Propranolol Suppresses the T-Helper Cell Depletion-Related Immune Dysfunction in Cirrhotic Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Ethical Approval
2.3. Evaluation of Systemic Inflammation
2.4. Detection of Systemic Infection
2.5. Tissue Collections
2.6. Preparation of Splenic T Lymphocytes
2.7. Effects of Chronic Propranolol Treatment on the Basal Proportion of the Th Cell Subsets
2.8. Acute Effects of Propranolol on the Proliferation and Apoptosis of Splenic Lymphocytes
2.9. Acute Effects of Propranolol on the Differentiation of Splenic Th Lymphocytes
2.10. Statistical Analysis
3. Results
3.1. Chronic Propranolol Treatment Corrected Lymphopenia, Systemic Inflammation, and Bacterial Translocation in Cirrhotic Mice
3.2. Over-Expression of ADRB1 and ADRB2 Protein Was Found in Spleen and Splenic T Lymphocytes of Cirrhotic Mice
3.3. Chronic Propranolol Treatment Suppressed Abnormal Apoptotic Activity and Restored Naíve T and Effector Memory T Cells in Spleens of Cirrhotic Mice
3.4. High Levels of Peripheral and Splenic LBP Were Associated with High Splenic Levels of ADRB Protein and Th1/Treg Cytokines in Cirrhotic Mice
3.5. Acute Propranolol Incubation Inhibits Apoptotic and Treg Markers of Splenic Th Cells from Cirrhotic Mice
3.6. Propranolol Inhibited Treg-Conditioned Differentiation and Restored Th2-Conditioned Differentiation of Th Cells Isolated from Cirrhotic Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Bernstein, I.M.; Williams, R.C., Jr.; Webster, K.H.; Strickland, R.G. Reduction in circulating T lymphocytes in alcoholic liver disease. Lancet 1974, 7879, 488–490. [Google Scholar] [CrossRef]
- Støy, S.; Dige, A.; Sandahl, T.D.; Laursen, T.L.; Buus, C.; Hokland, M.; Vilstrup, H. Cytotoxic T lymphocytes and natural killer cells display impaired cytotoxic functions and reduced activation in patients with alcoholic hepatitis. Am. J. Physiol. Gastrointest. Liver Physiol. 2015, 308, G269–G276. [Google Scholar] [CrossRef] [PubMed]
- Berzigotti, A.; Zappoli, P.; Magalotti, D.; Tiani, C.; Rossi, V.; Zoli, M. Spleen enlargement on follow-up evaluation: A noninvasive predictor of complications of portal hypertension in cirrhosis. Clin. Gastroenterol. Hepatol. 2008, 10, 1129–1134. [Google Scholar] [CrossRef]
- Mejias, M.; Garcia-Pras, E.; Gallego, J.; Mendez, R.; Bosch, J.; Fernandez, M. Relevance of the mTOR signaling pathway in the pathophysiology of splenomegaly in rats with chronic portal hypertension. J. Hepatol. 2010, 4, 529–539. [Google Scholar] [CrossRef] [PubMed]
- Lario, M.; Muñoz, L.; Ubeda, M.; Borrero, M.J.; Martínez, J.; Monserrat, J.; Díaz, D.; Alvarez-Mon, M.; Albillos, A. Defective thymopoiesis and poor peripheral homeostatic replenishment of T-helper cells cause T-cell lymphopenia in cirrhosis. J. Hepatol. 2013, 4, 723–730. [Google Scholar] [CrossRef]
