Reconstitution of the Jasmonate Signaling Pathway in Plant Protoplasts
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Conditions
2.2. Construction of Recombinant Plasmids
2.3. Protoplasts Preparation and Transfection
2.4. Dual Luciferase Report Assay
2.5. Western Blot Analysis
3. Results and Discussion
3.1. COI1-Mediated JAZ1 Protein Degradation in Arabidopsis Protoplast Cells
3.2. COI1-Mediated JAZ1 Protein Degradation in Protoplasts Requires Jasmonic Acid
3.3. COI1 Releases JAZ1-Repressed MYC2 Transcriptional Activity
3.4. JAZ1 Promoter Activity is Activated by an Exogenous JA Mimic and COI1 in Protoplasts
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zhu, J.-K. Abiotic Stress Signaling and Responses in Plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef] [PubMed]
- Ku, Y.-S.; Sintaha, M.; Cheung, M.-Y.; Lam, H.-M. Plant Hormone Signaling Crosstalks between Biotic and Abiotic Stress Responses. Int. J. Mol. Sci. 2018, 19, 3206. [Google Scholar] [CrossRef] [PubMed]
- VanWallendael, A.; Soltani, A.; Emery, N.C.; Peixoto, M.M.; Olsen, J.; Lowry, D.B. A Molecular View of Plant Local Adaptation: Incorporating Stress-Response Networks. Annu. Rev. Plant Biol. 2019, 70, 559–583. [Google Scholar] [CrossRef] [PubMed]
- Wasternack, C.; Hause, B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann. Bot. 2013, 111, 1021–1058. [Google Scholar] [CrossRef] [PubMed]
- Goossens, J.; Fernández-Calvo, P.; Schweizer, F.; Goossens, A. Jasmonates: Signal transduction components and their roles in environmental stress responses. Plant Mol. Biol. 2016, 91, 673–689. [Google Scholar] [CrossRef] [PubMed]
- Wasternack, C.; Strnad, M. Jasmonates: News on Occurrence, Biosynthesis, Metabolism and Action of an Ancient Group of Signaling Compounds. Int. J. Mol. Sci. 2018, 19, 2539. [Google Scholar] [CrossRef]
- Howe, G.A.; Major, I.T.; Koo, A.J. Modularity in Jasmonate Signaling for Multistress Resilience. Annu. Rev. Plant Biol. 2018, 69, 387–415. [Google Scholar] [CrossRef]
- Wasternack, C.; Feussner, I. The Oxylipin Pathways: Biochemistry and Function. Annu. Rev. Plant Biol. 2018, 69, 363–386. [Google Scholar] [CrossRef]
- Schaller, F.; Schaller, A.; Stintzi, A. Biosynthesis and Metabolism of Jasmonates. J. Plant Growth Regul. 2004, 23, 179–199. [Google Scholar] [CrossRef]
- Schaller, A.; Stintzi, A. Enzymes in jasmonate biosynthesis—Structure, function, regulation. Phytochemistry 2009, 70, 1532–1538. [Google Scholar] [CrossRef]
- Staswick, P.E.; Tiryaki, I. The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 2004, 16, 2117–2127. [Google Scholar] [CrossRef] [PubMed]
- Fonseca, S.; Chini, A.; Hamberg, M.; Adie, B.; Porzel, A.; Kramell, R.; Miersch, O.; Wasternack, C.; Solano, R. (+)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nat. Chem. Biol. 2009, 5, 344–350. [Google Scholar] [CrossRef] [PubMed]
- Gfeller, A.; Liechti, R.; Farmer, E.E. Arabidopsis jasmonate signaling pathway. Sci Signal. 2010, 3, cm4. [Google Scholar] [CrossRef] [PubMed]
