang, S.; Ouyang, H.; et al. Highly efficient CRISPR/Cas9-mediated transgene knockin at the H11 locus in pigs. Sci. Rep. 2015, 5, 14253. [Google Scholar] [CrossRef] [Scilit]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [Scilit]
- Zhao, C.Z.; Zheng, X.G.; Qu, W.B.; Li, G.L.; Li, X.Y.; Miao, Y.L.; Han, X.S.; Liu, X.D.; Li, Z.H.; Ma, Y.L.; et al. CRISPR-offinder: A CRISPR guide RNA design and off-target searching tool for user-defined protospacer adjacent motif. Int. J. Biol. Sci. 2017, 13, 1470–1478. [Google Scholar] [CrossRef] [Scilit]
- Yao, J.; Huang, J.; Hai, T.; Wang, X.; Qin, G.; Zhang, H.; Wu, R.; Cao, C.; Xi, J.J.; Yuan, Z.; et al. Efficient bi-allelic gene knockout and site-specific knock-in mediated by TALENs in pigs. Sci. Rep. 2014, 4, 6926. [Google Scholar] [CrossRef] [Scilit]
- Brinkman, E.K.; Chen, T.; Amendola, M.; van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014, 42, e168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phadke, M.; Krynetskaia, N.; Mishra, A.; Krynetskiy, E. Accelerated cellular senescence phenotype of GAPDH-depleted human lung carcinoma cells. Biochem. Biophys. Res. Commun. 2011, 411, 409–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phadke, M.S.; Krynetskaia, N.F.; Mishra, A.K.; Krynetskiy, E. Glyceraldehyde 3-phosphate dehydrogenase depletion induces cell cycle arrest and resistance to antimetabolites in human carcinoma cell lines. J. Pharmacol. Exp. Ther. 2009, 331, 77–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ni, W.; Qiao, J.; Hu, S.W.; Zhao, X.X.; Regouski, M.; Yang, M.; Polejaeva, I.A.; Chen, C.F. Efficient Gene Knockout in Goats Using CRISPR/Cas9 System. PLoS ONE 2014, 9, e106718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, C.; Wang, X.M.; Shi, H.; Yan, Q.M.; Zheng, M.; Li, J.; Zhang, Q.J.; Qin, Y.M.; Zhong, Y.G.; Mi, J.D.; et al. Generation of ApoE deficient dogs via combination of embryo injection of CRISPR/Cas9 with somatic cell nuclear transfer. J. Genet. Genom. 2018, 45, 47–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Cai, Y.J.; Liao, Z.D.; Xu, Y.T.; Wang, Y.; Wang, Z.Y.; Jiang, X.Y.; Li, Y.Z.; Lu, Y.; Nie, Y.H.; et al. Cloning of a gene-edited macaque monkey by somatic cell nuclear transfer. Natl. Sci. Rev. 2019, 6, 101–108. [Google Scholar] [CrossRef] [Scilit]
- Su, D.; Wang, M.; Ye, C.; Fang, J.; Duan, Y.; Zhang, Z.; Hua, Q.; Shi, C.; Zhang, L.; Zhang, R.; et al. One-step generation of mice carrying a conditional allele together with an HA-tag insertion for the delta opioid receptor. Sci. Rep. 2017, 7, 44476. [Google Scholar] [CrossRef] [Scilit]
- Wang, K.K.; Ouyang, H.S.; Xie, Z.C.; Yao, C.G.; Guo, N.N.; Li, M.J.; Jiao, H.P.; Pang, D.X. Efficient Generation of Myostatin Mutations in Pigs Using the CRISPR/Cas9 System. Sci. Rep. 2015, 5, 16623. [Google Scholar] [CrossRef] [Scilit]
- Whitworth, K.M.; Rowland, R.R.R.; Ewen, C.L.; Trible, B.R.; Kerrigan, M.A.; Cino-Ozuna, A.G.; Samuel, M.S.; Lightner, J.E.; McLaren, D.G.; Mileham, A.J.; et al. Gene-edited pigs are protected from porcine reproductive and respiratory syndrome virus. Nat. Biotechnol. 2016, 34, 20–22. [Google Scholar] [CrossRef] [Scilit]