- Márquez, M.; Fernández-Gutiérrez, C.; Montes-de-Oca, M.; Blanco, M.J.; Brun, F.; Rodríguez-Ramos, C.; Girón-González, J.A. Chronic antigenic stimuli as a possible explanation for the immunodepression caused by liver cirrhosis. Clin. Exp. Immunol. 2009, 2, 219–229. [Google Scholar]
- Muñoz, L.; Albillos, A.; Nieto, M.; Reyes, E.; Lledó, L.; Monserrat, J.; Sanz, E.; de la Hera, A.; Alvarez-Mon, M. Mesenteric Th1 polarization and monocyte TNF-alpha production: First steps to systemic inflammation in rats with cirrhosis. Hepatology 2005, 2, 411–419. [Google Scholar] [CrossRef]
- Yunfu, L. Causes of peripheral blood cytopenia in patients with liver cirrhosis portal hypertension and clinical significances. Open J. Endocr. Metab. Dis. 2014, 4, 85–89. [Google Scholar]
- Li, A.; Li, Z.; Ma, S.; Su, Q.; Zhang, S.; Sun, X.; Li, G. Dysfunction of splenic macrophages in cirrhotic patients with hypersplenism and HBV infection. Am. J. Med. Sci. 2008, 1, 32–38. [Google Scholar] [CrossRef]
- Trevisani, F.; Castelli, E.; Foschi, F.G.; Parazza, M.; Loggi, E.; Bertelli, M.; Melotti, C.; Domenicali, M.; Zoli, G.; Bernardi, M. Impaired tuftsin activity in cirrhosis: Relationship with splenic function and clinical outcome. Gut 2002, 5, 707–712. [Google Scholar] [CrossRef]
- Zapater, P.; Gómez-Hurtado, I.; Peiró, G.; González-Navajas, J.M.; García, I.; Giménez, P.; Moratalla, A.; Such, J.; Francés, R. Beta-Adrenergic Receptor 1 Selective Antagonism Inhibits Norepinephrine-Mediated TNF-Alpha Downregulation in Experimental Liver Cirrhosis. PLoS ONE 2012, 7, e43371. [Google Scholar] [CrossRef] [PubMed]
- Henriksen, J.H.; Ring-Larsen, H.; Kanstrup, I.L.; Christensen, N.J. Splanchnic and renal elimination and release of catecholamines in cirrhosis. Evidence of enhanced sympathetic nervous activity in patients with decompensated cirrhosis. Gut 1984, 25, 1034–1043. [Google Scholar] [CrossRef] [PubMed]
- Worlicek, M.; Knebel, K.; Linde, H.J.; Moleda, L.; Schölmerich, J.; Straub, R.H.; Wiest, R. Splanchnic sympathectomy prevents translocation and spreading of E coli but not S aureus in liver cirrhosis. Gut 2010, 59, 1127–1134. [Google Scholar] [CrossRef]
- Pérez-Paramo, M.; Muñoz, J.; Albillos, A.; Freile, I.; Portero, F.; Santos, M.; Ortiz-Berrocal, J. Effect of propranolol on the factors promoting bacterial translocation in cirrhotic rats with ascites. Hepatology 2000, 31, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Senzolo, M.; Cholongitas, E.; Burra, P.; Leandro, G.; Thalheimer, U.; Patch, D.; Burroughs, A.K. beta-Blockers protect against spontaneous bacterial peritonitis in cirrhotic patients: A meta-analysis. Liver Int. 2009, 29, 1189–1193. [Google Scholar] [CrossRef]
