Characterization of Living Dental Pulp Cells in Direct Contact with Mineral Trioxide Aggregate
Abstract
:1. Introduction
2. Materials and Methods
2.1. Gene Transfection of Discosoma Species Red Fluorescent Protein (DsRed) into a Porcine Dental-Pulp Cell Line (PPU7)
2.2. Alkaline Phosphatase (ALP) Activity Assay of the PPU7 Cell Line
2.3. Changes in the Number of DsRed-PPU7 Cells on the Mineral Trioxide Aggregate (MTA) Disk
2.4. Correlation of Fluorescence Intensity and Cell-Proliferation Rate of DsRed-PPU7 Cells
2.5. Characterization of DsRed-PPU7 Cells on MTA Disks
2.6. Quantitative Polymerase Chain Reaction (qPCR) Analysis
2.7. Scanning Electron Microscopy (SEM) and Electron-Probe Microanalysis (EPMA)
2.8. Statistical Analysis
3. Results
3.1. Comparison of PPU7 and DsRed-PPU7 Cells
3.2. Changes in the Number of DsRed-PPU7 Cells on the MTA Disk
3.3. Correlation between Fluorescence Intensity and Cell-Proliferation Rate of DsRed-PPU7 Cells
3.4. DsRed-PPU7 Cells on the MTA Disk
3.5. Effect of BMP and TGF-β on DsRed-PPU7 Cells on the MTA Disk
3.6. Direction of Differentiation of DsRed-PPU7 Cells on the MTA Disk
3.7. Observation of Mineralized Precipitates on the MTA Disk
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
MTS: | 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphentl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt). |
LDN | 4-[6-[4-(1-piperazinyl)phenyl]pyrazolo[1,5-a]pyrimidin-3-yl]-quinolinehydrochloride. |
RNA | ribonucleic acid |
mRNA | messenger ribonucleic acid |
PBS | phosphate buffer saline |
NaOH | sodium hydroxide |
MgCl2 | magnesium chloride. |
HCl | hydrochloric acid |
CO2 | carbon dioxide |
Ca | calcium |
P | phosphorus |
Si | silicon |
Smad | homologs of Caenorhabditis elegans (Sma) and Drosophila (Mad) proteins |
Appendix A
Appendix A.1. Fluorescence Microscope Observation of DeRed-PPU7 Cells on MTA Disk
Appendix A.2. Experimental Animal Model
Appendix A.3. Preparation of DsRed-PPU7 Cells
Appendix A.4. Splice Variants of Dentin Sialophosphoprotein
Gene | Sequence (5′→3′) | Size (bp) | qPCR Protocol (45 Cycles) | ||
---|---|---|---|---|---|
Dspp-v1 | F | CCCAGAAACCCAATCAGAGA | 300 | Denaturation Annealing Extension | 95 °C, 10 s 60 °C, 10 s 72 °C, 15 s |
R | TATGTGTTTTGCTGGGTCCA | ||||
Dspp-v2 | F | CCCAGAAACCCAATCAGAGA | 149 | ||
R | GGGAAGGAAGGGGAGAATTT | ||||
Mmp20 | F | ATGCAGCTTACGAAGTGGCT | 95 | ||
R | GGGAGGACCTTGCATTTGGA | ||||
Col1a1 | F | TGCGACGAAATCAAGAACTG | 204 | ||
R | TCCAGGAAGTCCAGGTTGTC | ||||
Gapdh | F | CCATCACCATCTTCCAGGAG | 346 | ||
R | ACAGTCTTCTGGGTGGCAGT |
References
- Roberts, H.W.; Toth, J.M.; Berzins, D.W.; Charlton, D.G. Mineral trioxide aggregate material use in endodontic treatment: A review of the literature. Dent. Mater. 2008, 24, 149–164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parirokh, M.; Torabinejad, M. Mineral Trioxide Aggregate: A Comprehensive Literature Review—Part III: Clinical Aapplications, Drawbacks, and Mechanism of Action. J. Endod. 2010, 36, 400–413. [Google Scholar] [CrossRef] [PubMed]