- Wasternack, C.; Song, S. Jasmonates: Biosynthesis, metabolism, and signaling by proteins activating and repressing transcription. J. Exp. Bot. 2017, 68, 1303–1321. [Google Scholar] [CrossRef]
- Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic Acid Signaling Pathway in Plants. Int. J. Mol. Sci. 2019, 20, 2479. [Google Scholar] [CrossRef]
- Katsir, L.; Schilmiller, A.L.; Staswick, P.E.; He, S.Y.; Howe, G.A. COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc. Natl. Acad. Sci. USA 2008, 105, 7100–7105. [Google Scholar] [CrossRef]
- Yan, J.; Zhang, C.; Gu, M.; Bai, Z.; Zhang, W.; Qi, T.; Cheng, Z.; Peng, W.; Luo, H.; Nan, F.; et al. The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell 2009, 21, 2220–2236. [Google Scholar] [CrossRef]
- Sheard, L.B.; Tan, X.; Mao, H.; Withers, J.; Ben-Nissan, G.; Hinds, T.R.; Kobayashi, Y.; Hsu, F.-F.; Sharon, M.; Browse, J.; et al. Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature 2010, 468, 400–405. [Google Scholar] [CrossRef]
- Chen, L.; Hellmann, H. Plant E3 ligases: Flexible enzymes in a sessile world. Mol. Plant 2013, 6, 1388–1404. [Google Scholar] [CrossRef]
- Thines, B.; Katsir, L.; Melotto, M.; Niu, Y.; Mandaokar, A.; Liu, G.; Nomura, K.; He, S.Y.; Howe, G.A.; Browse, J. JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature 2007, 448, 661–665. [Google Scholar] [CrossRef]
- Chini, A.; Fonseca, S.; Fernández, G.; Adie, B.; Chico, J.M.; Lorenzo, O.; García-Casado, G.; López-Vidriero, I.; Lozano, F.M.; Ponce, M.R.; et al. The JAZ family of repressors is the missing link in jasmonate signalling. Nature 2007, 448, 666–671. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, L.; Barbero, G.F.; Geerinck, J.; Tilleman, S.; Grunewald, W.; Pérez, A.C.; Chico, J.M.; Bossche, R.V.; Sewell, J.; Gil, E.; et al. NINJA connects the co-repressor TOPLESS to jasmonate signalling. Nature 2010, 464, 788–791. [Google Scholar] [CrossRef] [PubMed]
- Staswick, P.E. JAZing up jasmonate signaling. Trends Plant. Sci. 2008, 13, 66–71. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, L.; Goossens, A. The JAZ proteins: A crucial interface in the jasmonate signaling cascade. Plant Cell 2011, 23, 3089–3100. [Google Scholar] [CrossRef]
- Acosta, I.F.; Gasperini, D.; Chételat, A.; Stolz, S.; Santuari, L.; Farmer, E.E. Role of NINJA in root jasmonate signaling. Proc. Natl. Acad. Sci. USA 2013, 110, 15473–15478. [Google Scholar] [CrossRef]
- Kazan, K.; Manners, J.M. JAZ repressors and the orchestration of phytohormone crosstalk. Trends Plant Sci. 2012, 17, 22–31. [Google Scholar] [CrossRef]
- Bowler, C.; Chua, N.H. Emerging themes of plant signal transduction. Plant Cell 1994, 6, 1529–1541. [Google Scholar]
- McCarty, D.R.; Chory, J. Conservation and innovation in plant signaling pathways. Cell 2000, 103, 201–209. [Google Scholar] [CrossRef]
- Sheen, J. Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant Physiol. 2001, 127, 1466–1475. [Google Scholar] [CrossRef]