- Mookerjee, R.P.; Pavesi, M.; Thomsen, K.L.; Mehta, G.; Macnaughtan, J.; Bendtsen, F.; Coenraad, M.; Sperl, J.; Gines, P.; Moreau, R.; et al. CANONIC Study Investigators of the EASL-CLIF Consortium: Treatment with non-selective beta blockers is associated with reduced severity of systemic inflammation and improved survival of patients with acute-on-chronic liver failure. J. Hepatol. 2016, 3, 574–582. [Google Scholar] [CrossRef]
- Bartik, M.M.; Brooks, W.H.; Roszman, T.L. Modulation of T cell proliferation by stimulation of the beta-adrenergic receptor: Lack of correlation between inhibition of T cell proliferation and cAMP accumulation. Cell. Immunol. 1993, 2, 408–421. [Google Scholar] [CrossRef]
- Fuchs, B.A.; Albright, J.W.; Albright, J.F. Beta-adrenergic receptor on murine lymphocytes: Density varies with cell maturity and lymphocyte subtype and is decreased after antigen administration. Cell. Immunol. 1988, 114, 231–245. [Google Scholar] [CrossRef]
- Pochet, R.; Delespesse, G. Beta-adrenoceptors display different efficiency on lymphocyte subpopulations. Biochem. Pharmacol. 1983, 32, 1651–1655. [Google Scholar] [CrossRef]
- Huang, Y.T.; Lin, H.C.; Tsai, J.F.; Hou, M.C.; Hong, C.Y. Chronic administration of propranolol improves vascular contractile responsiveness in portal hypertensive rats. Eur. J. Clin. Investig. 1997, 27, 550–555. [Google Scholar] [CrossRef]
- D’Amico, M.; Mejias, M.; García-Pras, E.; Abraldes, J.G.; García-Pagán, J.C.; Fernández, M.; Bosch, J. Effects of the combined administration of propranolol plus sorafenib on portal hypertension in cirrhotic rats. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 302, G1191–G1198. [Google Scholar] [CrossRef]
- McGovern, B.H.; Golan, Y.; Lopez, M.; Pratt, D.; Lawton, A.; Moore, G.; Epstein, M.; Knox, T.A. The impact of cirrhosis on CD4+ T cell counts in HIV-seronegative patients. Clin. Infect. Dis. 2007, 3, 431–437. [Google Scholar] [CrossRef]
- Maisel, A.S.; Murray, D.; Lotz, M.; Rearden, A.; Irwin, M.; Michel, M.C. Propranolol treatment affects parameters of human immunity. Immunopharmacology 1991, 22, 157–164. [Google Scholar] [CrossRef]
- Zhou, L.; Li, Y.; Li, X.; Chen, G.; Liang, H.; Wu, Y.; Tong, J.; Ouyang, W. Propranolol Attenuates Surgical Stress-Induced Elevation of the Regulatory T Cell Response in Patients Undergoing Radical Mastectomy. J. Immunol. 2016, 196, 3460–3469. [Google Scholar] [CrossRef]
- Muñoz, L.; Borrero, M.J.; Úbeda, M.; Conde, E.; Del Campo, R.; Rodríguez-Serrano, M.; Lario, M.; Sánchez-Díaz, A.M.; Pastor, O.; Díaz, D.; et al. Intestinal immune dysregulation driven by dysbiosis promotes barrier disruption and bacterial translocation in rats with cirrhosis. Hepatology 2019, 70, 925–938. [Google Scholar] [CrossRef]
- Case, A.J.; Zimmerman, M.C. Redox-regulated suppression of splenic T-lymphocyte activation in a model of sympathoexcitation. Hypertension 2015, 65, 916–923. [Google Scholar] [CrossRef]
