MicroRNA-1258 Inhibits the Proliferation and Migration of Human Colorectal Cancer Cells through Suppressing CKS1B Expression
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Gene Expression Analysis
2.3. Protein Expression
2.4. Transfection of miR-1258 Mimic, miR-1258 Inhibitor, Stable miR-1258 Expression Vector and CKS1B siRNA
2.5. Cell Proliferation and Migration Assays
2.6. Luciferase Reporter Assay
2.7. Xenograft Mouse Model
2.8. Statistical Analysis
3. Results
3.1. miR-1258 Negatively Regulates CKS1B Expression, Which Is Highly Upregulated in CRC Tumor Tissues
3.2. CKS1B Is Directly Regulated by miR-1258
3.3. miR-1258 Inhibited Cell Proliferation, Motility and Tumorigenicity
3.4. CKS1B Knockdown Suppressed CRC Cell Proliferation and Migration
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [PubMed]
- Luebeck, E.G.; Moolgavkar, S.H. Multistage carcinogenesis and the incidence of colorectal cancer. Proc. Natl. Acad. Sci. USA 2002, 99, 15095–15100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hammond, W.A.; Swaika, A.; Mody, K. Pharmacologic resistance in colorectal cancer: A review. Ther. Adv. Med. Oncol. 2016, 8, 57–84. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.; Ma, J.; Zou, Z.; Jemal, A. Cancer statistics, 2014. CA Cancer J. Clin. 2014, 64, 9–29. [Google Scholar] [CrossRef] [Green Version]
- Hayles, J.; Beach, D.; Durkacz, B.; Nurse, P. The fission yeast cell cycle control gene cdc2: Isolation of a sequence suc1 that suppresses cdc2 mutant function. Mol. Gen. Genet. MGG 1986, 202, 291–293. [Google Scholar] [CrossRef]
- Lee, E.K.; Kim, D.G.; Kim, J.S.; Yoon, Y. Cell-cycle regulator Cks1 promotes hepatocellular carcinoma by supporting NF-kappaB-dependent expression of interleukin-8. Cancer Res. 2011, 71, 6827–6835. [Google Scholar] [CrossRef]
- Ganoth, D.; Bornstein, G.; Ko, T.K.; Larsen, B.; Tyers, M.; Pagano, M.; Hershko, A. The cell-cycle regulatory protein Cks1 is required for SCF (Skp2)-mediated ubiquitinylation of p27. Nat. Cell Biol. 2001, 3, 321–324. [Google Scholar] [CrossRef]
- Spruck, C.; Strohmaier, H.; Watson, M.; Smith, A.P.; Ryan, A.; Krek, T.W.; Reed, S.I. A CDK-independent function of mammalian Cks1: Targeting of SCF (Skp2) to the CDK inhibitor p27Kip1. Mol. Cell 2001, 7, 639–650. [Google Scholar] [CrossRef]
- Zhan, F.; Colla, S.; Wu, X.; Chen, B.; Stewart, J.P.; Kuehl, W.M.; Barlogie, B.; Shaughnessy, J.D., Jr. CKS1B, overexpressed in aggressive disease, regulates multiple myeloma growth and survival through SKP2- and p27Kip1-dependent and -independent mechanisms. Blood 2007, 109, 4995–5001. [Google Scholar] [CrossRef]
- Kang, Y.S.; Jeong, E.J.; Seok, H.J.; Kim, S.K.; Hwang, J.S.; Choi, M.L.; Jo, D.G.; Kim, Y.; Choi, J.; Lee, Y.J.; et al. Cks1 regulates human hepatocellular carcinoma cell progression through osteopontin expression. Biochem. Biophys. Res. Commun. 2019, 508, 275–281. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Doma, M.K.; Parker, R. Endonucleolytic cleavage of eukaryotic mRNAs with stalls in translation elongation. Nature 2006, 440, 561–564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Friedman, R.C.; Farh, K.K.; Burge, C.B.; Bartel, D.P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef] [PubMed]
- Lau, N.C.; Lim, L.P.; Weinstein, E.G.; Bartel, D.P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 2001, 294, 858–862. [Google Scholar] [CrossRef] [PubMed]
- Lagos-Quintana, M.; Rauhut, R.; Lendeckel, W.; Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science 2001, 294, 853–858. [Google Scholar] [CrossRef] [PubMed]
- Esquela-Kerscher, A.; Slack, F.J. Oncomirs—microRNAs with a role in cancer. Nat. Rev. Cancer 2006, 6, 259–269. [Google Scholar] [CrossRef]