- Camilleri, J.; Pitt Ford, T.R. Mineral trioxide aggregate: A review of the constituents and biological properties of the material. Int. Endod. J. 2006, 39, 747–754. [Google Scholar] [CrossRef] [PubMed]
- Darvell, B.W.; Wu, R.C. “MTA”-An Hydraulic Silicate Cement: Review update and setting reaction. Dent. Mater. 2011, 27, 407–422. [Google Scholar] [CrossRef]
- Camilleri, J.; Montesin, F.E.; Brady, K.; Sweeney, R.; Curtis, R.V.; Ford, T.R. The constitution of mineral trioxide aggregate. Dent. Mater. 2005, 21, 297–303. [Google Scholar] [CrossRef]
- Dammaschke, T.; Gerth, H.U.; Züchner, H.; Schäfer, E. Chemical and physical surface and bulk material characterization of white ProRoot MTA and two Portland cements. Dent. Mater. 2005, 21, 731–738. [Google Scholar] [CrossRef]
- Tomás-Catalá, C.J.; Collado-González, M.; García-Bernal, D.; Oñate-Sánchez, R.E.; Forner, L.; Llena, C.; Lozano, A.; Moraleda, J.M.; Rodríguez-Lozano, F.J. Biocompatibility of New Pulp-capping Materials NeoMTA Plus, MTA Repair HP, and Biodentine on Human Dental Pulp Stem Cells. J. Endod. 2018, 44, 126–132. [Google Scholar] [CrossRef] [Green Version]
- Okiji, T.; Yoshiba, K. Reparative Dentinogenesis Induced by Mineral Trioxide Aggregate: A Review from the Biological and Physicochemical Points of View. Int J. Dent. 2009, 2009, 464280. [Google Scholar] [CrossRef]
- Eldeniz, A.U.; Hadimli, H.H.; Ataoglu, H.; Orstavik, D. Antibacterial Effect of Selected Root-End Filling Materials. J. Endod. 2006, 32, 345–349. [Google Scholar] [CrossRef]
- Al-Hezaimi, K.; Naghshbandi, J.; Oglesby, S.; Simon, J.H.; Rotstein, I. Comparison of Antifungal Activity of White-Colored and Gray-Colored Mineral Trioxide Aggregate (MTA) at Similar Concentrations Against Candida albicans. J. Endod. 2006, 32, 365–367. [Google Scholar] [CrossRef]
- Kaneko, T.; Gu, B.; Sone, P.P.; Zaw, S.Y.M.; Murano, H.; Zaw, Z.C.T.; Okiji, T. Dental Pulp Tissue Engineering Using Mesenchymal Stem Cells: A Review with a Protocol. Stem Cell Rev. Rep. 2018, 14, 668–676. [Google Scholar] [CrossRef] [PubMed]
- Sarkar, N.K.; Caicedo, R.; Ritwik, P.; Moiseyeva, R.; Kawashima, I. Physicochemical Basis of the Biologic Properties of Mineral Trioxide Aggregate. J. Endod. 2005, 31, 97–100. [Google Scholar] [CrossRef] [PubMed]
- Bozeman, T.B.; Lemon, R.R.; Eleazer, P.D. Elemental Analysis of Crystal Precipitate from Gray and White MTA. J. Endod. 2006, 32, 425–428. [Google Scholar] [CrossRef] [PubMed]
- Tay, F.R.; Pashley, D.H.; Rueggeberg, F.A.; Loushine, R.J.; Weller, R.N. Calcium Phosphate Phase Transformation Produced by the Interaction of the Portland Cement Component of White Mineral Trioxide Aggregate with a Phosphate-containing Fluid. J. Endod. 2007, 33, 1347–1351. [Google Scholar] [CrossRef]
- Reyes-Carmona, J.F.; Felippe, M.S.; Felippe, W.T. Biomineralization Ability and Interaction of Mineral Trioxide Aggregate and White Portland Cement with Dentin in a Phosphate-containing Fluid. J. Endod. 2009, 35, 731–736. [Google Scholar] [CrossRef]