- Yangs, Y.Y.; Lin, H.C.; Huang, Y.T.; Lee, T.Y.; Hou, M.C.; Lee, F.Y.; Liu, R.S.; Chang, F.Y.; Lee, S.D. Effect of 1-week losartan administration on bile duct-ligated cirrhotic rats with portal hypertension. J. Hepatol. 2002, 36, 600–606. [Google Scholar] [CrossRef]
- Sansoè, G.; Aragno, M.; Mastrocola, R.; Mengozzi, G.; Parola, M. Alpha-2A Adrenoceptor Agonist Guanfacine Restores Diuretic Efficiency in Experimental Cirrhotic Ascites: Comparison with Clonidine. PLoS ONE 2016, 11, e0158486. [Google Scholar] [CrossRef]
- Mueller, H.S.; Ayres, S.M. Propranolol decreases sympathetic nervous activity reflected by plasma catecholamines during evolution of myocardial infarction in man. J. Clin. Investig. 1980, 65, 338–346. [Google Scholar] [CrossRef]
- MacNeil, B.J.; Jansen, A.H.; Greenberg, A.H.; Nance, D.M. Activation and selectivity of splenic sympathetic nerve electrical activity response to bacterial endotoxin. Am. J. Physiol. 1996, 1, R264–R270. [Google Scholar] [CrossRef]
- Semaeva, E.; Tenstad, O.; Skavland, J.; Enger, M.; Iversen, P.O.; Gjertsen, B.T.; Wiig, H. Access to the spleen microenvironment through lymph shows local cytokine production, increased cell flux, and altered signaling of immune cells during lipopolysaccharide-induced acute inflammation. J. Immunol. 2010, 184, 4547–4556. [Google Scholar] [CrossRef]
- Rogausch, H.; del Rey, A.; Oertel, J.; Besedovsky, H.O. Norepinephrine stimulates lymphoid cell mobilization from the perfused rat spleen via beta-adrenergic receptors. Am. J. Physiol. 1999, 3, R724–R730. [Google Scholar]
- Cao, L.; Hudson, C.A.; Lawrence, D.A. Acute cold/restraint stress inhibits host resistance to Listeria monocytogenes via β1-adrenergic receptors. Brain. Behav. Immun. 2003, 17, 121–133. [Google Scholar] [CrossRef]
- Elenkov, I.J.; Haskó, G.; Kovács, K.J.; Vizi, E.S. Modulation of lipopolysaccharide-induced tumor necrosis factor-alpha production by selective alpha and beta adrenergic drugs in mice. J. Neuroimmunol. 1995, 61, 123–131. [Google Scholar] [CrossRef]
- Van Tits., L.J.; Michel, M.C.; Grosse-Wilde, H.; Happel, M.; Eigler, F.W.; Soliman, A.; Brodde, O.E. Catecholamines increase lymphocyte beta 2-adrenergic receptors via a beta 2-adrenergic, spleen-dependent process. Am. J. Physiol. 1990, 258, E191–E202. [Google Scholar] [CrossRef]
- Albillos, A.; Lario, M.; Álvarez-Mon, M. Cirrhosis-associated immune dysfunction: Distinctive features and clinical relevance. J. Hepatol. 2014, 61, 1385–1396. [Google Scholar] [CrossRef]
- Gerbes, A.L.; Remien, J.; Jüngst, D.; Sauerbruch, T.; Paumgartner, G. Evidence for down-regulation of beta-2-adrenoceptors in cirrhotic patients with severe ascites. Lancet 1986, 1, 1409–1411. [Google Scholar] [CrossRef]
- Surh, C.D.; Sprent, J. Homeostasis of naïve and memory T cells. Immunity 2008, 29, 848–862. [Google Scholar] [CrossRef]
