Expression of Human CEACAM Receptors Promotes Inflammation and Organ Damage During Systemic Candida albicans Infection in Mice

Highlights

What are the main findings?

• In a murine C. albicans infection model, transgenic CEABAC10 mice expressing human CEACAM family receptors exhibited heightened systemic inflammation and reduced survival.
• In vivo and in vitro analyses indicated that expression of human CEACAM6 on monocytes in CEABAC10 mice led to elevated cytokine production and enhanced neutrophil recruitment, resulting in exacerbated inflammation and decreased survival.

What are the implications of the main findings?

• This study provides the first evidence that expression of human CEACAM6 on monocytes and macrophages in transgenic CEABAC10 mice plays a critical role in regulating host immune responses to (fungal) pathogens.
• During C. albicans infection, the expression of human CEACAM3 and CEACAM6 on murine neutrophils did not directly influence neutrophil responses.

Abstract

Invasive candidiasis is a fungal infection characterized by a high mortality rate. Carcinoembryonic antigen-related cell adhesion molecule (CEACAM) family receptors play a crucial role in regulating innate responses of both leukocytes and epithelia. Human CEACAM3, CEACAM5 and CEACAM6 receptors recognize Candida albicans and are expressed in transgenic CEABAC10 mice. In a murine C. albicans infection model, CEABAC10 mice exhibited a shortened survival period attributed to an early cytokine storm, an exacerbated acute phase response, and heightened systemic inflammation compared to their wild-type littermates. The livers and kidneys of CEABAC10 mice displayed intensified purulent necrotizing inflammation, accompanied by increased infiltration of neutrophils and macrophages. Our in vivo and in vitro data indicated that the expression of CEACAM6 on monocytes of CEABAC10 mice caused the elevated cytokine levels and the subsequent exacerbation of the acute phase response upon C. albicans infection, resulting in decreased survival.

1. Introduction

The fungal pathogen Candida albicans (C. albicans) is a predominant cause of human Candida bloodstream infections, associated with elevated mortality rates [1,2]. The incidence of systemic candidiasis is on the rise, particularly among patients with high-risk factors such as prior antibiotic exposure, chemotherapy, hematopoietic stem cell transplantation, prolonged intensive care requirements due to other medical conditions, and the use of central venous catheters [3].

Host defense against systemic candidiasis relies on the crucial role of myeloid phagocytes, including neutrophils, inflammatory monocytes, and tissue-resident macrophages [2]. The initial phase of their interaction with the fungus involves the fundamental step of fungal recognition, which mounts the inflammatory response against the invading fungus, orchestrates pathogen uptake and systemic inflammatory responses during blood stream infections.

In addition to pattern recognition receptors [4,5], C. albicans is recognized by members of the human CEACAM receptor family, namely, CEACAM1, CEACAM3, CEACAM5, and CEACAM6 [6]. CEACAM1 and CEACAM3 are modulatory receptors that signal via their intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM) and immunoreceptor tyrosine-based activation motif (ITAM), respectively. CEACAM5 and CEACAM6 are GPI-anchored and organized in membrane microdomains [7,8]. The well-described immunoregulatory function of CEACAM1 is complemented by the impact of CEACAM3, CEACAM5, and CEACAM6 on immune reactions across a diverse array of cell types [9,10,11,12,13]. In vitro data indicate immunoregulatory roles for human CEACAM1 and CEACAM6 in the innate immune response of human intestinal epithelial cells and human neutrophils triggered by C. albicans stimulation [6,14]. However, the expression of human CEACAM1 in transgenic mice had no discernible effect on their susceptibility to systemic candidiasis or on C. albicans colonization/dissemination [15].

Similar to its human homolog, mouse CEACAM1 serves as a receptor for host-specific pathogens, such as the murine hepatitis virus (MHV) [16], and possesses regulatory functions in immune responses across diverse cell types, both in vivo and in vitro [17,18]. However, mouse CEACAM1 does not bind to C. albicans cell surface structures [6]. Notably, mice lack the homologous genes for CEACAM3, CEACAM5, and CEACAM6 receptors [19].

Chan and Stanners developed CEABAC10 mice transgenic for human CEACAM3, CEACAM5, CEACAM6, and CEACAM7, including the human promotor region [20]. The extensive epithelial expression of CEACAM5 and CEACAM6 on the surface of various mucosal tissues in CEABAC10 mice, including the intestinal tract, closely mirrors their expression in humans [20]. While CEACAM5 is specifically expressed on apical membranes of epithelial cells, CEACAM6 is also present on immune cells, including neutrophils, alongside the neutrophil-specific CEACAM3 [20]. Notably, CEACAM7 does not bind to C. albicans and is selectively expressed in a limited number of highly differentiated epithelial cells in the colon [6,20]. The CEABAC10 mouse model is widely employed for analyzing CEACAM receptor functions in the host’s response to infections with human pathogens. It provided crucial insight into the role of CEACAM6 in conjunction with adhering-invasive E. coli (AIEC) in Crohn’s disease pathology in vivo [21,22], and it has contributed valuable information regarding the involvement of CEACAM receptors in the neutrophil response to Neisseria gonorrhea in vitro [23]. To date, to our knowledge, only local bacterial infections, no systemic infections, have been studied in CEABAC10 mice.

While many studies underline the importance of CEACAM5 and CEACAM6 in malignancies [24] and increasing evidence is available for bacterial infections [25], their interaction with C. albicans has been studied so far only in vitro [6,14]. Also, CEACAM6 on mononuclear phagocytes has been poorly analyzed until now. Early publications indicated the expression of CEACAM6 on human monocytic cells and tissue macrophages [26,27,28], but these studies were conducted with antibodies recognizing several human CEACAM receptors, including CEACAM1. No studies on mononuclear phagocytes derived from CEABAC10 mice have been conducted until now. In the present study, we used the CEABAC10 mouse model to investigate the impact of CEACAM3, CEACAM5, and CEACAM6 on disseminated candidiasis in vivo [15,24,29]. The presence of CEACAMs led to severe infection pathology, a heightened IL-6-mediated acute phase response, and early death in candidemic CEABAC10 mice. Through in vitro experiments employing primary bone marrow-derived myeloid cells, we found that CEACAM3 expression did not affect inflammatory responses, and we identified CEACAM6⁺ classical monocytes and resident macrophages as the cell populations responsible for the hyperinflammatory response to systemic C. albicans infection in CEABAC10 mice. These findings suggest that CEACAM6 may play a previously unknown role in the inflammatory response of mononuclear phagocytes during systemic candidiasis.

2. Materials and Methods

C. albicans strain and culture: C. albicans Berkhout strain SC5314 was used for all experiments and was grown as described [15]. In some cases, germ tubes were induced as described [15]. For FITC labelling, 10 × 10⁷ yeast cells were suspended in 10 mL carbonate buffer (pH 9.5; 70% sodium bicarbonate, 30% sodium carbonate) and 100 µL of a FITC stock solution (10 mg/mL in PBS) and incubated for one hour at 23 °C, 150 rpm, in the dark. Labeled yeast cells were washed twice with PBS.

