Next Article in Journal
Longitudinal Detection of Tumor-Specific Peptides in Cerebrospinal Fluid for Pediatric Brain Tumor Surveillance
Previous Article in Journal
Profiling Osteoporosis via Integrated Multi-Omics Technologies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 15
Issue 5
10.3390/cells15050473
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

PROTAC-Mediated Targeted Degradation of MDM2 Induces Tumor-Suppressive Signaling in Osteosarcoma Cells

by
Yeongji Kim
1,†,
Jin-Woo Kim
2,†,
Junwon Choi
3,
Jinhyeong Kim
3,
Soyeon Park
3,
Wonji Choi
3,
Hyunju An
1,
Jinman Kim
4,
Minsup Kim
5,
Sujin Choi
1,
Jinsu Lim
1,
Hyun Il Lee
6,* and
Soonchul Lee
1,7,8,*
1
Department of Orthopaedic Surgery, CHA Bundang Medical Center, School of Medicine, CHA University, 335 Pangyo-ro, Bundang-gu, Seongnam-si 13488, Republic of Korea
2
Department of Orthopaedic Surgery, Nowon Eulji Medical Center, Eulji University, Seoul 01830, Republic of Korea
3
Department of Molecular Science and Technology, Ajou University, Suwon 16499, Republic of Korea
4
Department of Oral Microbiology and Immunology, School of Dentistry and Dental Research Institute, Seoul National University, Seoul 08826, Republic of Korea
5
TARS Scientific, Seoul 01717, Republic of Korea
6
Department of Orthopedic Surgery, Ilsan Paik Hospital, Inje University, 170, Juhwa-ro, Ilsangeo-gu, Goyang-si 10380, Republic of Korea
7
SL Bio, Inc., 43, Beolmal-ro 30beon-gil, Bundang-gu, Seongnam-si 13503, Republic of Korea
8
Advanced College of Bio-Convergence Engineering, Ajou University, Suwon 16499, Republic of Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Cells 2026, 15(5), 473; https://doi.org/10.3390/cells15050473
Submission received: 3 February 2026 / Revised: 26 February 2026 / Accepted: 4 March 2026 / Published: 5 March 2026
Browse Figures
Versions Notes

Abstract

Osteosarcoma, the most common malignant bone tumor in young individuals, often exhibits poor outcomes due to MDM2-mediated suppression of the p53 pathway. Whereas conventional MDM2 inhibitors block the p53–MDM2 interaction but frequently induce compensatory MDM2 upregulation, proteolysis-targeting chimeras (PROTACs) directly degrade MDM2 and bypass this limitation. Here, we investigated the anticancer efficacy of two MDM2-targeting PROTAC compounds, CL0144 and CL0174, in osteosarcoma models. In Saos-2 and U2OS cells, both PROTACs efficiently induced MDM2 degradation, leading to activation of p53 or p73 signaling, increased reactive oxygen species production, apoptotic cell death, and marked reductions in viability. PROTAC treatment also significantly suppressed proliferation, colony formation, sphere formation, migration, and invasion. In vivo, xenograft assays demonstrated robust tumor growth inhibition following PROTAC administration. Collectively, these findings demonstrate that MDM2-targeting PROTACs exert strong antitumor effects by degrading MDM2 and disrupting downstream oncogenic pathways, supporting their potential as a promising therapeutic strategy for osteosarcoma.

1. Introduction

Osteosarcoma, a highly aggressive primary bone cancer predominantly affecting adolescents and young adults [1], remains a major clinical challenge due to its high metastatic potential [2], genetic heterogeneity [3], and poor responsiveness to conventional therapies [4]. Standard treatment strategies such as surgery and chemotherapy often result in severe side effects and limited therapeutic efficacy, particularly in patients with advanced or metastatic disease [5]. These limitations highlight the need for novel therapeutic approaches that can address the molecular drivers of osteosarcoma progression.
One of the key oncogenic factors implicated in osteosarcoma is MDM2, an E3 ubiquitin ligase that suppresses the tumor suppressor p53 pathway [6]. Overexpression or amplification of MDM2 leads to functional inactivation of p53 [7], enabling uncontrolled cell proliferation, impaired apoptosis, and enhanced tumor progression [8]. Given its central role in osteosarcoma biology, MDM2 represents a compelling therapeutic target for restoring p53 activity and improving clinical outcomes [9].
Existing studies have reported on small-molecule-based MDM2 inhibitors, which disrupt the p53–MDM2 interaction [10,11,12]. However, these agents are often limited by feedback-driven MDM2 upregulation [13], p53-dependent resistance [14], and have insufficient activity in p53-deficient tumors, which are biological features commonly observed in osteosarcoma [15]. Thus, there is a critical unmet medical need to evaluate whether MDM2-targeted protein degradation, rather than simply inhibiting the protein, could overcome these limitations and provide a more effective strategy for osteosarcoma treatment.
However, despite the recognized importance of MDM2 in osteosarcoma [16], the therapeutic potential of MDM2-targeting PROTACs in this malignancy has not been systematically explored. To overcome such oncogenic protein dysregulation, recent advances have introduced Proteolysis Targeting Chimeras (PROTACs)—a novel therapeutic modality that exploits the ubiquitin–proteasome system to selectively degrade disease-related proteins [17], even those previously regarded as “undruggable” [18]. PROTACs achieve this by bringing a target protein into proximity with an E3 ligase [19], which facilitates its ubiquitination and subsequent degradation [20]. Structurally, PROTAC molecules consist of three key components: a ligand that binds to the target protein, another that binds to the E3 ligase, and a linker that connects the two [21,22]. Unlike traditional therapeutics, such as small molecules, monoclonal antibodies [23], PROTACs can degrade a wide range of proteins [24], thus expanding the scope of druggable targets [25]. This unique mechanism offers several advantages, including the ability to overcome drug resistance while maintaining therapeutic efficacy [26]. PROTACs exhibit high selectivity and recyclability [27], allowing for lower dosing [28] and reducing potential side effects [29]. These attributes underscore their significant potential as a novel drug development platform. Currently, PROTACs are being actively explored in cancer therapy [30], where they aim to degrade oncogenic proteins crucial to cancer pathogenesis [31]. Initial studies have demonstrated their superior therapeutic effects [32], positioning PROTACs as a promising solution to unmet needs in cancer treatment and a potential paradigm shift in therapeutic design. However, despite these advances [33], the application of PROTAC technology to osteosarcoma remains poorly investigated [34]. In particular, no systematic studies have evaluated MDM2-targeting PROTACs in osteosarcoma, despite the pivotal role of MDM2 in osteosarcoma pathogenesis [35]. This knowledge gap highlights the need to explore whether selective degradation of MDM2 can offer a novel and effective therapeutic strategy for osteosarcoma.
In this study, we investigated the therapeutic efficacy of two different MDM2-targeting PROTAC compounds in osteosarcoma models. Through comprehensive in vitro analyses, we assessed their feasibility to degrade MDM2, reactivate p53 or p73 signaling pathways, induce apoptosis, impair proliferation, and alter cell-cycle progression. Furthermore, we evaluated the antitumor effects of these PROTACs in vivo using a xenograft mouse model. Collectively, this work aims to provide the first systematic evidence supporting MDM2-targeting PROTACs as a promising therapeutic avenue for osteosarcoma and to lay the foundation for future optimization and clinical translation of MDM2-directed protein degradation strategies.