- Han, L.; Okiji, T.; Okawa, S. Morphological and chemical analysis of different precipitates on mineral trioxide aggregate immersed in different fluids. Dent. Mater. J. 2010, 29, 512–517. [Google Scholar] [CrossRef] [Green Version]
- Gandolfi, M.G.; Taddei, P.; Tinti, A.; Prati, C. Apatite-forming ability (bioactivity) of ProRoot MTA. Int. Endod. J. 2010, 43, 917–929. [Google Scholar] [CrossRef]
- Rodrigues, E.M.; Cornélio, A.L.G.; Mestieri, L.B.; Fuentes, A.S.C.; Salles, L.P.; Rossa-Junior, C.; Faria, G.; Guerreiro-Tanomaru, J.M.; Tanomaru-Filho, M. Human dental pulp cells response to mineral trioxide aggregate (MTA) and MTA Plus: Cytotoxicity and gene expression analysis. Int. Endod. J. 2017, 50, 780–789. [Google Scholar] [CrossRef]
- Eid, A.A.; Gosier, J.L.; Primus, C.M.; Hammond, B.D.; Susin, L.F.; Pashley, D.H.; Tay, F.R. In Vitro Biocompatibility and Oxidative Stress Profiles of Different Hydraulic Calcium Silicate Cements. J. Endod. 2014, 40, 255–260. [Google Scholar] [CrossRef] [Green Version]
- Schneider, R.; Holland, G.R.; Chiego, D., Jr.; Hu, J.C.; Nör, J.E.; Botero, T.M. White Mineral Trioxide Aggregate Induces Migration and Proliferation of Stem Cells from the Apical Papilla. J. Endod. 2014, 40, 931–936. [Google Scholar] [CrossRef] [Green Version]
- Park, S.J.; Heo, S.M.; Hong, S.O.; Hwang, Y.C.; Lee, K.W.; Min, K.S. Odontogenic Effect of a Fast-setting Pozzolan-based Pulp Capping Material. J. Endod. 2014, 40, 1124–1131. [Google Scholar] [CrossRef]
- Minamikawa, H.; Yamada, M.; Deyama, Y.; Suzuki, K.; Kaga, M.; Yawaka, Y.; Ogawa, T. Effect of N-acetylcysteine on Rat Dental Pulp Cells Cultured on Mineral Trioxide Aggregate. J. Endod. 2011, 37, 637–641. [Google Scholar] [CrossRef] [PubMed]
- Eid, A.A.; Niu, L.N.; Primus, C.M.; Opperman, L.A.; Pashley, D.H.; Watanabe, I.; Tay, F.R. In Vitro Osteogenic/Dentinogenic Potential of an Experimental Calcium Aluminosilicate Cement. J. Endod. 2013, 39, 1161–1166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, B.N.; Lee, K.N.; Koh, J.T.; Min, K.S.; Chang, H.S.; Hwang, I.N.; Hwang, Y.C.; Oh, W.M. Effects of 3 Endodontic Bioactive Cements on Osteogenic Differentiation in Mesenchymal Stem Cells. J. Endod. 2014, 40, 1217–1222. [Google Scholar] [CrossRef] [PubMed]
- Tsai, C.L.; Ke, M.C.; Chen, Y.H.; Kuo, H.K.; Yu, H.J.; Chen, C.T.; Tseng, Y.C.; Chuang, P.C.; Wu, P.C. Mineral trioxide aggregate affects cell viability and induces apoptosis of stem cells from human exfoliated deciduous teeth. BMC Pharmacol. Toxicol. 2018, 19, 21. [Google Scholar] [CrossRef] [PubMed]
- Karakida, T.; Onuma, K.; Saito, M.M.; Yamamoto, R.; Chiba, T.; Chiba, R.; Hidaka, Y.; Fujii-Abe, K.; Kawahara, H.; Yamakoshi, Y. Potential for Drug Repositioning of Midazolam for Dentin Regeneration. Int. J. Mol. Sci. 2019, 20, 670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamakawa, S.; Niwa, T.; Karakida, T.; Kobayashi, K.; Yamamoto, R.; Chiba, R.; Yamakoshi, Y.; Hosoya, N. Effects of Er:YAG and Diode Laser Irradiation on Dental Pulp Cells and Tissues. Int. J. Mol. Sci. 2018, 19, 2429. [Google Scholar] [CrossRef] [Green Version]