Mouse strains: FVB mice transgenic for the human CEACAM3, -5, -6, and -7 genes, CEABAC10 [20], were crossed into the C57BL/6NRj background using Speed Congenics. The status of the background was supervised by GVG Genetic Monitoring (Leipzig, Germany). Mice were bred heterozygous, and a minimum of 12 backcrosses were performed prior to the first experiment. The genotypes (CEABAC10^+/− or wild type) were determined by PCR analysis of tail biopsies using the following primer pairs for the transgenic human CEACAMs (5′–3′): CEACAM3 (AACCCCAGGACAGCAGCTTC and GAGAGGCCTTTGTCCTGACC), CEACAM5 (CATTTGCAACAGCTACAGTC and AGTGCAGTGGTATCAGAAAC), CEACAM6 (TACTCAGCGTCAAAAGGAAC and AGAGACGTGGATCATCATCGTGA), and CEACAM7 (TGATCCTCCTGATTGTCACA CTACTGGGCAATACAACAGT). Mouse interferon beta primers ATAAGCAGCTCCAGCTCCAA and GCAACCACCACTCATTCTGA were used as a positive control. Wild-type littermates were co-housed and used as controls. Mice were maintained under specific pathogen-free conditions at the animal facility Forschungszentrum Beutenberg, Zentrale Experimentelle Tierhaltung, University Hospital Jena, Germany, according to European and German animal welfare regulations.

Systemic C. albicans infection was performed as described previously [15]. Briefly, co-housed male and female CEABAC10-transgenic mice (CEA) and their wild-type littermates (WT) (at least 10 weeks old and weighing at least 16 g) were injected with 2.5 × 10⁴ CFU C. albicans/g body weight or 1 × 10⁴ CFU C. albicans/g body weight via the lateral tail vein. After the infection, mice were scored at least twice a day and sacrificed when they reached a humane endpoint, as described in [15]. Log rank comparison of the survival curves was performed with the GraphPad PRISM software version 5. For analyses at pre-defined time points after infection, mice were infected as described above with 1 × 10⁴ CFU C. albicans/g body weight (“Ca”). Control mice received endotoxin-free buffered saline solution (“PBS”; InVivoPure pH 6.5 Dilution Buffer, Hoelzel Diagnostika GmbH, Köln, Germany; vehicle control). After infection, the health status of the mice was examined as described in [15], and the mice were sacrificed after 24 h (PBS and Ca) or 72 h (Ca). Since the vehicle control, PBS, does not result in any immune reaction [15] and any reaction due to the stress of the application would be only short-lived, no additional PBS group was analyzed at 72 h. Note that one PBS-injected CEABAC10 mouse was removed from all analyses after histological analysis identified a high-grade hydronephrosis with associated, presumably ascending pyelonephritis that was not associated with the experiment.

Post-mortem analyses: When the mice reached deep anesthesia, blood was taken retro-orbitally and analyzed in an automated hemocytometer (Mindray 5300Vet Hematology Analyzer, Mindray, Darmstadt, Germany). Peripheral blood for the determination of cytokine levels and glycoproteome analysis (see below) was obtained via cardiac puncture, kept at room temperature for 1 h and centrifuged at 1500× g for 15 min without break in order to obtain serum. Aliquots were kept at −80 °C until further analysis. During necropsy, the kidneys, spleen, liver, and brain were removed, weighed and either fixed immediately in Roti Histofix 4% (Carl Roth GmbH, Karlsruhe, Germany) and transferred into ethanol the next day or kept on ice in 1–3 mL PBS until homogenization. For pathohistological analysis, a representative section from all organs was stained with hematoxylin and eosin and evaluated histopathologically. For visualization of fungal structures, a PAS reaction and Grocott methenamine silver staining were performed. Histological preparations were digitalized with an Aperio CS2 (Whole Slide Scanner, Leica, Wetzlar, Germany), and the size, area, and numbers of inflammatory foci in the kidneys were quantified using the Image-Scope software (Leica, Wetzlar, Germany). For development, validation, evaluation, and statistical analysis, all embedded in the visual programming language JIPipe [30] “https://jipipe.hki-jena.de/” (accessed on 18 November 2021), where the automated image processing of C. albicans in mouse kidneys was realized using deep learning, please refer to the Supplementary Methods. DAB (3, 3′-diaminobenzidine) immunohistochemistry on paraffin sections was performed after dewaxing (3 × xylol, 100% ethanol, 96% ethanol, 70% ethanol, distilled water, 10 min), followed by citrate buffer, pH 6.0, at 96 °C for 30 min. After cooling, sections were washed with PBS and blocked with 1% BSA/PBS. Consecutive sections were incubated with 10 µg/mL 1H7-4B, anti-NE (neutrophil elastase) antibody (Abcam, ab68672, Abcam/Danaher, Cambridge, UK), and IgG control antibody (BioGenex, Rabbit NEGATIVE CONTROL, Biogenex, Fremont, CA, USA), followed by goat-anti-rabbit-Conjugate (Vector, VEC-BA-1000, Biozol, Hamburg, Germany), and developed using DAB (Carl Roth GmbH, Karlsruhe, Germany). CFUs were determined by plating dilutions of organ homogenates on yeast extract–peptone–dextrose (YPD) agar plates with 80 µg/mL chloramphenicol. The detection limits were as follows: 50 CFU/g kidneys and liver; 100 CFU/g spleen; 85 CFU/g brain. For Multiplex analysis (Cytokine Mouse Magnetic 20-Plex Panel for the Luminex platform, Thermo Fischer GmbH, Darmstadt, Germany) or ELISA (mouse IL-6, IL-1β and TNF-A Ready Set Go, both eBioscience/Thermo Fischer GmbH, Darmstadt, Germany; mouse IFNγ, BD Biosciences, Heidelberg, Germany), homogenates were centrifuged immediately at 3000× g, 4 °C, for 10 min and aliquots of supernatants were kept at −80 °C until analysis. For analysis of bone marrow cells, femurs were removed and kept in PBS on ice until the cell isolation procedures. The expression of human CEACAMs in bone marrow-derived leukocytes fixed in 4% PFA/PBS was determined by flow cytometry. Cells were blocked in 500 µL of 10% BSA/PBS overnight at 4 °C, treated with 1:30 mouse Fc block (eBioscience/Thermo Fischer GmbH, Darmstadt, Germany) for 30 min at 4 °C, and stained and analyzed as described in the Respective (Supplemental) Figure Legends with the following antibodies and the corresponding isotype controls: Ly6C PE-Cy 7, Ly6G-APC, huCD66acde-PE (all REA, Miltenyi Biotec Bergisch Gladbach, Germany), B220 PerCP-Cy 5.5, CD3-APC (both eBioscience). Samples were analyzed on an Attune Acoustic Focusing Cytometer (Life Technologies, Thermo Fisher Scientific, Darmstadt, Germany) using the FlowJo software version 10.0.6. The expression of human CEACAMs in viable immune cell populations isolated from the kidneys, liver, and spleen was determined by flow cytometry. Cells were stained and analyzed on an Attune Acoustic Focusing Cytometer (Life Technologies, Thermo Fisher Scientific, Darmstadt, Germany) using the Attune software v2.1, as described in the respective figure legends with the following antibodies or the corresponding isotype controls: CD45-PE, Ly-6G-PerCP-Vio700, CD3ε-PE-Vio770, CD19-APC, F4/80-FITC, CD45-PE, CD11c-PE-Vio770, CD335-APC (all REA, Miltenyi Biotec, Bergisch Gladbach, Germany), and viability dye eFluor780 (eBioscience/Thermo Fischer GmbH, Darmstadt, Germany).