2. Materials and Methods

2.1. Cell Culture and Reagents

The MDM2-targeting PROTAC compounds (CL0144 and CL0174) were provided by the laboratory of Professor Junwon Choi (Ajou University Suwon, Republic of Korea) (Figure 1A). The human osteosarcoma cell line, Saos-2(p53-null), was procured from the Korean Cell Line Bank and cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (1×; Welgene, Gyeongsan, Republic of Korea), supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and penicillin-streptomycin (100 U/mL; Gibco, Thermo Fisher Scientific Inc.), maintained at 37 °C in a humidified incubator with 5% CO2. The human osteosarcoma cell line, U2OS (p53-wild type), was sourced from the American Type Culture Collection and cultured in Dulbecco’s modified Eagle’s medium (DMEM; 1×; Welgene Inc.) supplemented with 10% FBS (Gibco, Thermo Fisher Scientific Inc.) and penicillin-streptomycin (100 U/mL; Gibco, Thermo Fisher Scientific Inc.), under identical incubation conditions. All small-molecule inhibitors used in this study, including Nutlin-3, RG7112, Idasanutlin, and others listed in Table 1, were dissolved in DMSO according to the manufacturers’ recommendations. The Antibodies against AKT (cat. no. 4685), p-ERK (cat. no. 4370), ERK (cat. no. 9102), Bak (cat. no. 3814), E-cadherin (cat. no. 3195), MDM2 (cat. no. 51541), and p53 (cat. no. 2524) were obtained from Cell Signaling Technology Inc. (Danvers, MA, USA), whereas antibodies against p73 (cat. no. sc-17823), p-AKT (cat. no. sc-293125), BAX (cat. no. sc-23959), β-actin (cat. no. sc-47778), and BCL-2 (cat. no. sc-7382) were acquired from Santa Cruz Biotechnology Inc. (Dallas, TX, USA) Additionally, the antibody against integrin β8 (cat. no. A27582) was obtained from ABclonal Inc. (Woburn, MA, USA). The MDM2 inhibitors used in this study were obtained from Sigma-Aldrich (St. Louis, MO, USA), MedChemExpress (Monmouth Junction, NJ, USA), AdooQ Bioscience (Irvine, CA, USA), Tocris Bioscience (Bristol, UK), MedKoo Biosciences (Morrisville, NC, USA), and Calbiochem (Merck KGaA, Darmstadt, Germany).

2.2. Determination of Cell Growth

Cell proliferation was assessed using the Cell Counting Kit-8 (CCK-8 Dojindo, Kumamoto, Japan) solution, following the manufacturer’s protocol. In brief, Saos-2 and U2OS Cells were exposed to control DMSO, PROTAC compounds (1 μM and 10 μM), and other MDM2 inhibitors (1 μM and 10 μM) in 96-well plates and incubated at 37 °C with 5% CO2 for 72 h. DMSO was used as the solvent control in in vitro assays to facilitate compound solubilization under cell culture conditions. Post incubation, 10 μL of the CCK-8 solution was added to each well, and the plates were further incubated at 37 °C for 2 h. The absorbance was then measured at 450 nm.

2.3. Cell Cycle Analysis

For cell cycle analysis, Saos-2 and U2OS cells were treated with control DMSO and PROTAC compounds (1 μM and 10 μM) for 72 h. Following treatment, the cells were fixed in ice-cold 70% ethanol for 2 h and subsequently treated with RNase A (20 µg/mL). The cells were then stained with propidium iodide (PI; 50 µg/mL) and incubated at 37 °C for 40 min, after which the cell cycle distribution was analyzed using a flow cytometer (CytoFLEX, Beckman Coulter, Mumbai, India) and analyzed with CytExpert software version 2.4 (Beckman Coulter Life Sciences, Mumbai, India).

2.4. Colony Formation Assay

Saos-2 and U2OS cells were treated with control DMSO and PROTAC compounds (1 μM and 10 μM) for 72 h. Subsequently, the cells were seeded into 60 mm culture dishes at densities of 500 cells/dish and 250 cells/dish, respectively, and incubated at 37 °C with 5% CO2 for 2 weeks. The culture medium was refreshed every 4 days. Colonies were visualized and quantified following staining with a 0.05% crystal violet solution for 30 min.