- Li, Z.F.; Zhang, S.; Lv, G.B.; Huang, Y.; Zhang, W.; Ren, S.; Yang, J.; Dang, S.S. Changes in count and function of splenic lymphocytes from patients with portal hypertension. World J. Gastroenterol. 2008, 14, 2377–2382. [Google Scholar] [CrossRef]
- Chakir, H.; Wang, H.; Lefebvre, D.E.; Webb, J.; Scott, F.W. T-bet/GATA-3 ratio as a measure of the Th1/Th2 cytokine profile in mixed cell populations: Predominant role of GATA-3. J. Immunol. Methods 2003, 1, 157–169. [Google Scholar] [CrossRef]
- Zheng, Y.; Song, T.; Zhang, L.; Wei, N. Immunomodulatory effects of T helper 17 cells and regulatory T cells on cerebral ischemia. J. Biol. Regul. Homeost. Agents 2018, 32, 29–35. [Google Scholar]
- Wang, Z.H.; Qin, C.; Ran, T.; Yang, D.Q.; Guo, J.H. Effects of Astragalus glycoprotein on Th17/Treg cells in mice with collagen-induced arthritis. J. Biol. Regul. Homeost. Agents 2018, 32, 951–957. [Google Scholar]
- Lan, Y.T. Treg/Th17 imbalance and its clinical significance in patients with hepatitis B-associated liver cirrhosis. Diagn. Pathol. 2019, 14, 114. [Google Scholar] [CrossRef]
- Serrano, C.A.; Ling, S.C.; Verdaguer, S.; León, M.; Jarufe, N.; Guerra, J.F.; Pattillo, J.C.; Benítez, C.; Villagrán, A.; Torres, J.; et al. Portal Angiogenesis in chronic liver disease patients correlates with portal pressure and collateral formation. Dig. Dis. 2019, 37, 498–508. [Google Scholar] [CrossRef]
- Guereschi, M.G.; Araujo, L.P.; Maricato, J.T.; Takenaka, M.C.; Nascimento, V.M.; Vivanco, B.C.; Reis, V.O.; Keller, A.C.; Brum, P.C.; Basso, A.S. Beta2-adrenergic receptor signaling in CD4+ Foxp3+ regulatory T cells enhances their suppressive function in a PKA-dependent manner. Eur. J. Immunol. 2013, 4, 1001–1012. [Google Scholar] [CrossRef]
- Tsushima, H.; Kawata, S.; Tamura, S.; Ito, N.; Shirai, Y.; Kiso, S.; Doi, Y.; Yamada, A.; Oshikawa, O.; Matsuzawa, Y. Reduced plasma transforming growth factor-beta1 levels in patients with chronic hepatitis C after interferon-alpha therapy: Association with regression of hepatic fibrosis. J. Hepatol. 1990, 1, 1–7. [Google Scholar]
- Niedbala, W.; Wei, X.Q.; Cai, B.; Hueber, A.J.; Leung, B.P.; McInnes, I.B.; Liew, F.Y. IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells. Eur. J. Immunol. 2007, 11, 3021–3029. [Google Scholar] [CrossRef]
- Calabrese, F.; Valente, M.; Giacometti, C.; Pettenazzo, E.; Benvegnu, L.; Alberti, A.; Gatta, A.; Pontisso, P. Parenchymal transforming growth factor beta-1: Its type II receptor and Smad signaling pathway correlate with inflammation and fibrosis in chronic liver disease of viral etiology. J. Gastroenterol. Hepatol. 2003, 11, 1302. [Google Scholar] [CrossRef]
- Pandiyan, P.; Zheng, L.; Ishihara, S.; Reed, J.; Lenardo, M.J. CD4 + CD25 + Foxp3+ regulatory T cells induce cytokine deprivation-mediated apoptosis of effector CD4+ T cells. Nat. Immunol. 2007, 8, 1353–1362. [Google Scholar] [CrossRef]