- Yan, S.; Tu, Z.; Liu, Z.; Fan, N.; Yang, H.; Yang, S.; Yang, W.; Zhao, Y.; Ouyang, Z.; Lai, C.; et al. A Huntingtin Knockin Pig Model Recapitulates Features of Selective Neurodegeneration in Huntington’s Disease. Cell 2018, 173, 989–1002. [Google Scholar] [CrossRef] [Scilit]
- Ercolani, L.; Florence, B.; Denaro, M.; Alexander, M. Isolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase gene. J. Biol. Chem. 1988, 263, 15335–15341. [Google Scholar] [PubMed]
- Suzuki, K.; Tsunekawa, Y.; Hernandez-Benitez, R.; Wu, J.; Zhu, J.; Kim, E.J.; Hatanaka, F.; Yamamoto, M.; Araoka, T.; Li, Z.; et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature 2016, 540, 144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakuma, T.; Nakade, S.; Sakane, Y.; Suzuki, K.T.; Yamamoto, T. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat. Protoc. 2016, 11, 118–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, X.; Wang, X.; Hu, X.D.; Liu, Z.; Liu, J.L.; Zhou, H.B.; Shen, X.W.; Wei, Y.; Huang, Z.J.; Ying, W.Q.; et al. Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017, 27, 801–814. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| # | Predicted OTS | Sequence | Indel |
|---|---|---|---|
| GAPDH-sgR | CATGGTCCACATGGCCTCCA AGG | ||
| 1 | Prediated-OFF-Target1 | CATGGTCCCCATGGCCTGCC TGG | NO |
| 2 | Prediated-OFF-Target2 | CATGATCCGCATGGCCTCCA TGG | NO |
| 3 | Prediated-OFF-Target3 | CACGGTCCACATGGCCTCCC TGG | NO |
| 4 | Prediated-OFF-Target4 | CATGGTCTCCATGGCCTCCA GGG | NO |
| 5 | Prediated-OFF-Target5 | CATGGTGAACATGTCCTCCA TGG | NO |
| 6 | Prediated-OFF-Target6 | GATGCTCCACCTGGCCTCCA GGG | NO |
| 7 | Prediated-OFF-Target7 | CAGGGTCCAGATGGTCTCCA GGG | NO |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, X.; Xiong, Y.; Zhao, C.; Xie, S.; Li, C.; Li, X.; Liu, X.; Li, K.; Zhao, S.; Ruan, J. Identification of Glyceraldehyde-3-Phosphate Dehydrogenase Gene as an Alternative Safe Harbor Locus in Pig Genome. Genes 2019, 10, 660. https://doi.org/10.3390/genes10090660
Han X, Xiong Y, Zhao C, Xie S, Li C, Li X, Liu X, Li K, Zhao S, Ruan J. Identification of Glyceraldehyde-3-Phosphate Dehydrogenase Gene as an Alternative Safe Harbor Locus in Pig Genome. Genes. 2019; 10(9):660. https://doi.org/10.3390/genes10090660
Chicago/Turabian StyleHan, Xiaosong, Youcai Xiong, Changzhi Zhao, Shengsong Xie, Changchun Li, Xinyun Li, Xiangdong Liu, Kui Li, Shuhong Zhao, and Jinxue Ruan. 2019. "Identification of Glyceraldehyde-3-Phosphate Dehydrogenase Gene as an Alternative Safe Harbor Locus in Pig Genome" Genes 10, no. 9: 660. https://doi.org/10.3390/genes10090660
APA StyleHan, X., Xiong, Y., Zhao, C., Xie, S., Li, C., Li, X., Liu, X., Li, K., Zhao, S., & Ruan, J. (2019). Identification of Glyceraldehyde-3-Phosphate Dehydrogenase Gene as an Alternative Safe Harbor Locus in Pig Genome. Genes, 10(9), 660. https://doi.org/10.3390/genes10090660