2.5. Apoptosis Analysis

Apoptosis in cultured cells was assessed using flow cytometry following annexin-FITC/propidium iodide (PI) double staining, employing the Annexin V-FITC Apoptosis Detection Kit I (BD Biosciences, San Jose, CA, USA). In accordance with the manufacturer’s protocol, cells were treated with control DMSO and PROTAC compounds (1 μM and 10 μM) for 72 h. Post-staining, the apoptotic rate was quantified using a CytoFLEX flow cytometer (Beckman Coulter Life Sciences) and analyzed with CytExpert software version 2.4 (Beckman Coulter Life Sciences), enabling the enumeration of early and late apoptotic cells.

2.6. Reactive Oxygen Species (ROS) Assay

Saos-2 and U2OS cells were treated with control DMSO and PROTAC compounds (1 μM and 10 μM) for 72 h. Subsequently, cells were exposed to DCF-DA at a concentration of 5 μM, shielded from light with foil, and incubated at 37 °C for 30 min. Following this, the cells were washed twice with phosphate-buffered saline (PBS), detached, and harvested using trypsin. After an additional wash, the ROS levels were quantified by measuring the FL1 value using flow cytometry (FACS; Beckman Coulter, Brea, CA, USA).

2.7. Sphere Formation Assay

For sphere formation assays, cells were cultured in Dulbecco’s modified Eagle’s/F12 serum-free medium (Welgene Inc.), supplemented with 2% B-27 (Gibco, Thermo Fisher Scientific Inc.), 20 ng/mL recombinant human epidermal growth factor (Gibco, Thermo Fisher Scientific Inc.), and 20 ng/mL recombinant human basic fibroblast growth factor (Gibco, Thermo Fisher Scientific Inc.), using six-well ultra-low attachment cluster plates (Corning, NY, USA). Once the diameters of the formed spheres reached 50 µm, the spheroids were treated with control DMSO and PROTAC compounds (1 μM and 10 μM) and incubated at 37 °C in a 5% CO2 atmosphere for 72 h. Three days after treatment, images of the spheres were captured using an Olympus CKX52 microscope (magnification ×40, Tokyo, Japan). The number and diameter of the spheres were quantified in four randomly selected fields.

2.8. Transwell Assay

A transwell assay was conducted to evaluate the migration and invasion capacities of the cells. Briefly, Saos-2 and U2OS cells, following treatment with control DMSO and PROTAC compounds (1 μM and 10 μM), were suspended in serum-free RPMI-1640 or DMEM medium. The cell suspensions were then seeded at a density of 1 × 105 cells/well onto uncoated or Matrigel-coated filters placed in the upper chamber of an 8.0 µm pore transwell plate (Corning Inc.). After 72 h of incubation, cells that had migrated or invaded to the lower surface of the filters were fixed in methanol and stained with a 0.05% crystal violet solution. The stained cells were counted in four randomly selected fields using an Olympus CKX52 microscope (magnification ×200).

2.9. Western Blotting

Cells were lysed using PRO-PREPTM protein extraction solution (iNtRON Biotechnology, Seungnam, Republic of Korea) to isolate the proteins. For protein quantification, 10 µL of the extracted protein and 10 µL of an albumin standard (Cat. no. 23209, Thermo, Waltham, MA, USA) as a control were added to a 96-well plate. Subsequently, 90 µL of a solution, prepared by mixing Pierce™ BCA Protein Assay Reagent A (Cat. no. 23228, Thermo) and Pierce™ BCA Protein Assay Reagent B (Cat. no. 23224, Thermo) in a 49:1 ratio, was added to the wells. The plate was then incubated at 37 °C for 1 h, and the absorbance was measured using a spectrometer to calculate the protein concentration. The extracted protein was mixed with a solution of 4× Laemmli Sample Buffer (Cat. no. 1610747, BIO-RAD Laboratories, Hercules, CA, USA) and 2-Mercaptoethanol (Cat. no. 1049758, Sigma, St. Louis, MO, USA) in a 9:1 ratio, based on the calculated protein amount. Protein samples were denatured by heating at 100 °C for 10 min in a heating block to ensure proper loading into the gel. The denatured proteins were then separated via electrophoresis on an 8–12% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and subsequently transferred onto polyvinylidene difluoride (PVDF) membranes (Cat. no. IPVH00010, Sigma). The PVDF membranes were blocked with 5% skim milk (Cat. no. 232100, BD DIFCO™, San Jose, CA, USA) in Tris-buffered saline containing 0.1% Tween 20 (TBST; iNtRON Biotechnology Inc.) for 1 h at 25 °C. They were then incubated overnight at 4 °C with specific primary antibodies diluted 1:1000 in the blocking solution. The membranes were washed three times with TBST and incubated with horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG secondary antibodies diluted 1:2000 in TBST for 2 h at 25 °C. Detection was performed using an enhanced chemiluminescence (ECL) substrate (Bio-Rad Laboratories, Hercules, CA, USA). Band intensities were quantified using ImageJ software version 1.52a (National Institutes of Health, Bethesda, MD, USA) and normalized to the corresponding β-actin loading control. All Western blot experiments were independently performed at least three times with similar results.

2.10. Real-Time PCR (RT-PCR)

Total RNA was extracted from cultured cell lines and tumor tissues using TRIzol™ Reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA (cDNA) was synthesized from the isolated RNA using the EzAmp™ qPCR 2X Master Mix (Elpisbio, Daejeon, Republic of Korea) according to the manufacturer’s protocol. The thermocycling conditions for cDNA synthesis were as follows: 42 °C for 30 min, 94 °C for 5 min, followed by a hold at 4 °C. Quantitative RT-PCR was performed using the CFX96 Touch RT-PCR Detection System (Bio-Rad Laboratories, Inc.) under the following cycling conditions: 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s, 65 °C for 5 s, and 95 °C for 5 s. The primer sequences used for each gene are listed in Table 2. Relative gene expression was calculated using the 2−ΔΔCq method, with GAPDH serving as the internal control.