- Kerdiles, Y.M.; Stone, E.L.; Beisner, D.R.; McGargill, M.A.; Ch’en, I.L.; Stockmann, C.; Katayama, C.D.; Hedrick, S.M. Foxo transcription factors control regulatory T cell development and function. Immunity 2010, 6, 890–904. [Google Scholar] [CrossRef]
- O’Garra, A.; Vieira, P.L.; Vieira, P.; Goldfeld, A.E. IL-10-producing and naturally occurring CD4+ Tregs: Limiting collateral damage. J. Clin. Investig. 2004, 10, 1372–1378. [Google Scholar] [CrossRef] [PubMed]
- Shevach, E.M. Mechanisms of foxp3+ T regulatory cell-mediated suppression. Immunity 2009, 5, 636–645. [Google Scholar] [CrossRef] [PubMed]
- Wohlfert, E.A.; Grainger, J.R.; Bouladoux, N.; Konkel, J.E.; Oldenhove, G.; Ribeiro, C.H.; Hall, J.A.; Yagi, R.; Naik, S.; Bhairavabhotla, R.; et al. GATA3 controls Foxp3 regulatory T cell fate during inflammation in mice. J. Clin. Investig. 2011, 121, 4503–4515. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Guo, E. Effect of propranolol on proliferation and apoptosis of hemangioma endothelial cells in infants and young children. J. Biol. Regul. Homeost. Agents 2018, 32, 1491–1497. [Google Scholar]
- Lamy, S.; Lachambre, M.P.; Lord-Dufour, S.; Béliveau, R. Propranolol suppresses angiogenesis in vitro: Inhibition of proliferation, migration, and differentiation of endothelial cells. Vascul. Pharmacol. 2010, 53, 200–208. [Google Scholar] [CrossRef]








| Name of Gene | Sequence of Sense Primer (5′-3′) | Sequence of Anti-Sense Primer (3′-5′) |
|---|---|---|
| 18S | ACGGAAGGGCACCACCAGGA | CACCACCACCCACGGAATCG |
| ADRB1 | CGTCGCCCTTTCGCTACCAG | CCGCCACCAGTGCAGTGCTGAGGAT |
| ADRB2 | TGCGTGATTGCAGTGGATCGCTAT | CTATCTTCTGCAGCTGCCTTTTGG |
| CD68 | GCTACATGGCGGTGGAGTACAA | ATGATGAGAGGCAGCAAGATGG |
| F4/80 | CAAGACTGACAACCAGACG | ACAGAAGCAGAGATTATGACC |
| IFN-γ | TGA ACG CTA CAC ACT GCA TCT TGG | CGA CTC CTT TTC CGC TTC CTG AG |
| IL-10 | ACAGCCGGGAAGACAATAACT | ACACCCAGGAAAGACAGCA |
| TGFβ1 | CCTGCAAGACCATCGACATG | TGTTGTACAAAGCGAGCACC |
| T-bet | CGG CTG CAT ATC GTT GAG GT | GTC CCC ATT GGC ATT CCT C |
| GATA-3 | TGTCTGCAGCCAGGAGAGC | ATGCATCAAACAACTGTGGCCA |
| Foxp3 | ACACCCAGGAAAGACAGCA | ACACCCAGGAAAGACAGCA |
| Caspase-3 | GGTATTGAGACAGACAGTGG | CATGGGATCTGTTTCTTTGC |
| Ki-67 | ATTTCAGTTCCGCCAATCC | GGCTTCCGTCTTCATACCTAAA |
| cAMP | AGAAATCACCCAGCAGGGCAAA | GTATGGGGACAGTGACCCTCAACC |
| p38MAPK | CGAAATGACCGGCTACGTGG | CACTTCATCGTAGGTCAGGC |
| Sham (n = 4) | BDL-V (n = 7) | BDL-Pro (n = 7) | TAA-V (n = 7) | TAA-Pro (n = 7) | |
|---|---|---|---|---|---|
| Presence of ascites (%) | 0 | 6/7 | 5/7 | 4/7 | 3/7 |
| Body weight (BW, gm) | 29.7 ± 1.6 | 27.1 ± 2.4 | 28.3 ± 1.9 | 26.1 ± 1.1 | 27.5 ± 0.9 |
| Liver weight (mg) | 1.2 ± 0.2 | 2.51 ± 0.3 * | 2.6 ± 0.1 * | 2.32 ± 0.4 * | 2.4 ± 0.1 * |