Glycoproteome analysis. Glycoprotein enrichment from serum: After thawing, 20 µL serum was added to 20 µL 4% SDS in PBS and heated for 5 min at 95 °C. After cooling to room temperature, 60 µL of PBS was added and the mixture was centrifuged at 20,000× g for 10 min at RT. The supernatant was used to enrich for glycoproteins as described in [31]. Trypsin-released peptides and PNGase F-released N-glycopeptides were collected and dried in a SpeedVac (Thermo Scientific, Darmstadt, Germany). Shotgun MS proteomics: Samples were reconstituted in 0.3% formic acid and peptide concentrations were measured using a NanoDrop spectrometer (Thermo Fisher Scientific, Darmstadt, Germany). Then, 2.5 µg each of tryptic and deglycosylated peptides (former N-glycopeptides) was analyzed in each LC-MS/MS run in duplicates on an Orbitrap Fusion (Thermo Scientific) coupled to a Dionex Ultimate 3000 (Thermo Scientific) by a nanoelectrospray ion source. Samples were loaded on a 2 cm C18 trap column (Acclaim PepMap100, Thermo Scientific) and separated using a 2.5 h non-linear gradient (2–80% acetonitrile/0.1% formic acid, flow rate: 300 nL/min) on a 50 cm C18 analytical column (75 µm i.d., PepMap RSLC, Thermo Scientific). Full MS scans were acquired with a resolution of 120,000 at m/z 400 in the Orbitrap analyzer (m/z range: 370–1570, quadrupole isolation, isolation window: 1.6). MS1 parent ions were fragmented by higher-energy collisional dissociation (HCD, 30% collision energy) and 20 fragment ion spectra were acquired in the ion trap in rapid mode. The following conditions were used: a spray voltage of 2.0 kV, a heated capillary temperature of 275 °C, an S-lens RF level of 60%, and maximum ion accumulation times of 50 ms (AGC 1 × 106) for full scans and 35 ms (AGC 1 × 104) for HCD. Protein identification and quantification: All RAW files were searched against the human UniProt database (version 05.2016, reviewed sequences) with MaxQuant version 1.5.5.1 (Max Planck Institute of Biochemistry) [32]. The parameters were set as follows: main search peptide tolerance: 4.5 ppm; enzyme: trypsin, max. 2 missed cleavages; static modification: cysteine carbamidomethylation; variable modification in the tryptic peptide fraction: methionine oxidation; variable modification in PNGase F fractions: methionine oxidation and asparagine deamidation. PSMs (peptide-specific matches) and protein FDR were set to 0.01. For advanced identification, the Second Peptide Search in MS2 spectra and the Match Between Runs features were enabled. Label-free quantification of proteins with normalization was done in MaxQuant [32]. The LFQ min. ratio count was set to one. Peptides from both fractions were integrated in the LFQ protein intensity calculations. Only unique and razor peptides, unmodified or modified, were used for quantification. LFQ protein intensities (see Supplementary Table S7) were then loaded into the Perseus framework (Max Planck Institute of Biochemistry) [33]. Known contaminants and reverse identified peptides/proteins were discarded. Intensities were log(2)-transformed and missing values were imputed from the normal distribution of the dataset (width: 0.3, downshift 1.8). A two-sample t-test was used to calculate statistical differences in protein abundances in the compared groups. p-values were adjusted according to Benjamini and Hochberg [34], and proteins demonstrating at least a two-fold expression difference and an adjusted p-value < 0.05 were considered to be significantly changed in abundance. The mass spectrometry proteomics data have been deposited with the ProteomeXchange Consortium via the PRIDE partner repository [35] with the dataset identifier PXD061893.

Isolation and analysis of bone marrow-derived neutrophils (BMNs): Young adult mice were sacrificed by CO₂ inhalation. BMNs were isolated and assessed for purity and viability as described in [15]. All assays were performed with freshly prepared BMNs in Eppendorf tubes blocked with 10% BSA/PBS for at least 1 h at 37 °C. The concentration of released MPO was determined in cell culture supernatants from BMNs that were either left untreated or stimulated with live C. albicans yeast cells (MOI 10) for 60 min using the mouse MPO ELISA kit (Hycultec GmbH, Beutelsbach, Germany).

C. albicans killing assays were performed using the Colorimetric Cell Viability Kits III (XTT) obtained from Promokine(Promocell, Heidelberg, Germany. For these, 2 × 10⁵ neutrophils in 100 µL RPMI/10% FBS were left unstimulated or were stimulated with 2 × 10⁵ C. albicans cells per well (MOI 1) in a 96-well plate for 30 min at 37 °C, 5% CO₂. The C. albicans solution for standards (input) was kept on ice for the incubation times. Just before the following procedures, C. albicans standards (sensitivity: 6500 CFU) were transferred to the 96 well-plate. Triton X-100 was added to all wells to reach a final concentration of 0.3% and incubated for 10 min at 37 °C, 5% CO₂, in order inactivate neutrophils. Viable C. albicans cells were quantified by the addition of 50 µL XTT reaction mixture per well and incubation for 3–4 h at 37 °C, 5% CO₂. Absorbance was measured using a TECAN M200 at 450 nm and 630 nm (background). For calculations of C. albicans CFUs, background and blanks were subtracted.

Phagocytosis assays were performed as described in [15]. Briefly, BMNs were stimulated with FITC-labeled C. albicans yeast cells (MOI 20) for 20 min, fixed and counterstained for Hoechst33342 (Thermo Scientific, Darmstadt, Germany), mouse anti-mouse CEACAM1 expressed on WT and CEABAC10 BMNs (MSCC1, monoclonal mouse IgG1, Bernhard B. Singer, Essen/highly cross-adsorbed goat anti-mouse-Alexa546, Invitrogen, Thermo Fisher Scientific, Darmstadt, Germany), and extracellular C. albicans cells (rabbit-anti Candida, BP1006, Acris antibodies/highly cross-adsorbed goat anti-rabbit-Alexa633, Invitrogen, Thermo Scientific, Darmstadt, Germany). Micrographs were analyzed for phagocytosis by counting BMNs without contact with C. albicans cells; BMNs with attached, extracellular C. albicans cells (FITC staining and anti-Candida antibody staining); and BMNs with intracellular (phagocytosed) C. albicans cells (FITC staining only) with a confocal laser scanning microscope (Zeiss LSM 710) using the ZEN 2010 software (both Carl Zeiss Microscopy GmbH, Jena, Germany).