2.11. Tumor Xenograft Experiments

Saos-2 cells were subcutaneously injected into the flanks of the mice at a density of 1 × 107 cells/mL in a 6:4 (v/v) mixture of PBS and Matrigel, with a total injection volume of 100 µL. Mice were randomized into control and treatment groups (n = 5 mice per group) when the tumor volume reached approximately 150 mm3. Treatments included PBS, CL0144 (15 mg/kg), and CL0174 (15 mg/kg), administered intratumorally (i.t.) in a 100 µL volume twice per week. PBS was used as the vehicle control for in vivo administration to ensure physiological compatibility. Tumor volumes were measured every 3–4 days post-injection for 25 days. The tumor volume (V) was calculated using the formula: V = (large diameter) × (small diameter)2 × 0.52 [36]. All mice were sacrificed on day 25, and tumor weights were measured. Mice were euthanized using CO2, ensuring the tumor volume did not exceed 2500 mm3. CO2 was introduced into the chamber at a rate of 10–30% of the chamber volume/min. After 3 min of CO2 exposure, euthanasia was confirmed by the absence of respiratory movement and the appearance of pale eye coloration.

2.12. Immunohistochemistry (IHC)

For immunohistochemical (IHC) analysis, a ready-to-use IHC/ICC kit (Biovision, Milpitas, CA, USA) was employed according to the manufacturer’s instructions. Briefly, tumor tissues were fixed in 3.7% paraformaldehyde at 25 °C, embedded in paraffin, deparaffinized, rehydrated, and subjected to protein blocking. The slides were then incubated with primary antibodies against MDM2 (1:200, Cat. no. 51541s), PCNA (1:500, Cat. no. sc-25280), and BAX (1:100, Cat. no. sc-23959) at 4 °C overnight. After washing with PBS, slides were incubated with HRP-conjugated anti-mouse and anti-rabbit IgG polyclonal antibody for 20 min at 25 °C, followed by staining with 3,3′-diaminobenzidine for 10 min. Images were acquired using a ZEISS Axioscan 7 microscope (Baden-Württemberg, Germany). Quantification of IHC-stained areas was performed using ImageJ software version 1.52a (National Institutes of Health).

2.13. Statistical Analysis

All data are presented as the mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism version 8 (GraphPad Software Inc., San Diego, CA, USA). For multiple group comparisons, one-way ANOVA followed by Tukey’s post hoc test was used. Differences were considered statistically significant at p < 0.05. All in vitro experiments were independently performed in triplicate.

3. Results

3.1. Reduction in Cell Viability by MDM2-Targeting PROTACs Compared with Conventional MDM2 Inhibitors in Saos-2 and U2OS Cells

The chemical structure of the MDM2-targeting PROTAC used in this study is shown in Figure 1A. We compared the inhibitory effects of MDM2-targeting PROTACs with those of several known MDM2 inhibitors, including Nutlin-3, RG7388, and RG7112. When osteosarcoma cells were treated with CL0144 or CL0174 (1 μM and 10 μM) for 72 h, both PROTACs reduced cell viability in Saos-2 and U2OS cells relative to the control group (100.00 ± 0.00%). At equivalent concentrations, treatment with CL0144 or CL0174 resulted in greater suppression of cell viability compared with conventional MDM2 inhibitors. In Saos-2 cells, CL0144 reduced cell viability to 77.98 ± 4.23% and 62.98 ± 2.95% at 1 μM and 10 μM, respectively (both p < 0.0001 vs. control), whereas CL0174 reduced viability to 75.75 ± 4.22% and 60.04 ± 1.15% (both p < 0.0001 vs. control). In U2OS cells, CL0144 reduced cell viability to 74.24 ± 1.00% and 62.54 ± 2.91% at 1 μM and 10 μM, respectively (both p < 0.0001 vs. control), while CL0174 reduced viability to 71.65 ± 1.55% and 60.71 ± 1.33% (both p < 0.0001 vs. control) (Figure 1B). To quantitatively compare drug potency, IC50 values were determined by nonlinear regression analysis of the dose–response curves. In Saos-2 cells, the IC50 values of Nutlin-3, RG7112, RG7388, CL0144, and CL0174 were 1.156 μM, 0.791 μM, 0.658 μM, 0.184 μM, and 0.081 μM, respectively. Similarly, in U2OS cells, the IC50 values were 1.200 μM for Nutlin-3, 0.5487 μM for RG7112, 0.5327 μM for RG7388, 0.2887 μM for CL0144, and 0.1728 μM for CL0174. These results indicate that CL0144 and CL0174 exhibited markedly lower IC50 values than conventional MDM2 inhibitors in both osteosarcoma cell lines (Figure 1C).

3.2. Determination of Effective Concentrations of MDM2-Targeting PROTACs

To determine the optimal concentrations for regulating cancer-cell viability, Saos-2 and U2OS cells were treated with DMSO (control), Nutlin-3 (0.1 μM, 1 μM, and 10 μM), CL0144 (1 nM, 10 nM, and 100 nM), and CL0174 (1 nM, 10 nM, and 100 nM) for 12 and 24 h. At 12 h following PROTAC treatment, no statistically significant dose-dependent changes in p53 expression were observed in either cell line. However, CL0174 treatment at 1 nM significantly increased p53 expression in U2OS cells (1.45 ± 0.12, p = 0.0049 vs. control) (Figure 2A). After 24 h of treatment at 100 nM, both CL0144 and CL0174 significantly increased p53 expression in U2OS cells (both p < 0.0001 vs. control). In addition, p73 levels were significantly elevated in both U2OS and Saos-2 cells (all p < 0.01). MDM2 expression was significantly reduced in U2OS cells following treatment with CL0144 and CL0174 (p = 0.0311 and p = 0.0132 vs. control, respectively), and in Saos-2 cells following CL0174 treatment (p = 0.0488 vs. control). No statistically significant change in MDM2 expression was observed in Saos-2 cells following CL0144 treatment (Figure 2B).