- Yoo, S.-D.; Cho, Y.-H.; Sheen, J. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2007, 2, 1565–1572. [Google Scholar] [CrossRef]
- von Malek, B.; van der Graaff, E.; Schneitz, K.; Keller, B. The Arabidopsis male-sterile mutant dde2-2 is defective in the ALLENE OXIDE SYNTHASE gene encoding one of the key enzymes of the jasmonic acid biosynthesis pathway. Planta 2002, 216, 187–192. [Google Scholar] [CrossRef] [PubMed]
- Mosblech, A.; Thurow, C.; Gatz, C.; Feussner, I.; Heilmann, I. Jasmonic acid perception by COI1 involves inositol polyphosphates in Arabidopsis thaliana. Plant J. 2011, 65, 949–957. [Google Scholar] [CrossRef] [PubMed]
- Köster, J.; Thurow, C.; Kruse, K.; Meier, A.; Iven, T.; Feussner, I.; Gatz, C. Xenobiotic- and jasmonic acid-inducible signal transduction pathways have become interdependent at the Arabidopsis CYP81D11 promoter. Plant Physiol. 2012, 159, 391–402. [Google Scholar] [CrossRef] [PubMed]
- Reymond, P.; Weber, H.; Damond, M.; Farmer, E.E. Differential gene expression in response to mechanical wounding and insect feeding in Arabidopsis. Plant Cell 2000, 12, 707–720. [Google Scholar] [CrossRef] [PubMed]
- Karimi, M.; De Meyer, B.; Hilson, P. Modular cloning in plant cells. Trends Plant Sci. 2005, 10, 103–105. [Google Scholar] [CrossRef]
- Uhrig, J.F.; Huang, L.-J.; Barghahn, S.; Willmer, M.; Thurow, C.; Gatz, C. CC-type glutaredoxins recruit the transcriptional co-repressor TOPLESS to TGA-dependent target promoters in Arabidopsis thaliana. Biochim. Biophys. Acta Gene Regul. Mech. 2017, 1860, 218–226. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Muthreich, M.; Huang, L.-J.; Thurow, C.; Sun, T.; Zhang, Y.; Gatz, C. TGACG-BINDING FACTORs (TGAs) and TGA-interacting CC-type glutaredoxins modulate hyponastic growth in Arabidopsis thaliana. New Phytol. 2019, 221, 1906–1918. [Google Scholar] [CrossRef]
- Zander, M.; Chen, S.; Imkampe, J.; Thurow, C.; Gatz, C. Repression of the Arabidopsis thaliana jasmonic acid/ethylene-induced defense pathway by TGA-interacting glutaredoxins depends on their C-terminal ALWL motif. Mol. Plant 2012, 5, 831–840. [Google Scholar] [CrossRef]
- Grefen, C.; Donald, N.; Hashimoto, K.; Kudla, J.; Schumacher, K.; Blatt, M.R. A ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies. Plant J. 2010, 64, 355–365. [Google Scholar] [CrossRef]
- Melotto, M.; Mecey, C.; Niu, Y.; Chung, H.S.; Katsir, L.; Yao, J.; Zeng, W.; Thines, B.; Staswick, P.; Browse, J.; et al. A critical role of two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins in mediating coronatine- and jasmonoyl isoleucine-dependent interactions with the COI1 F-box protein. Plant J. 2008, 55, 979–988. [Google Scholar] [CrossRef]
- Park, J.-H.; Halitschke, R.; Kim, H.B.; Baldwin, I.T.; Feldmann, K.A.; Feyereisen, R. A knock-out mutation in allene oxide synthase results in male sterility and defective wound signal transduction in Arabidopsis due to a block in jasmonic acid biosynthesis. Plant J. 2002, 31, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Santner, A.; Estelle, M. Recent advances and emerging trends in plant hormone signalling. Nature 2009, 459, 1071–1078. [Google Scholar] [CrossRef] [PubMed]