- Han, T.S.; Hur, K.; Xu, G.; Choi, B.; Okugawa, Y.; Toiyama, Y.; Oshima, H.; Oshima, M.; Lee, H.J.; Kim, V.N.; et al. MicroRNA-29c mediates initiation of gastric carcinogenesis by directly targeting ITGB1. Gut 2015, 64, 203–214. [Google Scholar] [CrossRef]
- Yan, L.X.; Wu, Q.N.; Zhang, Y.; Li, Y.Y.; Liao, D.Z.; Hou, J.H.; Fu, J.; Zeng, M.S.; Yun, J.P.; Wu, Q.L.; et al. Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth. Breast Cancer Res. 2011, 13, R2. [Google Scholar] [CrossRef]
- Lujambio, A.; Calin, G.A.; Villanueva, A.; Ropero, S.; Sanchez-Cespedes, M.; Blanco, D.; Montuenga, L.M.; Rossi, S.; Nicoloso, M.S.; Faller, W.J.; et al. A microRNA DNA methylation signature for human cancer metastasis. Proc. Natl. Acad. Sci. USA 2008, 105, 13556–13561. [Google Scholar] [CrossRef] [Green Version]
- Han, T.S.; Ban, H.S.; Hur, K.; Cho, H.S. The Epigenetic Regulation of HCC Metastasis. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef]
- Han, T.S.; Voon, D.C.; Oshima, H.; Nakayama, M.; Echizen, K.; Sakai, E.; Yong, Z.W.E.; Murakami, K.; Yu, L.; Minamoto, T.; et al. Interleukin 1 Upregulates MicroRNA 135b to Promote Inflammation-associated Gastric Carcinogenesis in Mice. Gastroenterology 2018. [Google Scholar] [CrossRef]
- Malumbres, M. Cyclin-dependent kinases. Genome Biol. 2014, 15, 122. [Google Scholar] [CrossRef] [PubMed]
- Warfel, N.A.; Dolloff, N.G.; Dicker, D.T.; Malysz, J.; El-Deiry, W.S. CDK1 stabilizes HIF-1alpha via direct phosphorylation of Ser668 to promote tumor growth. Cell Cycle 2013, 12, 3689–3701. [Google Scholar] [CrossRef] [PubMed]
- Sakurikar, N.; Thompson, R.; Montano, R.; Eastman, A. A subset of cancer cell lines is acutely sensitive to the Chk1 inhibitor MK-8776 as monotherapy due to CDK2 activation in S phase. Oncotarget 2016, 7, 1380–1394. [Google Scholar] [CrossRef]
- Shubbar, E.; Kovacs, A.; Hajizadeh, S.; Parris, T.Z.; Nemes, S.; Gunnarsdottir, K.; Einbeigi, Z.; Karlsson, P.; Helou, K. Elevated cyclin B2 expression in invasive breast carcinoma is associated with unfavorable clinical outcome. BMC Cancer 2013, 13, 1. [Google Scholar] [CrossRef]
- Chen, X.; Guo, X.; Zhang, H.; Xiang, Y.; Chen, J.; Yin, Y.; Cai, X.; Wang, K.; Wang, G.; Ba, Y.; et al. Role of miR-143 targeting KRAS in colorectal tumorigenesis. Oncogene 2009, 28, 1385–1392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiong, B.; Cheng, Y.; Ma, L.; Zhang, C. MiR-21 regulates biological behavior through the PTEN/PI-3 K/Akt signaling pathway in human colorectal cancer cells. Int. J. Oncol. 2013, 42, 219–228. [Google Scholar] [CrossRef]
- Nagel, R.; le Sage, C.; Diosdado, B.; van der Waal, M.; Oude Vrielink, J.A.; Bolijn, A.; Meijer, G.A.; Agami, R. Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer. Cancer Res. 2008, 68, 5795–5802. [Google Scholar] [CrossRef]
- Shi, J.; Chen, P.; Sun, J.; Song, Y.; Ma, B.; Gao, P.; Chen, X.; Wang, Z. MicroRNA-1258: An invasion and metastasis regulator that targets heparanase in gastric cancer. Oncol. Lett. 2017, 13, 3739–3745. [Google Scholar] [CrossRef] [Green Version]
- Tang, D.; Zhang, Q.; Zhao, S.; Wang, J.; Kangping, L.; Song, Y.; Zhao, L.; Kang, X.; Wang, J.; Xu, S. The expression and clinical significance of microRNA-1258 and heparanase in human breast cancer. Clin. Biochem. 2013, 46, 926–932. [Google Scholar] [CrossRef]
- Zhang, L.; Sullivan, P.S.; Goodman, J.C.; Gunaratne, P.H.; Marchetti, D. MicroRNA-1258 suppresses breast cancer brain metastasis by targeting heparanase. Cancer Res. 2011, 71, 645–654. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Chen, X.; Gao, W.; Jiang, G. The expression of heparanase and microRNA-1258 in human non-small cell lung cancer. Tumor Biol. 2012, 33, 1327–1334. [Google Scholar] [CrossRef] [PubMed]