3.3. Dose-Dependent Effects of MDM2-Targeting PROTACs on MDM2 Degradation and Cell-Cycle Progression

Based on these initial dose–response results, we further investigated the effects of the PROTAC compounds across a broader concentration range. Saos-2 and U2OS cells were subsequently exposed to DMSO (control), CL0144 (1 nM, 10 nM, 100 nM, 1 μM, and 10 μM), and CL0174 (1 nM, 10 nM, 100 nM, 1 μM, and 10 μM) for 24 h. p53 expression was significantly increased in U2OS cells following treatment with CL0144 and CL0174 at both 1 and 10 μM (all p < 0.0001). Additionally, p73 levels were significantly elevated in both Saos-2 and U2OS cells (all p < 0.05). These changes were accompanied by a significant reduction in MDM2 protein levels in both cell lines following treatment with CL0144 and CL0174 (all p < 0.05) (Figure 3A). We next examined the impact of MDM2-targeting PROTACs on cell-cycle progression. In p53-null Saos-2 cells, both CL0144 and CL0174 (1 and 10 μM) induced a mild increase in the G2/M population compared with control cells, increasing from 18.29 ± 0.62% in control cells to 22.26 ± 0.37%, 20.99 ± 1.44%, 22.29 ± 1.40%, and 22.57 ± 0.27%, respectively. This increase reached statistical significance at 1 μM CL0144 (p = 0.0020), 1 μM CL0174 (p = 0.0172), and 10 μM CL0174 (p = 0.0012), but not at 10 μM CL0144 (p = 0.0763). In contrast, U2OS cells exhibited an increase in the G0/G1 population compared with control cells, increasing from 59.01 ± 1.28% in control cells to 63.64 ± 3.57%, 73.42 ± 1.30%, 64.15 ± 3.31%, and 67.69 ± 2.52%, respectively, with statistically significant accumulation observed at 10 μM CL0144 (p = 0.0003) and 10 μM CL0174 (p = 0.0066) (Figure 3B).

3.4. Induction of ROS Production and Apoptosis by PROTACs in Saos-2 and U2OS Cell Lines

The detection of DCF fluorescence confirmed an increase in ROS levels following PROTAC treatment. In Saos-2 cells, CL0144 and CL0174 significantly increased ROS levels compared with control cells, ranging from 59.38 ± 4.88% to 87.66 ± 2.16% (p = 0.0272 to p < 0.0001). Similarly, in U2OS cells, ROS levels were significantly increased compared with control cells, ranging from 70.61 ± 3.27% to 88.24 ± 3.68% (p = 0.0200 to p < 0.0001) following PROTAC treatment (Figure 4A). Consistent with these findings, CL0144 and CL0174 treatments significantly increased apoptotic cell populations in both osteosarcoma cell lines compared with control cells. In Saos-2 cells, apoptotic populations increased from 6.72 ± 2.06% in control cells to 13.52 ± 1.44%–15.28 ± 3.94% (p = 0.0202 to p = 0.0045). Similarly, in U2OS cells, apoptotic populations increased from 25.39 ± 6.54% in control cells to 31.04 ± 6.40%–45.42 ± 6.12% (p = 0.0100 to p = 0.0017) following PROTAC treatment (Figure 4B). Western blot analysis further demonstrated that CL0144 and CL0174 treatments significantly increased the expression of the pro-apoptotic proteins Bax and Bak, while significantly decreasing the expression of the anti-apoptotic protein BCL-2 in both Saos-2 and U2OS cells compared with control cells (all p ≤ 0.0279 for Bax and Bak; all p < 0.0001 for BCL-2) (Figure 4C).

3.5. Inhibition of Cell Proliferation by MDM2-Targeting PROTACs in Saos-2 and U2OS Cell Lines

Treatment with the PROTAC compounds CL0144 and CL0174 markedly reduced the proliferation of Saos-2 and U2OS cells (Figure 5A). Consistently, treatment with CL0144 and CL0174 significantly decreased cell viability compared with control cells in both Saos-2 and U2OS cell lines. In Saos-2 cells, viability ranged from 82.51 ± 7.69% to 61.57 ± 1.12% (p = 0.0015 to p < 0.0001), whereas in U2OS cells, viability ranged from 78.09 ± 6.34% to 54.79 ± 3.01% (p = 0.0013 to p < 0.0001) following PROTAC treatment (Figure 5B). Additionally, treatment with CL0144 and CL0174 significantly suppressed colony formation in both Saos-2 and U2OS cells compared with control cells. In Saos-2 cells, colony formation decreased from 1.00 in control cells to 0.61–0.13 (all p < 0.0001), whereas in U2OS cells, colony formation decreased from 1.00 to 0.59–0.15 following PROTAC treatment (all p < 0.0001) (Figure 5C). Western blot analysis further demonstrated that treatment with CL0144 and CL0174 significantly reduced the phosphorylation levels of AKT and ERK in both Saos-2 and U2OS cells compared with control cells (all p < 0.0001 for p-AKT/AKT; all p ≤ 0.0002 for p-ERK/ERK) (Figure 5D).