All flow cytometric analyses of BMNs were performed on an Attune Acoustic Focusing Cytometer (Life Technologies, Thermo Fisher Scientific, Darmstadt, Germany) using the Attune software v2.1. The expression of CD11b and human CEACAM3 and CEACAM6 and their relative fluorescence intensities on BMNs was determined in cells either left untreated or stimulated with UV-killed C. albicans germ tubes (MOI 10) for 60 min. Cells were stained using viability dye eFluor780 (eBiosciences/Thermo Fischer GmbH, Darmstadt, Germany), anti-CD11b-APC (clone REA592, Miltenyi Biotec), and either 308/3-3 (anti-human CEACAM3/5, LeukoCom, Essen, Germany)/highly cross-adsorbed goat anti-mouse IgG1-PE (eBiosciences) or 1H7-4B (anti-human CEACAM6, LeukoCom, Essen, Germany)/highly cross-adsorbed goat anti-mouse IgG1-PE (eBiosciences/Thermo Fischer GmbH, Darmstadt, Germany). Note that 308/3-3 cross-reacts with CEACAM5 [14] that is not expressed on neutrophils (therefore, we refer to 308/3-3 as “CEACAM3-specific” in the context of this publication). For the analysis of flow cytometry data, dead cells were excluded due to possible false-positive staining. For analysis of apoptosis, BMNs were either left untreated for 2 h or were treated for 2 h with UV-killed C. albicans germ tubes (MOI 10) and stained using the Annexin V Detection Kit APC (eBiosciences/Thermo Fischer GmbH, Darmstadt, Germany). Cells negative for Annexin V and propidium iodide were considered viable. Analysis of intracellular reactive oxygen species was performed as described in [15]. Briefly, BMNs were pre-incubated for 15 min with 1.5 μg/mL dihydro-rhodamine 123 (DHR, Biomol GmbH, Hamburg, Germany) in calcium- and magnesium-free PBS/2.5% BSA and either left untreated or stimulated with UV-killed C. albicans germ tubes (MOI 10) for another 15 min. Cells were washed in calcium- and magnesium-free PBS, fixed in 1% PFA/PBS for 10 min, blocked with PBS/50% heat-inactivated fetal bovine serum, and washed with PBS/2% heat-inactivated fetal bovine serum.

Differentiation and analysis of bone marrow-derived monocytes (BMMs) and macrophages (BMDMs): Young adult mice were sacrificed by CO₂ inhalation. Isolated bone marrow cells were differentiated into BMMs (non-adherent cells, 5–7 days) and BMDMs (adherent cells, 7 days) in RPMI/25 ng/mL recombinant mouse M-CSF (ImmunoTools GmbH, Friesoythe, Germany). The medium was exchanged every other day (non-adherent cells were collected by centrifugation). CEACAM6 expression was determined by flow cytometry using eFluor 780 (eBioscience/Thermo Fischer GmbH, Darmstadt, Germany) and the following antibodies (all Miltenyi Biotec, Bergisch Gladbach, Germany): CD66c-PE/REA414 (CEACAM6), F4/80-FITC/REA126, CD11b-APC/REA892, CD11c-PE-Vio770/REA754, and CD62L-APC/REA828, as described in the Respective Figure Legends and Supplementary Figure Legends. All flow cytometric analyses of BMNs and BMDMs were performed on an Attune Acoustic Focusing Cytometer (Life Technologies, Thermo Fisher Scientific, Darmstadt, Germany) using the Attune software v2.1.

For stimulation, C. albicans was opsonized (2 × 10⁸/1 mL of serum, incubation on ice for at least one hour, removal of serum by RPMI wash). In all stimulations longer than 6 h, treatment of the cells with Amphotericin B was included to prevent excessive growth of hyphae (1 µg/mL, added after 1 h of stimulation). For the phagocytosis assay, C. albicans cells were labelled with fluorescein isothiocyanate (FITC) prior to the experiment (see above). For ELISAs, 5 × 10⁵ BMNs and BMDMs in 500 µL medium were seeded in 24-well-plates and were either left untreated or were stimulated for 24 h at MOI 1. Concentrations of mouse cytokines IL-1β (eBioscience/Thermo Fischer GmbH, Darmstadt, Germany), IL-6 (Thermo Scientific, Darmstadt, Germany), CCL2 (Becton Dickinson, Heidelberg, Germany), and TNFα (Thermo Scientific, Darmstadt, Germany) were determined according to the manufacturer’s instructions. To quantify the overall C. albicans-induced cell death, BMDMs were seeded in 48-well-plates at a density of 2.5 × 10⁵ cells in 250 µL of medium. Following 24 h of C. albicans stimulation at MOI 1, SYTOX^TM Green (Invitrogen, Thermo Scientific, Darmstadt, Germany) was added to the cells to a final concentration of 200 nM and incubated for 10 min in the dark at 37 °C 5% CO₂. Two images per well were taken at 20× magnification using the Vert.A1 + AxioCam MRc (Carl Zeiss, Jena, Germany) and exported as .tiff files from ZEN software (Carl Zeiss, Jena, Germany). Cells were counted using the multi-point tool in Image J version 1.53 (open source). Phase-contrast images were used to count all cells, and dead cells were counted in the SYTOX^TM Green channel. For analysis of phagocytosis, 2.5 × 10⁵ BMDMs/well were seeded in collagen-coated 8-well chambers (Permanox, Nunc Lab-TEK, Thermo Scientific, Darmstadt, Germany) in 500 µL of medium and stimulated at an MOI 5 with FITC-labeled C. albicans for 20 min. Cells were washed twice with pre-warmed PBS, fixed with 250 µL 4% paraformaldehyde in PBS for 20 min at RT, and blocked with 200 µL 10% BSA/PBS at 4 °C overnight. Mouse Fc-block (eBioscience/Thermo Fischer GmbH, Darmstadt, Germany) was added for 30 min, and rabbit-anti-Candida antibody (BP1006, Acris antibodies) was added at 5 µg/mL for 1 h. Cells were washed three times with PBS, and goat anti-rabbit-Alexa Fluor 633 antibody (1:200, Invitrogen, Thermo Scientific, Darmstadt, Germany) and Hoechst33342 (1:1000, Thermo Scientific, Darmstadt, Germany) in 5% BSA/PBS were added. Cells were washed three times with PBS, chambers were removed, and the slides were dipped consecutively in PBS, water and 70% ethanol. After drying, slides were mounted with Vectashield mounting medium and allowed to harden in the dark overnight at RT and sealed using nail polish. Samples were analyzed with a Cell Observer Z1 microscope (Carl Zeiss, Jena, Germany) using the ZEN2010 software. Intracellular Ca and BMDM-associated extracellular Ca were quantified, and the amount of extracellular Ca was divided by the amount of intracellular plus associated Ca, giving the phagocytosis index.

Human liver section analysis: Human PFA-fixed, paraffin-embedded liver sections were incubated at room temperature consecutively with xylol (2 × 15 min), 100% ethanol, 96% ethanol, 70% ethanol, and distilled water (each for 10 min), followed by Tris-EDTA buffer, pH 9.0, at boiling temperature for 15 min. After cooling, sections were washed with PBS and blocked with 1% BSA/PBS; incubated with monoclonal rabbit-anti-CD68 antibody (EPR20545, Abcam) and mouse anti-CEACAM6 1H7-4B (LeukoCom, Essen, Germany) at 10 µg/mL in 0.5% BSA overnight at 4 °C in a humid chamber; washed and incubated with “Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody -Alexa Fluor 660” (Thermo Scientific Darmstadt, Germany) and “Alexa Flour 546 Goat anti Mouse IgG (H+L)” (Invitrogen GmbH, Thermo Fisher Scientific, Darmstadt, Germany), each at 1:200 in 0.5% BSA, and 1:5000 Hoechst 33342” (Thermo Scientific, Darmstadt, Germany) for 1 h at RT. Slides were washed twice with PBS. After drying, slides were mounted with Vectashield mounting medium (Biozol, Hamburg, Germany), allowed to harden in the dark overnight at RT, and sealed using nail polish. Samples were analyzed with an Axio Observer.Z1/7 microscope using the ZEN 2010 software (both produced by Carl Zeiss Microscopy GmbH, Jena, Germany).