- Fujita, Y.; Yagishita, S.; Hagiwara, K.; Yoshioka, Y.; Kosaka, N.; Takeshita, F.; Fujiwara, T.; Tsuta, K.; Nokihara, H.; Tamura, T.; et al. The clinical relevance of the miR-197/CKS1B/STAT3-mediated PD-L1 network in chemoresistant non-small-cell lung cancer. Mol. Ther. 2015, 23, 717–727. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, S.; Yang, C.D.; Hong, H.C.; Chou, C.H.; Tai, C.S.; Chiew, M.Y.; Chen, W.L.; Weng, S.L.; Chen, C.C.; Chang, Y.A.; et al. Integrated MicroRNA-mRNA Analysis Reveals miR-204 Inhibits Cell Proliferation in Gastric Cancer by Targeting CKS1B, CXCL1 and GPRC5A. Int. J. Mol. Sci. 2017, 19. [Google Scholar] [CrossRef]
- Torres-Ferreira, J.; Ramalho-Carvalho, J.; Gomez, A.; Menezes, F.D.; Freitas, R.; Oliveira, J.; Antunes, L.; Bento, M.J.; Esteller, M.; Henrique, R.; et al. MiR-193b promoter methylation accurately detects prostate cancer in urine sediments and miR-34b/c or miR-129-2 promoter methylation define subsets of clinically aggressive tumors. Mol. Cancer 2017, 16, 26. [Google Scholar] [CrossRef]
- Braga, E.A.; Loginov, V.I.; Burdennyi, A.M.; Filippova, E.A.; Pronina, I.V.; Kurevlev, S.V.; Kazubskaya, T.P.; Kushlinskii, D.N.; Utkin, D.O.; Ermilova, V.D.; et al. Five Hypermethylated MicroRNA Genes as Potential Markers of Ovarian Cancer. Bull. Exp. Biol. Med. 2018, 164, 351–355. [Google Scholar] [CrossRef]
- Reid, G.; Kao, S.C.; Pavlakis, N.; Brahmbhatt, H.; MacDiarmid, J.; Clarke, S.; Boyer, M.; van Zandwijk, N. Clinical development of TargomiRs, a miRNA mimic-based treatment for patients with recurrent thoracic cancer. Epigenomics 2016, 8, 1079–1085. [Google Scholar] [CrossRef] [Green Version]
Primers | Sequences (5′–3′) | Restriction Enzyme | |
---|---|---|---|
CKS1B | Forward | TATTCGGACAAATACGACGACG | |
Reverse | CGCCAAGATTCCTCCATTCAGA | ||
GAPDH | Forward | CTCTGCTCCTCCTGTTCGAC | |
Reverse | TTAAAAGCAGCCCTGGTGAC | ||
miR-1258 cloning primer | Forward | AAAGAGCTCGAGCGTGAGCAACAGCTTC | SacI |
Reverse | AAGGTACCGGGACCTTCTCTCTGCTCCT | KpnI | |
CKS1B WT 3′-UTR | Forward | AGCTTTACACAGCTGTCCTTACTTCCTAACATCTT | SacI |
Reverse | TCGAAAGATGTTAGGAAGTAAGGACAGCTGTGTAAAGCTAGCT | XhoI | |
CKS1B MUT 3′-UTR | Forward | AGCTTTACACAGCTGTCCTTACTTAAATTTATCTT | SacI |
Reverse | TCGAAAGATAAATTTAAGTAAGGACAGCTGTGTAAAGCTAGCT | XhoI |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hwang, J.-S.; Jeong, E.-J.; Choi, J.; Lee, Y.-J.; Jung, E.; Kim, S.-K.; Min, J.-K.; Han, T.-S.; Kim, J.-S. MicroRNA-1258 Inhibits the Proliferation and Migration of Human Colorectal Cancer Cells through Suppressing CKS1B Expression. Genes 2019, 10, 912. https://doi.org/10.3390/genes10110912
Hwang J-S, Jeong E-J, Choi J, Lee Y-J, Jung E, Kim S-K, Min J-K, Han T-S, Kim J-S. MicroRNA-1258 Inhibits the Proliferation and Migration of Human Colorectal Cancer Cells through Suppressing CKS1B Expression. Genes. 2019; 10(11):912. https://doi.org/10.3390/genes10110912
Chicago/Turabian StyleHwang, Jin-Seong, Eun-Jeong Jeong, Jinhyeon Choi, Yeo-Jin Lee, Eunsun Jung, Seon-Kyu Kim, Jeong-Ki Min, Tae-Su Han, and Jang-Seong Kim. 2019. "MicroRNA-1258 Inhibits the Proliferation and Migration of Human Colorectal Cancer Cells through Suppressing CKS1B Expression" Genes 10, no. 11: 912. https://doi.org/10.3390/genes10110912
APA StyleHwang, J.-S., Jeong, E.-J., Choi, J., Lee, Y.-J., Jung, E., Kim, S.-K., Min, J.-K., Han, T.-S., & Kim, J.-S. (2019). MicroRNA-1258 Inhibits the Proliferation and Migration of Human Colorectal Cancer Cells through Suppressing CKS1B Expression. Genes, 10(11), 912. https://doi.org/10.3390/genes10110912