3.6. Inhibition of Sphere Formation, Migration, and Invasion by PROTACs in Saos-2 and U2OS Cell Lines

The effects of the PROTAC compounds on the tumorigenic characteristics of Saos-2 and U2OS cells were investigated. Initially, the potential of the PROTAC compounds to inhibit the formation or self-renewal capacity of cancer stem cell (CSC)-like phenotypes in these cells was assessed. Sphere culture assays conducted under serum-free conditions were employed to enrich CSC-like populations and evaluate their self-renewal ability. The sphere-forming capacity of Saos-2 and U2OS cells in stem cell growth medium was examined following treatment with the PROTAC compounds for 3 days. Furthermore, treatment with CL0144 and CL0174 significantly reduced both the diameter and number of tumor spheres in Saos-2 and U2OS cells compared with control cells, resulting in an approximately 40–90% reduction in sphere diameter and a 70–90% reduction in sphere number (all p < 0.0001) (Figure 6A). Subsequently, the impact of the PROTAC compounds on the migratory and invasive properties of Saos-2 and U2OS cells was examined using a transwell assay. Treatment with CL0144 and CL0174 significantly reduced the migratory and invasive abilities of both cell lines compared with control cells, resulting in an approximately 20–86% reduction in cell migration and a 57–85% reduction in cell invasion (all p ≤ 0.0028 for Saos-2 migration; all p < 0.0001 for U2OS migration and invasion; p = 0.0004 to p < 0.0001 for Saos-2 invasion) (Figure 6B).

3.7. In Vivo Inhibition of Osteosarcoma Growth by MDM2-Targeting PROTACs

To assess the inhibitory effects of MDM2-targeting PROTACs on osteosarcoma cells in vivo, BALB/c nude mice were subcutaneously injected with Saos-2 cells into the flank. Body weight remained stable over the course of treatment with CL0144 (15 mg/kg) and CL0174 (15 mg/kg), suggesting no noticeable weight-related adverse effects. (Figure 7A). The growth rate of tumors treated with the MDM2-targeting PROTAC compounds (CL0144 and CL0174, 15 mg/kg) was significantly reduced compared with that of the control PBS-injected tumors. Furthermore, tumor volume was significantly reduced from 1046 ± 794.7 mm3 in control mice to 636.5 ± 355.0 mm3 and 565.6 ± 269.7 mm3 in the CL0144- and CL0174-treated groups, respectively (p < 0.0001). Similarly, tumor weight was significantly decreased from 2.229 g in control mice to 0.8302 g and 0.5052 g in the CL0144- and CL0174-treated groups, respectively (p < 0.0001) at the experimental endpoint (Figure 7B–E). An immunohistochemical (IHC) analysis was performed to identify alterations in PCNA, MDM2, and the apoptosis-associated protein BAX in osteosarcoma tissues. The IHC results revealed that treatment with CL0144 and CL0174 significantly decreased the expression of PCNA and MDM2 (both p < 0.0001 and both p = 0.0002, respectively), accompanied by a significant increase in BAX expression (p = 0.0011 and p = 0.0006, respectively) compared with control tumors (Figure 7D). Whole-tissue lysates were extracted for Western blot and RT-PCR analyses. Western blot analysis of xenograft tumor lysates revealed that treatment with CL0144 and CL0174 significantly increased the protein expression of BAX, BAK, and E-cadherin (p = 0.0040 and p = 0.0428 for BAX; p = 0.0232 and p = 0.0125 for BAK; p = 0.0428 and p < 0.0001 for E-cadherin), while significantly decreasing the expression of ITGβ8 (p = 0.0368 and p = 0.0204, respectively) and MDM2 (p = 0.0114 and p = 0.0052, respectively) compared with control tumors (Figure 7F). RT-PCR analysis showed significantly elevated mRNA expression levels of BAX and CDH1, whereas the mRNA expression levels of PCNA, MKI67, BCL2, ITGB8, and CCND1 were significantly reduced in tumors from CL0144- and CL0174-treated mice compared with control tumors (BAX: p = 0.0185 and p = 0.0324; CDH1: p = 0.0033 and p = 0.0076; PCNA: p = 0.0048 and p = 0.0031; MKI67 and BCL2: both p < 0.0001; ITGB8: both p = 0.0006; CCND1: p = 0.0093 and p = 0.0058) (Figure 7G).