- Niwa, T.; Yamakoshi, Y.; Yamazaki, H.; Karakida, T.; Chiba, R.; Hu, J.C.; Nagano, T.; Yamamoto, R.; Simmer, J.P.; Margolis, H.C.; et al. The dynamics of TGF-β in dental pulp, odontoblasts and dentin. Sci. Rep. 2018, 8, 4450. [Google Scholar] [CrossRef] [Green Version]
- Nagano, T.; Oida, S.; Suzuki, S.; Iwata, T.; Yamakoshi, Y.; Ogata, Y.; Gomi, K.; Arai, T.; Fukae, M. Porcine Enamel Protein Fractions Contain Transforming Growth Factor-β1. J. Periodontol. 2006, 77, 1688–1694. [Google Scholar] [CrossRef] [Green Version]
- Maruoka, Y.; Oida, S.; Iimura, T.; Takeda, K.; Asahina, I.; Enomoto, S.; Sasaki, S. Production of functional human bone morphogenetic protein-2 using a baculovirus/Sf-9 insect cell system. Biochem. Mol. Biol. Int. 1995, 35, 957–963. [Google Scholar]
- Yamamoto, R.; Oida, S.; Yamakoshi, Y. Dentin Sialophosphoprotein-derived Proteins in the Dental Pulp. J. Dent. Res. 2015, 94, 1120–1127. [Google Scholar] [CrossRef] [PubMed]
- Hosoya, N.; Takigawa, T.; Horie, T.; Maeda, H.; Yamamoto, Y.; Momoi, Y.; Yamamoto, K.; Okiji, T. A review of the literature on the efficacy of mineral trioxide aggregate in conservative dentistry. Dent. Mater. J. 2019, 38, 693–700. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takita, T.; Hayashi, M.; Takeichi, O.; Ogiso, B.; Suzuki, N.; Otsuka, K.; Ito, K. Effect of mineral trioxide aggregate on proliferation of cultured human dental pulp cells. Int. Endod. J. 2006, 39, 415–422. [Google Scholar] [CrossRef] [PubMed]
- Matz, M.V.; Fradkov, A.F.; Labas, Y.A.; Savitsky, A.P.; Zaraisky, A.G.; Markelov, M.L.; Lukyanov, S.A. Fluorescent proteins from nonbioluminescent Anthozoa species. Nat. Biotechnol. 1999, 17, 969–973. [Google Scholar] [CrossRef] [PubMed]
- Strack, R.L.; Strongin, D.E.; Bhattacharyya, D.; Tao, W.; Berman, A.; Broxmeyer, H.E.; Keenan, R.J.; Glick, B.S. A noncytotoxic DsRed variant for whole-cell labeling. Nat. Methods 2008, 5, 955–957. [Google Scholar] [CrossRef] [Green Version]
- Torabinejad, M.; Hong, C.U.; McDonald, F.; Pitt Ford, T.R. Physical and Chemical Properties of a New Root-End Filling Material. J. Endod. 1995, 21, 349–353. [Google Scholar] [CrossRef]
- Fridland, M.; Rosado, R. Mineral Trioxide Aggregate (MTA) Solubility and Porosity with Different Water-to-Powder Ratios. J. Endod. 2003, 29, 814–817. [Google Scholar] [CrossRef] [Green Version]
- Fridland, M.; Rosado, R. MTA Solubility: A Long Term Study. J. Endod. 2005, 31, 376–379. [Google Scholar] [CrossRef]
- Saidon, J.; He, J.; Zhu, Q.; Safavi, K.; Spångberg, L.S. Cell and tissue reactions to mineral trioxide aggregate and Portland cement. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 2003, 95, 483–489. [Google Scholar] [CrossRef] [Green Version]