- Nagels Durand, A.; Pauwels, L.; Goossens, A. The Ubiquitin System and Jasmonate Signaling. Plants 2016, 5, 6. [Google Scholar] [CrossRef] [PubMed]
- Choi, C.M.; Gray, W.M.; Mooney, S.; Hellmann, H. Composition, roles, and regulation of cullin-based ubiquitin e3 ligases. Arabidopsis Book 2014, 12, e0175. [Google Scholar] [CrossRef]
- Gutsche, N.; Thurow, C.; Zachgo, S.; Gatz, C. Plant-specific CC-type glutaredoxins: Functions in developmental processes and stress responses. Biol. Chem. 2015, 396, 495–509. [Google Scholar] [CrossRef]
- Mou, Z.; Fan, W.; Dong, X. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 2003, 113, 935–944. [Google Scholar] [CrossRef]
- Koornneef, A.; Leon-Reyes, A.; Ritsema, T.; Verhage, A.; Den Otter, F.C.; Van Loon, L.C.; Pieterse, C.M.J. Kinetics of salicylate-mediated suppression of jasmonate signaling reveal a role for redox modulation. Plant Physiol. 2008, 147, 1358–1368. [Google Scholar] [CrossRef]
- Kazan, K.; Manners, J.M. MYC2: The master in action. Mol. Plant 2013, 6, 686–703. [Google Scholar] [CrossRef]
- Santner, A.; Estelle, M. The JAZ proteins link jasmonate perception with transcriptional changes. Plant Cell 2007, 19, 3839–3842. [Google Scholar] [CrossRef]
- Çevik, V.; Kidd, B.N.; Zhang, P.; Hill, C.; Kiddle, S.; Denby, K.J.; Holub, E.B.; Cahill, D.M.; Manners, J.M.; Schenk, P.M.; et al. MEDIATOR25 acts as an integrative hub for the regulation of jasmonate-responsive gene expression in Arabidopsis. Plant Physiol. 2012, 160, 541–555. [Google Scholar] [CrossRef]
- Zhai, Q.; Li, C. The plant Mediator complex and its role in jasmonate signaling. J. Exp. Bot. 2019, 70, 3415–3424. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, L.; Goossens, A. Fine-tuning of early events in the jasmonate response. Plant. Signal. Behav. 2008, 3, 846–847. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Figueroa, P.; Browse, J. The Arabidopsis JAZ2 promoter contains a G-Box and thymidine-rich module that are necessary and sufficient for jasmonate-dependent activation by MYC transcription factors and repression by JAZ proteins. Plant Cell Physiol. 2012, 53, 330–343. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Yao, J.; Ke, J.; Zhang, L.; Lam, V.Q.; Xin, X.-F.; Zhou, X.E.; Chen, J.; Brunzelle, J.; Griffin, P.R.; et al. Structural basis of JAZ repression of MYC transcription factors in jasmonate signalling. Nature 2015, 525, 269–273. [Google Scholar] [CrossRef] [PubMed]
- Ulmasov, T.; Murfett, J.; Hagen, G.; Guilfoyle, T.J. Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 1997, 9, 1963–1971. [Google Scholar] [PubMed]
- Worley, C.K.; Zenser, N.; Ramos, J.; Rouse, D.; Leyser, O.; Theologis, A.; Callis, J. Degradation of Aux/IAA proteins is essential for normal auxin signalling. Plant J. 2000, 21, 553–562. [Google Scholar] [CrossRef]