4. Discussion

Osteosarcoma remains a significant clinical challenge due to its aggressive nature and the limited efficacy of existing treatments [37]. MDM2, an E3 ubiquitin ligase [38], plays a crucial role in osteosarcoma pathogenesis by inhibiting the p53 tumor suppressor pathway, leading to uncontrolled cell growth and resistance to apoptosis [39]. Recent advances in targeted therapies have highlighted the potential of Proteolysis Targeting Chimeras (PROTACs) to selectively degrade oncogenic proteins, including MDM2 [40]. The present work investigated the therapeutic potential of two novel MDM2-targeting PROTAC compounds, CL0144 and CL0174, in osteosarcoma cell lines and mouse models, expanding upon prior studies demonstrating that these compounds successfully induce MDM2 degradation via the ubiquitin-proteasome system (UPS) [41].
Our findings demonstrate that MDM2-targeting PROTACs effectively inhibit osteosarcoma cell proliferation and induce apoptosis. These biological effects align with key mechanistic features of PROTAC technology: unlike traditional occupancy-driven inhibitors, PROTACs function through an event-driven catalytic mechanism [42], enabling repeated cycles of target engagement and degradation [43]. This allows efficient and sustained reduction in MDM2 levels, even at relatively low intracellular concentrations, potentially accounting for the robust downstream responses observed [44]. Moreover, by eliminating the entire protein rather than inhibiting a single binding pocket, PROTACs can target proteins previously considered “undruggable” [45], reinforcing their therapeutic potential in oncology [46].
The underlying mechanism appears to involve the degradation of MDM2, resulting in the reactivation of p53 signaling [47]. Importantly, the two osteosarcoma cell lines used in this study differ fundamentally in their p53 status: Saos-2 cells are p53-null [48], whereas U2OS cells harbor wild-type p53 [49]. This biological difference determines how each line responds to MDM2 degradation, because the downstream signaling consequences depend on whether p53 is present and able to be reactivated [50]. Mechanistically, degradation of MDM2 led to reactivation of p53 signaling. Time-course analysis showed minimal early changes (12 h), whereas clear effects emerged at 24 h. In p53-null Saos-2 cells, MDM2 degradation occurred at higher doses and was accompanied by dose-dependent p73 induction, consistent with MDM2’s known role as a negative regulator of p73 [51]. Because p73 can compensate for the absence of p53 and mediate apoptosis in p53-deficient tumor cells [52], it was necessary to examine whether PROTAC-mediated removal of MDM2 would relieve its inhibitory effect on p73, thereby enabling activation of a p53-independent apoptotic pathway. In p53-proficient U2OS cells, PROTAC treatment induced marked degradation of MDM2 with robust upregulation of both p53 and p73, indicating that eliminating MDM2 efficiently restores the p53 network while also permitting p73 activation. Although MDM2 degradation was confirmed at the examined time point, comprehensive temporal profiling of degradation kinetics was not included. Additional time-course analyses will be required to assess the persistence of PROTAC-mediated degradation and potential feedback-driven reaccumulation.
Conventional small-molecule MDM2 inhibitors have shown promise in preclinical and early clinical studies [53] by restoring p53 activity through disruption of the MDM2–p53 interaction. However, their therapeutic efficacy may be limited by the requirement for sustained target occupancy, which can result in incomplete pathway suppression and the emergence of adaptive resistance [54]. In addition, high concentrations are often required to maintain effective inhibition, potentially increasing the risk of off-target effects and toxicity. Importantly, compared with the classical MDM2 inhibitor Nutlin-3 [55]—which binds the p53-binding pocket of MDM2 [56] and stabilizes p53 [57] but simultaneously triggers compensatory transcriptional upregulation of MDM2 due to intact p53-mediated feedback—PROTAC treatment bypasses this feedback loop by eliminating MDM2 at the protein level [58]. Nutlin-3 increases p53 levels through competitive inhibition [59], but elevated p53 transcriptionally activates MDM2 [60], creating a counteracting loop that limits the duration and magnitude of therapeutic response. PROTACs, in contrast, function through an event-driven mechanism [61] in which MDM2 is repeatedly ubiquitinated and degraded, preventing the accumulation of newly synthesized MDM2 and effectively collapsing the feedback circuitry. This distinction highlights a key pharmacological advantage of degraders: the ability to maintain sustained p53 activation without triggering compensatory MDM2 rebound [62].
Although 100 nM PROTAC treatment induced detectable modulation of p53–MDM2 signaling, these early molecular changes were not expected to consistently translate into measurable phenotypic outcomes. Because more robust target engagement is generally required to elicit functional responses such as apoptosis, ROS induction, or cell-cycle perturbation [63], higher concentrations (1 μM and 10 μM) were selected for subsequent assays to ensure clearer and more reproducible biological effects. However, the concentrations required to achieve functional responses in vitro may not directly reflect clinically achievable exposure levels, and further pharmacokinetic and pharmacodynamic evaluations will be necessary to determine the in vivo exposure required for therapeutic efficacy.
In terms of cell-cycle regulation, PROTAC treatment induced only mild changes—slight G2/M elevation in Saos-2 and modest G1 enrichment in U2OS—indicating limited checkpoint engagement. Despite this, both cell types exhibited strong apoptosis and ROS induction. Upregulation of Bax/Bak and downregulation of BCL-2 are consistent with p53-family–mediated apoptotic responses, and elevated ROS further suggests that redox imbalance contributes to PROTAC-induced cytotoxicity [64]. The minimal cell-cycle alterations suggest that apoptosis was induced independently of strong checkpoint engagement, a phenomenon previously observed in p53-modulating therapies [65]. Although increased expression of p53 in U2OS cells and p73 in Saos-2 cells was observed following PROTAC treatment, the causal contribution of these pathways to apoptosis induction was not directly assessed in the present study. Future studies employing gene-specific knockdown approaches will be necessary to determine the mechanistic involvement of p53 and p73 in the observed apoptotic effects in osteosarcoma cells.
In vivo xenograft studies further validated the antitumor efficacy of CL0144 and CL0174. Treatment significantly reduced tumor volume and weight, and immunohistochemical analysis showed decreased MDM2 and PCNA expression along with increased BAX levels, mirroring our in vitro findings. Although microenvironmental effects were not directly assessed, the central role of the MDM2–p53 axis in regulating immune infiltration, angiogenesis, and ECM remodeling suggests [66] that MDM2-targeting PROTACs may influence additional tumor-modulating pathways [67]. Future studies using immunocompetent or orthotopic models will be necessary to evaluate these possibilities.
Despite promising results, several limitations should be acknowledged. First, the metabolic and structural stability of PROTAC compounds represents an important determinant of their in vivo activity. Although direct assessments of plasma or microsomal stability were not conducted in this study, previous studies of structurally related MDM2-targeting PROTACs have demonstrated sustained degradation kinetics and time-dependent ubiquitination, suggesting sufficient functional stability to enable prolonged target engagement [41]. Second, the therapeutic window and potential off-target toxicity of PROTACs [68] remain to be defined, as the cytotoxic effects of CL0144 and CL0174 on non-malignant cells were not evaluated in the present study. Future investigations assessing the selectivity and safety profile of these compounds in normal cell types will be necessary. Third, our findings are based on a limited set of osteosarcoma cell lines and a subcutaneous xenograft model, which may not fully recapitulate the human tumor microenvironment [69]. The in vivo evaluation presented in this study was conducted as a preliminary proof-of-concept using a single osteosarcoma xenograft model with intratumoral administration. While localized delivery enabled assessment of anti-tumor efficacy, this approach may not fully reflect systemic pharmacokinetics or biodistribution. In addition, toxicity evaluation was limited to body weight monitoring. Fourth, pharmacokinetics, bioavailability, and long-term safety of these compounds require systematic evaluation. Future studies employing multiple tumor models, systemic administration routes, and comprehensive toxicity assessments will be required to better evaluate the translational relevance and safety profile of these PROTAC compounds. Fifth, the interpretation of migration and invasion assays may be influenced by concurrent anti-proliferative effects, as reduced cell proliferation can contribute to decreased wound closure or transwell migration. Future studies employing proliferation-controlled conditions will be required to distinguish direct effects on cell motility from indirect effects associated with growth inhibition.
Future work will include comprehensive pharmacokinetic characterization—such as plasma exposure, clearance, half-life, and tissue distribution—to guide further optimization. Because PROTAC molecules often exhibit limited oral bioavailability due to their large size [70], strategies such as linker/warhead modification [71], prodrug design [72], nanoparticle-based delivery [73], or tumor-targeted approaches (e.g., dual-aptamer functionalization) [74] may improve therapeutic index. Incorporating more clinically relevant models, including PDX [75] and 3D osteosarcoma cultures [76], will also be critical for capturing tumor heterogeneity and improving translational relevance.
While we demonstrated strong activation of p53-family signaling and apoptosis, MDM2 regulates additional pathways—including checkpoint control, DNA repair, proteostasis, and cellular stress responses [77]. Systematic analysis of these pathways following PROTAC-induced MDM2 depletion will be important for understanding the full biological consequences. In addition, because MDM2 dysregulation is common in multiple cancers [78], our findings may have broader applicability beyond osteosarcoma.
Taken together, the characteristics of CL0144 and CL0174 provide valuable guidance for developing more selective and clinically tractable MDM2-targeting degraders. Continued optimization of pharmacokinetics, safety, and bioavailability will be essential for successful clinical translation. PROTAC-based therapeutics hold significant promise [79] not only for osteosarcoma but also for other cancers characterized by MDM2 overexpression [80] and may become an important component of future precision oncology [81].