- Elmore, S. Apoptosis: A Review of Programmed Cell Death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Harrington, H.A.; Ho, K.L.; Ghosh, S.; Tung, K.C. Construction and analysis of a modular model of caspase activation in apoptosis. Theor. Biol. Med. Model. 2008, 5, 26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Q.; Li, F.; Liu, X.; Li, W.; Shi, W.; Liu, F.F.; O’Sullivan, B.; He, Z.; Peng, Y.; Tan, A.C.; et al. Caspase 3-mediated stimulation of tumor cell repopulation during cancer radiotherapy. Nat. Med. 2011, 17, 860–866. [Google Scholar] [CrossRef]
- Ohsawa, S.; Hamada, S.; Asou, H.; Kuida, K.; Uchiyama, Y.; Yoshida, H.; Miura, M. Caspase-9 Activation Revealed by Semaphorin 7A Cleavage Is Independent of Apoptosis in the Aged Olfactory Bulb. J. Neurosci. 2009, 29, 11385–11392. [Google Scholar] [CrossRef] [PubMed]
- Matsushita, K.; Motani, R.; Sakuta, T.; Yamaguchi, N.; Koga, T.; Matsuo, K.; Nagaoka, S.; Abeyama, K.; Maruyama, I.; Torii, M. The Role of Vascular Endothelial Growth Factor in Human Dental Pulp Cells: Induction of Chemotaxis, Proliferation, and Differentiation and Activation of the AP-1-dependent Signaling Pathway. J. Dent. Res. 2000, 79, 1596–1603. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.G.; Smith, A.J.; Shelton, R.M.; Cooper, P.R. Recruitment of dental pulp cells by dentine and pulp extracellular matrix components. Exp. Cell Res. 2012, 318, 2397–2406. [Google Scholar] [CrossRef] [PubMed]
- Chang, F.; Kim, J.M.; Choi, Y.; Park, K. MTA promotes chemotaxis and chemokinesis of immune cells through distinct calcium-sensing receptor signaling pathways. Biomaterials 2018, 150, 14–24. [Google Scholar] [CrossRef]
- Yang, X.; van der Kraan, P.M.; van den Dolder, J.; Walboomers, X.F.; Bian, Z.; Fan, M.; Jansen, J.A. STRO-1 Selected Rat Dental Pulp Stem Cells Transfected with Adenoviral-Mediated Human Bone Morphogenetic Protein 2 Gene Show Enhanced Odontogenic Differentiation. Tissue Engi. 2007, 13, 2803–2812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohazama, A.; Tucker, A.; Sharpe, P.T. Organized Tooth-specific Cellular Differentiation Stimulated by BMP4. J. Dent. Res. 2005, 84, 603–606. [Google Scholar] [CrossRef]
- Tjäderhane, L.; Koivumäki, S.; Pääkkönen, V.; Ilvesaro, J.; Soini, Y.; Salo, T.; Metsikkö, K.; Tuukkanen, J. Polarity of Mature Human Odontoblasts. J. Dent. Res. 2013, 92, 1011–1016. [Google Scholar] [CrossRef]
- Li, Y.; Lu, X.; Sun, X.; Bai, S.; Li, S.; Shi, J. Odontoblast-like cell differentiation and dentin formation induced with TGF-β1. Arch. Oral Biol. 2011, 56, 1221–1229. [Google Scholar] [CrossRef]
- Tomson, P.L.; Grover, L.M.; Lumley, P.J.; Sloan, A.J.; Smith, A.J.; Cooper, P.R. Dissolution of bio-active dentine matrix components by mineral trioxide aggregate. J. Dent. 2007, 35, 636–642. [Google Scholar] [CrossRef]