Human alveolar macrophage analysis: Cells from human bronchoalveolar lavage were stained for CD169-PE (marker for alveolar macrophages), CD66b-FITC (marker for human neutrophils), and CEACAM6 (CD66c-PE-Vio770) (all REA, Miltenyi Biotec, Bergisch Gladbach, Germany) and analyzed on an Attune Acoustic Focusing Cytometer (Life Technologies, Thermo Fisher Scientific, Darmstadt, Germany) using the Attune software v2.1.

Human peripheral monocyte analysis: Human PBMCs were isolated and stained directly using anti-CD14-FITC (REA, Miltenyi Biotec, Bergisch Gladbach, Germany), anti-CD66c.PE-Vio770 (CEACAM6, REA, Miltenyi Biotec, Bergisch Gladbach, Germany), and eFluor780. Cells were analyzed on an on an Attune Acoustic Focusing Cytometer (Life Technologies, Thermo Fisher Scientific, Darmstadt, Germany) using the Attune software v2.1.

Statistical analysis: Except for proteomics data (see glycoproteome analysis), statistical analysis was performed using GraphPad Prism 5.04 Software. For parametric data with 2 groups, an unpaired, two-tailed Student’s t-tests was performed; for matched pairs, a paired, two-tailed Student’s t-test was performed. For non-matched parametric data with more than 2 groups, One-Way ANOVA with Bonferroni post-tests was performed. In case of exponential data (CFUs, relative fluorescence intensity), log(10)-transformed data were used for statistical analysis. In case of samples with no detectable CFU counts, statistical analysis was performed twice, inserting either 0.1 or the respective detection limit; the outcome was “not significant” in both cases. In the present manuscript, p-values for the former analysis are given. The significance level was 0.05 for all analyses.

3. Results

3.1. Human CEACAM-Transgenic CEABAC10 Mice Are More Susceptible to Systemic Candidiasis

In an intravenous infection model using two different infectious doses, our results showed a marked increase in susceptibility to systemic candidiasis and earlier death of CEABAC10 mice (CEA) compared to their wild-type (WT) littermates (Figure 1A and Figure S1A). Proinflammatory cytokine responses were indistinguishable at 24 h post-infection (p.i.) in WT and CEABAC10 mice, but at 72 h p.i., CEABAC10 mice exhibited significantly elevated serum levels of IL-6, TNFα, GM-CSF, IL-2, IL-4, CXCL10, and VEGF, indicative of an exacerbated inflammatory response (Figure 1B–D and Figure S2). Moreover, CEABAC10 mice displayed a diminished count of neutrophils and monocytes in their blood 24 h p.i., suggesting an enhanced recruitment of peripheral leukocytes into infected tissue (Figure 1E,F). Analysis of bone marrow cell populations revealed no disparities in hematopoiesis between CEABAC10 and WT mice during infection (Figure S3). Additionally, CEABAC10 mice exhibited a significant reduction in platelet numbers 24 h p.i., along with enlarged platelet volumes 72 h p.i., suggesting increased consumption and subsequent replenishment (Figure S4), indicative of increased bleeding and thrombosis typical of septic progression [36].

To explore the inflammatory response and heightened susceptibility of CEABAC10 mice to systemic candidiasis in more detail, we conducted an analysis of serum glycoproteome changes (Figure 2). Principal component analysis revealed that samples from mice injected with PBS separated from those infected with C. albicans at 24 h and 72 h. In addition, CEABAC10 sera notably diverged from WT samples at 72 h p.i. (Figure 2A).

Consistent with the principal component analysis, the comparison between PBS control-treated and C. albicans-infected WT mice revealed 29 and 103 differentially expressed serum glycoproteins at 24 h p.i. and 72 h p.i., respectively (Figure 2B,C and Tables S1 and S2). No significant differences in serum glycoprotein abundance were detected between PBS-treated WT and CEABAC10 control mice or between WT and CEABAC10 animals 24 h p.i. (Figure 2D,E). In contrast, at 72 h p.i., the serum glycoprotein composition between WT and CEABAC10 mice revealed significant changes. Overall, 51 glycoproteins were differentially abundant in serum, with 14 showing higher abundance in CEABAC10 mice and 37 elevated in WT animals (Figure 2F and Table S3). Pathway analysis with Qiagens IPA software revealed a robust activation of the acute phase response in C. albicans-infected WT animals at 24 h p.i. that further progressed at 72 h p.i., accompanied by changes in proteins associated with the activity of the coagulation and complement system and LXR/RXR and FXR/RXR responses (Figure 2G,H and Tables S4 and S5). In comparison to WT animals, CEABAC10 mice revealed a stronger acute phase response at 72 h p.i. and alterations in coagulation, complement und prothrombin pathways (Figure 2I, Table S6). Consequently, the serum glycoproteome data suggest an exacerbation of the systemic septic response in CEABAC10 mice initiated by C. albicans infection.

3.2. Infected Kidneys of CEABAC10 Mice Display Pronounced Purulent Necrotizing Nephritis 72 h p.i.

To further explore disease progression, we next investigated inflammatory responses in various organs after C. albicans infection in more detail. The kidney is the main target organ in the murine intravenous model of systemic candidiasis [37]. Examination of hematoxylin–eosin (HE)-stained kidney sections revealed renal inflammation 24 h p.i. in both WT and CEABAC10 mice (Figure 3A–D and Figure S1B,D). Subsequently, from 24 h to 72 h p.i., the extent of kidney inflammation escalated in CEABAC10 but remained relatively stable in WT mice (Figure 3A–D and Figure S1C,E). This was evidenced by the higher inflammation score (Figure 3A), the increased number of inflammatory foci (Figure 3B), and the larger total area of inflamed tissue (Figure 3D). Interestingly, the mean area of inflammatory foci remained similar between WT and CEABAC10 kidneys (Figure 3C). The heightened degree of kidney inflammation in infected CEABAC10 mice was further underscored by significantly higher levels of pro-inflammatory cytokines (IL-6 and IL-1β, Figure 3E,F; IL-1α, Figure S5), chemo-attractants (CCL2/MCP-1, Figure 3G; CCL3/MIP1 α and CXCL1/KC, Figure S5), and growth factors (bFGF and GM-CSF, Figure S5) in CEABAC10 kidney homogenates at 72 h p.i.