- Ramos, J.A.; Zenser, N.; Leyser, O.; Callis, J. Rapid Degradation of Auxin/Indoleacetic Acid Proteins Requires Conserved Amino Acids of Domain II and Is Proteasome Dependent. Plant Cell 2001, 13, 2349–2360. [Google Scholar] [CrossRef]
- Dharmasiri, N.; Dharmasiri, S.; Jones, A.M.; Estelle, M. Auxin action in a cell-free system. Curr. Biol. 2003, 13, 1418–1422. [Google Scholar] [CrossRef]
- Fujii, H.; Chinnusamy, V.; Rodrigues, A.; Rubio, S.; Antoni, R.; Park, S.-Y.; Cutler, S.R.; Sheen, J.; Rodriguez, P.L.; Zhu, J.-K. In vitro reconstitution of an abscisic acid signalling pathway. Nature 2009, 462, 660–664. [Google Scholar] [CrossRef]
- Ruschhaupt, M.; Mergner, J.; Mucha, S.; Papacek, M.; Doch, I.; Tischer, S.V.; Hemmler, D.; Chiasson, D.; Edel, K.H.; Kudla, J.; et al. Rebuilding core abscisic acid signaling pathways of Arabidopsis in yeast. EMBO J. 2019, 38, e101859. [Google Scholar] [CrossRef]
Primer Symbol | Primer Sequence (5′-3′) |
---|---|
JAZ1-gw-d1 | GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGTCGAGTTCTATGGAATG |
JAZ1ohnestop-gw-r1 | GGGGACCACTTTGTACAAGAAAGCTGGGTGATATTTCAGCTGCTAAACCG |
JAZ1mitstop-gw-r1 | GGGGACCACTTTGTACAAGAAAGCTGGGTGATCATATTTCAGCTGCTAAACCG |
mJAZ1-d1 | ACTTCCTATTGCTGCAGCAGCTTCAC |
mJAZ1-r1 | GTGAAGTGAAGCTGCTGCAGCAATAG |
JAZ1ΔTIFY-d1 | GTCTCAAACTGCACCATTGGCCGGGCAAGTGATTG |
JAZ1ΔTIFY-r1 | CAATCACTTGCCCGGCCAATGGTGCAGTTTGAGAC |
COI1-gw-d1 | GGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGAGGATCCTGATATCAAGAGGTGT |
COI1mitstop-gw-r1 | GGGGACCACTTTGTACAAGAAAGCTGGGTCTCATATTGGCTCCTTCAGGACTC |
mCOI1-d1 | AGCTAGAATCGGTTCTCTACTTCTGCTCAGATATAACTAACGAATCTCTTGAAAG |
mCOI1-r1 | CTGAGCAGAAGTAGAGAACCGATTCTAGCTCCTGGCAGCCCTGAG |
COI1SC-d1 | GCTAGAGATGAGAGGTTCTTGCTTCAGTGAGCGAGCAAT |
COI1CS-d1 | GCTAGAGATGAGAGGTTGTTCCTTCAGTGAGCGAGCAAT |
COI1SS-d1 | GCTAGAGATGAGAGGTTCTTCCTTCAGTGAGCGAGCAAT |
COI1CC-r1 | AACCTCTCATCTCTAGCTTCTG |
JAZ1pro-gw-d1 | GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCGCATAACAACAAAAACGTGG |
JAZ1pro-gw-r1 | GGGGACCACTTTGTACAAGAAAGCTGGGTGACATCTTTAACAATTAAAACTTTCAAAC |
SeqL1 | TCGCGTTAACGCTAGCATGGATCTC |
SeqL2 | GTAACATCAGAGATTTTGAGACAC |
attB1-ad | GGGGACAAGTTTGTACAAAAAAGCAGGCT |
attB2-ad | GGGGACCACTTTGTACAAGAAAGCTGGGT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, N.; Uhrig, J.F.; Thurow, C.; Huang, L.-J.; Gatz, C. Reconstitution of the Jasmonate Signaling Pathway in Plant Protoplasts. Cells 2019, 8, 1532. https://doi.org/10.3390/cells8121532
Li N, Uhrig JF, Thurow C, Huang L-J, Gatz C. Reconstitution of the Jasmonate Signaling Pathway in Plant Protoplasts. Cells. 2019; 8(12):1532. https://doi.org/10.3390/cells8121532
Chicago/Turabian StyleLi, Ning, Joachim F. Uhrig, Corinna Thurow, Li-Jun Huang, and Christiane Gatz. 2019. "Reconstitution of the Jasmonate Signaling Pathway in Plant Protoplasts" Cells 8, no. 12: 1532. https://doi.org/10.3390/cells8121532
APA StyleLi, N., Uhrig, J. F., Thurow, C., Huang, L.-J., & Gatz, C. (2019). Reconstitution of the Jasmonate Signaling Pathway in Plant Protoplasts. Cells, 8(12), 1532. https://doi.org/10.3390/cells8121532