| Liver to BW ratio (mg/100g BW) | 4.1 ± 0.6 | 9.2 ± 0.5 * | 9.1 ± 0.3 * | 8.9 ± 0.2 * | 8.7 ± 0.1 * |
| Spleen weight (mg) | 0.184 ± 0.01 | 0.27 ± 0.02 * | 0.21 ± 0.03 | 0.24 ± 0.01 * | 0.202 ± 0.01 |
| Spleen to BW ratio (mg/100 g BW) | 0.62 ± 0.01 | 0.99 ± 0.02 * | 0.7 4± 0.01 # | 0.92 ± 0.01 * | 0.73 ± 0.02 # |
| Plasma norepinephrine level (pg/mL) | 298 ± 64 | 549 ± 66 * | 398 ± 77 # | 568 ± 95 * | 398 ± 87 # |
| Sham (n = 4) | BDL-V (n = 7) | BDL-Pro (n = 7) | TAA-V (n = 7) | TAA-Pro (n = 7) | ||
|---|---|---|---|---|---|---|
| Blood | aerobic bacteria | 1/4(25%) | 5/7(71% *,δ) | 3/7(43% #) | 6/7(86% *,δ) | 2/7 (29% #) |
| anaerobic bacteria | 0/4(0%) | 3/7(42% *) | 1/7 (14% #) | 4/7(57% *) | 1/7 (14% #) | |
| Ascites | aerobic bacteria | - | 4/7(57% *,δ) | 2/7 (29% #) | 5/7(71% *,δ) | 1/7 (14% #) |
| anaerobic bacteria | - | 5/7(71% *) | 3/7 (43% #) | 3/7(43% *) | 1/7 (14% #) | |
| Lung | aerobic bacteria | 0/4(0%) | 2/7(29% *) | 2/7 (29%) | 1/7(14% *) | 0/7 (0%) |
| anaerobic bacteria | 0/4(0%) | 1/7(14%) | 1/7 (14%) | 2/7(29%) | 0/7 (0%) | |
| Intestine | aerobic bacteria | 0/4(0%) | 6/7(86% *,δ) | 2/7 (29% #) | 5/7(71% *,δ) | 1/7 (14% #) |
| anaerobic bacteria | 0/4(0%) | 2/7(29% *) | 1/7 (14%) | 1/7(14% *) | 0/7 (0%) | |
| Pleural fluid | aerobic bacteria | - | 2/7(29% *) | 0/7 (0%) | 3/7(43% *,δ) | 1/7 (14% #) |
| anaerobic bacteria | - | 2/7(29% *) | 1/7 (14%) | 2/7(29% *) | 1/7 (14% #) | |
| Liver | aerobic bacteria | 1/4(25%) | 3/7(43% *) | 1/7 (14% #) | 2/7(29% δ) | 1/7 (14% #) |
| anaerobic bacteria | 1/4(25%) | 2/7(29%) | 1/7 (14%) | 3/7(43% *) | 1/7 (14% #) | |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsai, H.-C.; Hsu, C.-F.; Huang, C.-C.; Huang, S.-F.; Li, T.-H.; Yang, Y.-Y.; Lin, M.-W.; Lee, T.-Y.; Liu, C.-W.; Huang, Y.-H.; et al. Propranolol Suppresses the T-Helper Cell Depletion-Related Immune Dysfunction in Cirrhotic Mice. Cells 2020, 9, 604. https://doi.org/10.3390/cells9030604
Tsai H-C, Hsu C-F, Huang C-C, Huang S-F, Li T-H, Yang Y-Y, Lin M-W, Lee T-Y, Liu C-W, Huang Y-H, et al. Propranolol Suppresses the T-Helper Cell Depletion-Related Immune Dysfunction in Cirrhotic Mice. Cells. 2020; 9(3):604. https://doi.org/10.3390/cells9030604
Chicago/Turabian StyleTsai, Hung-Cheng, Chien-Fu Hsu, Chia-Chang Huang, Shiang-Fen Huang, Tzu-Hao Li, Ying-Ying Yang, Ming-Wei Lin, Tzung-Yan Lee, Chih-Wei Liu, Yi-Hsiang Huang, and et al. 2020. "Propranolol Suppresses the T-Helper Cell Depletion-Related Immune Dysfunction in Cirrhotic Mice" Cells 9, no. 3: 604. https://doi.org/10.3390/cells9030604
APA StyleTsai, H.-C., Hsu, C.-F., Huang, C.-C., Huang, S.-F., Li, T.-H., Yang, Y.-Y., Lin, M.-W., Lee, T.-Y., Liu, C.-W., Huang, Y.-H., Hou, M.-C., & Lin, H.-C. (2020). Propranolol Suppresses the T-Helper Cell Depletion-Related Immune Dysfunction in Cirrhotic Mice. Cells, 9(3), 604. https://doi.org/10.3390/cells9030604