In the kidneys of infected CEABAC10 mice, immune cell populations exhibit a notable relative decrease in NK cells (Figure S6C) but a significant relative increase in neutrophils (Figure 3H) at 72 h p.i. There was an observed increase in fungal burden, measured in CFU (Figure 3I), visualized by histology (Figure 3J,K), and quantified by automated image analysis of the area covered by fungi (Figure S6F). Also, hyphal growth was increased in CEABAC10 kidneys (Figure 3J–L and Figure S6G). Immunohistochemistry (IHC) showed that CEACAM6 was exclusively present in neutrophils, monocytes, and macrophages in CEABAC10 kidney sections (Figure 3M,N). Due to its high glycosylation [25], CEACAM6 is proteolytically stable, and its presence was detectable in areas with high counts of damaged/deceased immune cells at 72 h p.i., particularly on neutrophils (Figure 3M,N). IHC analysis of consecutive sections for neutrophil elastase (Figure 3O), detectable only in viable neutrophils, indicated that dead cells outnumbered viable neutrophils. Consequently, the quantification of viable neutrophils by flow cytometry likely underestimated the extent of increased neutrophil recruitment into inflamed CEABAC10 kidney tissue.

3.3. The Expression of Human CEACAM3 and CEACAM6 Does Not Alter the Response of Bone Marrow-Derived Neutrophils to C. albicans In Vitro

Neutrophils play a pivotal role in the host response against C. albicans [3], yet they also contribute to pathogenesis by inflammation-driven tissue damage [38,39]. The enhanced recruitment of neutrophils, coupled with a higher fungal burden and increased numbers of inflammatory foci in the kidneys of CEABAC10 mice, implied a potential reduction in the antifungal activity of these cells. Thus, we sought to investigate the response of bone marrow-derived neutrophils (BMNs) to C. albicans infection in vitro. CEABAC10 BMNs express CEACAM3 and CEACAM6 on their cell surfaces (Figure 4A,B), both of which regulate various human neutrophil functions such as pathogen recognition and uptake, modulation of apoptosis, and adhesion to endothelial cells [14,40,41,42]. Given that CEACAM6 is also present in primary/azurophilic granules of human neutrophils and can be de-granulated to increase the cell surface expression level upon neutrophil activation [40], we assessed the expression of human CEACAM receptors on transgenic BMNs by flow cytometry. Upon stimulation of CEABAC10-derived BMNs with C. albicans, a significant increase in both human CEACAM3 and CEACAM6 on BMN cell surfaces was observed (Figure 4C,D), indicating similar behavior of the receptors in transgenic murine neutrophils.

The integrin CD11b/CD18 (CR3, αMβ2, MO-1, and Mac-1) plays a crucial role in mediating neutrophil extravasation. CR3 can be activated and upregulated upon human neutrophil activation and ligation of CEACAM3 and CEACAM6 [42]. Stimulation of BMNs with C. albicans led to a similar increase in cell surface-associated CD11b in both WT and CEABAC10 cells (Figure 4E), indicating similar activation states of BMNs after C. albicans recognition. Furthermore, no discernible differences related to spontaneous or C. albicans-induced neutrophil death, binding and phagocytosis of C. albicans, or fungal killing were observed in isolated BMNs from WT and CEABAC10 mice in vitro (Figure 4F–H). While a slightly higher basal level of reactive oxygen species (ROS) was detected in CEABAC10 BMNs, the quantities of ROS induced by C. albicans were comparable between WT and CEABAC10 BMNs (Figure 4I). Also, there was no significant difference in the release of proinflammatory CXCL1 (KC), but CEABAC10 BMNs exhibited a less variable and lower release of the degranulation marker myeloperoxidase (Figure 4J,K).

In summary, the expression of human CEACAM3 and CEACAM6 did not fundamentally alter the interaction of BMNs with C. albicans in vitro. However, the microenvironment of inflamed tissues may well influence neutrophil behavior in vivo, and the elevated numbers of neutrophils likely contribute to heightened inflammation and tissue damage.

3.4. CEABAC10 Mice Develop Acute Hepatic Coagulation Necroses, Purulent Necrotizing Hepatitis, Purulent Splenitis, and Brain Hemorrhage During Systemic Candidiasis

Following intravenous infection of WT mice, C. albicans is typically cleared from the liver over time without causing visible tissue alterations [37], a trend also observed in our experiments (Figure 5A,C). In contrast, at necropsy 72 h p.i., prominent white areas were evident on the livers of 15 out of 18 CEABAC10 samples (Figure 5B,C). Histologically, these alterations correlated with multifocal acute coagulation necroses with immune cell infiltrations (Figure 5D–F). Notably, these lesions were strictly vascular-associated, predominantly periportally localized, and nearly exclusive to CEABAC10 livers (Figure 5G). The onset of coagulation necroses and immune cell infiltrations was detected microscopically as early as 24 h p.i., intensifying in numbers and size by 72 h p.i. (Figure 5G), when they became macroscopically visible. Additionally, acute purulent necrotizing hepatitis was observed in 6 out of 11 CEABAC10 mice 72 h p.i., contrasting with the absence of such findings in WT animals (Figure 5H).

The inflammatory nature of these lesions was evident through the higher relative numbers of neutrophils and macrophages detected by flow cytometry in livers of CEABAC10 mice (Figure 5I,J), accompanied by elevated levels of pro-inflammatory cytokines and chemokines in liver homogenates (IL-6, CCL2/MCP-1, CCL3/MIP-1α, and CXCL10/IP-10; Figure 5K–M and Figure S9). While the proportion of monocytes among hepatic immune cells was comparable between WT and CEABAC10 mice, there was a tendency towards a relative reduction in NK cell, T cell, and B cell numbers in CEABAC10 livers 72 h p.i. (Figure S10). Despite the heightened inflammation in the livers of CEABAC10 mice, the total fungal burden in the liver tissue was comparable to that of WT animals (Figure 5N). Similar to the kidneys, only neutrophils, along with macrophages and monocytes stained positive for CEACAM6 (Figure S10) and live, neutrophil elastase (NE)-positive granulocytes, were outnumbered by dead CEACAM6-posive neutrophils and macrophages 72 h p.i. (Figure S10).

In addition to the liver pathology, severe purulent splenitis was also observed in 8 out of 11 CEABAC10 mice at 72 h p.i., a condition only detected in 1 out of 7 WT mice (Figure 5R). Despite this discrepancy in pathology, the composition of immune cell populations and fungal load were not significantly different in spleens of infected WT and CEABAC10 mice (Figure S12 and Figure 5S).

Interestingly, 4 out of 18 CEABAC10 mice exhibited brain hemorrhage at 72 h p.i. at necropsy, which was not seen in any of the 14 WT mice at 72 h (Figure S14). No difference in the severity of encephalitis was observed between the two genotypes, although CEABAC10 brains displayed higher fungal burdens and higher hyphae scores (Figure S14). Similar to other organs, CEACAM6 expression in the brain was restricted to neutrophils and some macrophages (Figure S14), and dead CEACAM6-positive neutrophils and macrophages outnumbered viable, neutrophil elastase (NE)-positive granulocytes (Figure S14).

3.5. CEACAM6 Expression on Monocytes, but Not Macrophages, Leads to Increased Cytokine Production in Response to C. albicans

The activation of leukocytes induces increased expression of CEACAMs on their surfaces [40]. In evaluating the activation of myeloid cells following systemic candidiasis, we focused on assessing the expression of CEACAM6 that is expressed by neutrophils, monocytes, and macrophages in CEABAC10 mice. The proportion of CEACAM6⁺ neutrophils increased from approximately 80% to nearly 100% at 72 h p.i. in the kidneys, liver, and spleen (Figure 6A,D,G). While CEACAM6⁺ monocytes were scarce in PBS control mice, their numbers increased to approximately 50% of the total monocyte population in the kidneys, liver, and spleen at 72 h p.i. (Figure 6B,E,H).