- Da Rosa, W.L.O.; Piva, E.; da Silva, A.F. Disclosing the physiology of pulp tissue for vital pulp therapy. Int. Endod. J. 2018, 51, 829–846. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, J.; Xu, L.; Li, K.; Xie, N.; Xi, Y.; Wang, Y.; Zheng, X.; Chen, X.; Wang, M.; Ye, X. Zinc-modified Calcium Silicate Coatings Promote Osteogenic Differentiation through TGF-β/Smad Pathway and Osseointegration in Osteopenic Rabbits. Sci. Rep. 2017, 7, 3440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, Y.; Duan, J.; Li, Y.; Li, Y.; Jing, L.; Yang, M.; Wang, J.; Sun, Z. Silica nanoparticles induce liver fibrosis via TGF-β1/Smad3 pathway in ICR mice. Int. J. Nanomed. 2017, 12, 6045–6057. [Google Scholar] [CrossRef] [Green Version]
- Hirschhaeuser, F.; Menne, H.; Dittfeld, C.; West, J.; Mueller-Klieser, W.; Kunz-Schughart, L.A. Multicellular tumor spheroids: An underestimated tool is catching up again. J. Biotechnol. 2010, 148, 3–15. [Google Scholar] [CrossRef] [PubMed]
- Anada, T.; Fukuda, J.; Sai, Y.; Suzuki, O. An oxygen-permeable spheroid culture system for the prevention of central hypoxia and necrosis of spheroids. Biomaterials 2012, 33, 8430–8441. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Nancollas, G.H. Calcium Orthophosphates: Crystallization and Dissolution. Chem. Rev. 2008, 108, 4628–4669. [Google Scholar] [CrossRef] [Green Version]
- Kuratate, M.; Shigetani, Y.; Han, L.; Okiji, T. Compositional Change of Mineral Trioxide Aggregate Immersed in Water: Alteration of Elemental Distribution in the Surface Layer. Jpn. J. Coservative Dent. 2009, 52, 348–354. [Google Scholar]
- Sloan, A.J.; Rutherford, R.B.; Smith, A.J. Stimulation of the rat dentine–pulp complex by bone morphogenetic protein-7 in vitro. Arch. Oral Biol. 2000, 45, 173–177. [Google Scholar] [CrossRef]
- Chen, S.; Gu, T.T.; Sreenath, T.; Kulkarni, A.B.; Karsenty, G.; MacDougall, M. Spatial Expression of Cbfa1/Runx2 Isoforms in Teeth and Characterization of Binding Sites in the DSPP Gene. Connect. Tissue Res. 2002, 43, 338–344. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hattori-Sanuki, T.; Karakida, T.; Chiba-Ohkuma, R.; Miake, Y.; Yamamoto, R.; Yamakoshi, Y.; Hosoya, N. Characterization of Living Dental Pulp Cells in Direct Contact with Mineral Trioxide Aggregate. Cells 2020, 9, 2336. https://doi.org/10.3390/cells9102336
Hattori-Sanuki T, Karakida T, Chiba-Ohkuma R, Miake Y, Yamamoto R, Yamakoshi Y, Hosoya N. Characterization of Living Dental Pulp Cells in Direct Contact with Mineral Trioxide Aggregate. Cells. 2020; 9(10):2336. https://doi.org/10.3390/cells9102336
Chicago/Turabian StyleHattori-Sanuki, Tamaki, Takeo Karakida, Risako Chiba-Ohkuma, Yasuo Miake, Ryuji Yamamoto, Yasuo Yamakoshi, and Noriyasu Hosoya. 2020. "Characterization of Living Dental Pulp Cells in Direct Contact with Mineral Trioxide Aggregate" Cells 9, no. 10: 2336. https://doi.org/10.3390/cells9102336
APA StyleHattori-Sanuki, T., Karakida, T., Chiba-Ohkuma, R., Miake, Y., Yamamoto, R., Yamakoshi, Y., & Hosoya, N. (2020). Characterization of Living Dental Pulp Cells in Direct Contact with Mineral Trioxide Aggregate. Cells, 9(10), 2336. https://doi.org/10.3390/cells9102336