In macrophages, the CEACAM6⁺ subpopulation remained remarkably stable during infection of kidneys and spleen. Approximately 6% of all macrophages in the kidneys (Figure 6C) and around 10% in the spleen (Figure 6I) were CEACAM6-positive cells. Interestingly, a contrasting scenario unfolded in the liver: Here, a substantial proportion of CEACAM6⁺ macrophages (approximately 40%) was observed in PBS-treated control animals (Figure 6F). However, this population dropped below 10% within 24 h p.i. and remained low at 72 h p.i. (Figure 6F). One plausible explanation for the reduced proportion of CEACAM6⁺ macrophages is macrophage cell death, as only viable cells were quantified by flow cytometry, and a substantial number of CEACAM6⁺ dead cells, including macrophages, were visible in immunohistochemistry (Figure 5P).

Since the expression of CEACAM3 and CEACAM6 did not influence BMN interaction with or response to C. albicans, we postulated that CEACAM6⁺ transgenic macrophages and monocytes are crucial for the heightened inflammatory response observed in CEABAC10 mice during systemic candidiasis. We therefore studied responses to C. albicans infection in transgenic and WT bone marrow-derived macrophages (BMDMs) in vitro. The majority of BMDMs stained positive for CEACAM6 (Figure 7A,B). While phagocytosis of C. albicans was slightly but significantly higher in CEABAC10 BMDMs (Figure 7C), C. albicans-induced macrophage cell death was comparable between both WT and CEABAC10 BMDMs (Figure 7D). These findings suggest that macrophage expression of CEACAM6 per se is not the primary factor responsible for the substantial number of dead hepatic macrophages observed after infection in vivo (Figure 6F). Moreover, the release of the pro-inflammatory cytokines IL-1β, IL-6, and TNFα was not significantly affected by CEACAM6 expression in BMDMs (Figure 7D–F).

In CEABAC10 bone marrow-derived monocytes (BMMs), only the classical subset (CD62L⁺/CD11c⁻) and not the non-classical subset (CD62L⁻/CD11c⁺) expressed CEACAM6 on the surface (Figure 8A–D). Nevertheless, this mixed population of CEABAC10-derived BMMs with >50% CEACAM6⁺ cells demonstrated significantly increased production of IL-6 and CCL2/MIP-1α after C. albicans infection compared to WT BMMs, aligning with the higher cytokine production observed in mouse tissues in vivo. In contrast, the amount of secreted TNFα and IL-1β after infection was comparable in both WT- and CEABAC10-derived BMMs irrespective of CEACAM6 expression.

The identification of a specific subset of macrophages expressing CEACAM6 in the livers of transgenic mice aligns with the results from the analysis of human liver sections, where a substantial portion of resident CD68⁺ macrophages [43] were also positive for CEACAM6 (Figure S17). Additionally, closely mirroring this pattern, about one-third of CD169⁺ alveolar macrophages [44], as detected via flow cytometry in cell pellets from human bronchoalveolar lavage samples, were CEACAM6-positive (Figure S18). In contrast to CEABAC10 monocytes (Figure 6B,E,H), peripheral monocytes isolated from fresh blood of healthy human volunteers showed no detectable surface expression of CEACAM6 (Figure S19).

4. Discussion

CEACAM family receptors play a crucial role in regulating immune functions during infections and cancer [8,25,45]. CEACAM1 is recruited and activated by bacterial and viral pathogens to suppress immune responses [8,25,45]. Conversely, CEACAM6 primarily functions as an adhesin for human pathogens like AIEC, Neisseria spec., and Acinetobacter baumannii, permitting colonization and invasion of cells and tissues without directly affecting host responses [10,13,21]. CEABAC10 mice [20] serve as a valuable model for studying interactions of human pathogens with CEACAM3, CEACAM5, and CEACAM6, both in vivo and in vitro [13,21,22,23,46,47]. In this study, we explored the impact of their expression on the host response to systemic candidiasis.

CEABAC10 mice exhibited a heightened susceptibility and accelerated mortality in response to systemic C. albicans infection. This increased vulnerability can be at least partially attributed to an exacerbated systemic immune response, characterized by elevated cytokine levels and an intensified acute phase response, in line with the contribution of progressive sepsis to death of mice systemically infected with C. albicans [48]. In addition, increasing fungal burden in the kidneys as the primary target organ [37] leads to renal failure [48]. Here, we found that CEABAC10 kidneys were severely affected at 72 h p.i. with increased inflammation and fungal burden, indicating that both augmented immunopathology and reduced ability to control fungal growth contributed to the increased susceptibility of transgenic mice.

Neutrophils are crucial for host defense against systemic candidiasis [3], and they express functional CEACAM3 [23] and CEACAM6 [8,25]. Thus, functional impairment of transgenic neutrophils would explain the higher fungal burden, and increased recruitment of neutrophils in CEABAC10 mice in response to the high fungal load likely resulted in increased renal injury [49,50]. However, we found no evidence of reduced anti-fungal activity of CEABAC10 BMNs in vitro. Possibly, neutrophil behavior in vivo is influenced by infection-specific alterations in the tissue environment that were absent in the BMN experiments in vitro. In inflamed organs, the local microenvironment markedly alters neutrophil behavior, often amplifying their inflammatory and tissue-damaging functions. Elevated cytokines and chemokines, such as those observed in candidemic CEABAC10 mice, prime neutrophils, prolong their survival, and lower activation thresholds [51]. Hypoxia and metabolic stress further sustain neutrophil activity and promote effector functions, including reactive oxygen species production and neutrophil extracellular trap formation [52]. In addition, damage-associated molecular patterns and interactions with endothelial, epithelial, and immune cells reprogram neutrophils toward persistent activation and tissue retention [53]. Together, these cues shift neutrophils from short-lived, self-limiting antimicrobial responders to prolonged drivers of inflammation, contributing to tissue injury. Our serum glycoproteome analysis showed markedly dysregulated levels of several matrix proteins and secreted/shed immunoregulatory receptors and enzymes in CEABAC10 serum, including the key enzyme for heparan sulfate chain initiation, EXTL2. In mouse models of vulvovaginal candidiasis, heparan sulfate in the vaginal environment of susceptible mice serves as a competitive ligand for Mac-1 on neutrophils, effectively rendering the neutrophils unable to bind to C. albicans to initiate killing [54]. Pathway analysis of the serum glycoproteomes of WT and CEABAC10 mice 72 h p.i. further identified a dysregulation of the LXR/RXR activation, which regulates neutrophil functions [55] as well as monocyte/macrophage cytokine release [56,57].

Interestingly, CEABAC10 livers also showed clear inflammatory changes and tissue damage. This was unexpected because in WT mice, liver infection is normally controlled by the murine immune system, and tissue architecture is preserved without evident inflammatory changes, except for the transient accumulation of both neutrophils and mononuclear phagocytes [37]. The acute coagulation necroses in livers concurred with thrombocytopenia in candidemic CEABAC10 animals. Alterations in the changes in proteins associated with the activity of coagulation pathways and the complement system identified in serum glycoproteomics are likely inducers of this pathology. While C. albicans infection alone affected both pathways, the dysregulation was further enhanced in CEABAC10 mice. Thus, expression of human CEACAM receptors in the transgenic mice worsened endothelial dysfunction and micro-thrombosis, which are known to be induced by sepsis. In LPS-treated rats, higher pro-inflammatory cytokine levels also coincide with elevated coagulation [58]. C. albicans-stimulated CEABAC10 bone marrow-derived monocytes released substantially increased amounts of IL-6 and CCL2/MIP-1α, consistent with their marked increase in vivo in infected CEABAC10 mice. Monocytes closely control the early host reaction to C. albicans infection, primarily by secretion of various cytokines and chemokines, including IL6 and CCL2/MIP-1α [59,60,61]. Enhanced numbers of monocytic phagocytes can also lead to tissue damage, as shown by mouse liver injury exacerbated by CCL2-mediated monocyte/macrophage recruitment [62]. In fact, our data suggested that CEABAC10 monocytes and macrophages were among the driving forces behind the observed systemic inflammation and organ damage, acutely affecting the liver. Recently, an increasing number of publications have focused on the role of monocytic phagocytes in systemic candidiasis [3,63].

As the primary immune cells in naive tissues, tissue-resident macrophages are essential for innate host defense against C. albicans infection [63]. CCL2 further enhances monocyte recruitment to inflammatory sites, where they differentiate into macrophages [63,64], as we found in CEABAC10 livers 72 h p.i. CEABAC10 liver macrophages showed a contrasting behavior with the loss of all CEACAM6⁺ macrophages within 24 h p.i. and a strongly increased total number of CEACAM6^- macrophages. Regrettably, bone marrow-derived CEABAC10 macrophages were not a useful tool to study the role of macrophages during C. albicans infection, probably due to the marked heterogeneity of macrophage populations as a function of their microenvironment, as reviewed in detail previously [3,63,65]. However, in a CX3CR1 knock-out mouse model, the dysfunction of tissue macrophages was associated with a higher fungal and higher neutrophil counts in the kidneys, renal failure, and shortened survival [66]. As in most murine studies of systemic C. albicans infection, the liver was not further analyzed in this study [66] as it is usually not severely affected [37].

In CEABAC10 mice, the liver as the key integrator of microbial responses [67] was likely central to the exacerbation of sepsis progression via enhanced activation of the acute phase response elicited by the increased levels of monocyte-derived IL-6. During microbial infection, IL-6 induces the liver to switch from tolerogenic towards immunogenic responses and initiate the production of acute phase proteins [67,68]. In mice as well as in human patients, serum levels of IL-6 are closely related to the severity and outcome of sepsis [69,70]. In fact, IL-6 is the major factor that induces a systemic inflammatory response syndrome in mouse models of sepsis [71], furthered by inflammation and coagulation that promote organ dysfunction [36].

The rapid septic progression in CEABAC10 mice driven by the liver may have obscured further roles of CEACAM6 receptors on monocytes and tissue macrophages in other organs [72]. For example, CEABAC10 brains showed increased fungal burden and hemorrhage. C. albicans enters the brain by damaging the blood–brain barrier [73], and microglia promote the recruitment of neutrophils to the brain, which mediate fungal clearance [73,74]. Further studies will be needed to address the possible role of CEACAM6 expression on microglia and other immune cells that may further impair blood vessel permeability.

This study confirms the results of our previous research on human neutrophils [14], which showed that CEACAM6 expression plays a role in enhancing the responses triggered by other receptors upon C. albicans infection rather than directly initiating a response. While CEACAM1 shows very similar behavior to CEACAM6 in response to C. albicans infection on human neutrophils [14], mice transgenic for human CEACAM1 show no difference in their response to systemic candidiasis compared to their WT littermates [15]. In human neutrophils, CEACAM6 can influence different pattern recognition receptor pathways, including Toll-like receptor (TLR), NOD-like receptor, and c-type lectin receptor signaling. However, results from TLR2- and TLR-4-deficient mice infected with C. albicans remain controversial, and the consequences of TLR knock-out for survival and fungal burden depend on the genetic background, fungal strain, and infection dose [75]. Therefore, it remains unclear if TLR interference by CEACAM6 might contribute to the increased susceptibility of CEABAC10 mice. Dectin-1 deficiency renders mice susceptible to C. albicans infection due to impaired neutrophil, monocyte, and macrophage recruitment and responses, including impaired cytokine release, after infection, even in the presence of opsonins [76]. This is in stark contrast to increased recruitment of leucocytes and immunopathology observed with CEABAC10 mice, making it unlikely that the interference of CEACAM6 with Dectin-1 signaling contributed to the observed phenotype.

Because of the intravenous route of infection used in this study, we believe that CEACAM6 expression on myeloid cells, particularly monocytes and monocyte-derived cells, rather than mucosal CEACAM expression, led to the exacerbated systemic inflammatory response syndrome found in the CEABAC10 mice. While there are some early publications indicating the expression of CEACAM6 (also named CD66c, NCA-50/90, non-specific cross-reacting antigen) on human monocytic cells and tissue macrophages [26,27,28], we were only able to verify the expression of CEACAM6 in human tissue macrophages. Tissue-resident macrophages are key immune sentinels that maintain tissue homeostasis and play a central role in the clearance of inhaled and blood-borne pathogens [77,78]. They display pronounced plasticity, dynamically adopting pro- or anti-inflammatory states in response to local microenvironmental cues [77,78]. Analogous to its functions in neutrophils and epithelial cells [6,14,40,41,42], CEACAM6 may support immune surveillance and cell–cell communication within tissues, enabling macrophages to integrate signals from epithelial cells, endothelia, and other leukocytes. Through these interactions, CEACAM6 could modulate activation thresholds, phagocytic capacity, and cytokine production. Under pathological conditions, CEACAM6 may amplify inflammatory circuits by promoting sustained macrophage activation, survival, and pro-inflammatory cytokine release, thereby contributing to tissue injury. Given its established role in neutrophil activation and retention [14,40,41,42], macrophage-expressed CEACAM6 may further engage in self-reinforcing loops that stabilize inflammatory niches, prolong neutrophil persistence, and amplify local cytokine gradients. The microenvironment can, however, also have a contrary effect, removing CEACAM6⁺ phagocytes, as shown in the present study in the liver of CEABAC10 mice. To date, no data on the role of CEACAM6 on human tissue macrophages are available.

Study limitations are the lack of confirmatory results using depletion experiments or cell-specific knock-out approaches in monocytes/macrophages and neutrophils. Also, the molecular background of CEACAM6-dependent alterations in immune cells derived from CEABAC10 mice need to be explored.

Further studies on the role of CEACAM6⁺ cells in the liver, especially during infection and/or inflammation, may be of importance for a better understanding of the pathology observed in this study. The role of CEACAM6⁺ mononuclear phagocytes remains to be further elucidated in primary human cells. Also, the possibility of CEACAM6⁺ monocyte subpopulations in systemically infected or septic patients should be further explored.