5. Conclusions

In conclusion, this study provides compelling evidence that MDM2-targeting PROTACs, specifically CL0144 and CL0174, are effective in inhibiting osteosarcoma cell growth and promoting apoptosis. By leveraging the unique mechanism of PROTACs to degrade MDM2 and reactivate the p53 pathway [82], these compounds represent a novel and promising therapeutic approach for osteosarcoma. Further research is needed to fully realize their clinical potential and broaden the applicability of PROTAC technology in cancer therapy.

Author Contributions

Y.K.: Data curation, formal analysis, and writing—original draft. J.-W.K.: Data curation, investigation, and writing—original draft. J.C.: Data curation and formal analysis. J.K. (Jinhyeong Kim): Data curation and investigation. S.P.: Data curation and investigation. W.C.: Data curation and investigation. H.A.: Data curation, manuscript review, and editing. J.K. (Jinman Kim): Data curation and formal analysis. M.K.: Data curation and software. S.C.: Data curation. J.L.: Data curation. H.I.L.: Conceptualization, investigation, methodology, and writing—original draft. S.L.: Conceptualization, investigation, methodology, manuscript review, and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. RS-2022-NR070173, RS-2022-NR073655) awarded to Hyun Il Lee and the Korea Evaluation Institute of Industrial Technology (KEIT) funded by the Korea Government (MOTIE) (grant number. RS-2025-16064070) awarded to Soonchul Lee.

Institutional Review Board Statement

All animal procedures were performed in accordance with the guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of CHA Medical University (approval no. 240121, approval date: 1 July 2024). The experiments were conducted in compliance with the AVMA Guidelines for the Euthanasia of Animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The authors would like to thank all members of the laboratory for their valuable comments, helpful suggestions, and assistance with the animal experiments. The authors also gratefully acknowledge Junwon Choi (Ajou University) for kindly providing the synthesized PROTAC compounds used in this study.

Conflicts of Interest

Author Soonchul Lee was employed by SL Bio, Inc. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Brar, G.S.; Schmidt, A.A.; Willams, L.R.; Wakefield, M.R.; Fang, Y. Osteosarcoma: Current insights and advances. Explor. Target. Antitumor Ther. 2025, 6, 1002324. [Google Scholar] [CrossRef]
  2. Tang, J.; Shen, L.; Yang, Q.; Zhang, C. Overexpression of metadherin mediates metastasis of osteosarcoma by regulating epithelial-mesenchymal transition. Cell Prolif. 2014, 47, 427–434. [Google Scholar] [CrossRef]
  3. Saraf, A.J.; Fenger, J.M.; Roberts, R.D. Osteosarcoma: Accelerating Progress Makes for a Hopeful Future. Front. Oncol. 2018, 8, 4. [Google Scholar] [CrossRef]
  4. Hattinger, C.M.; Patrizio, M.P.; Fantoni, L.; Casotti, C.; Riganti, C.; Serra, M. Drug Resistance in Osteosarcoma: Emerging Biomarkers, Therapeutic Targets and Treatment Strategies. Cancers 2021, 13, 2878. [Google Scholar] [CrossRef]
  5. Lilienthal, I.; Herold, N. Targeting Molecular Mechanisms Underlying Treatment Efficacy and Resistance in Osteosarcoma: A Review of Current and Future Strategies. Int. J. Mol. Sci. 2020, 21, 6885. [Google Scholar] [CrossRef]
  6. Han, X.; Wei, W.; Sun, Y. PROTAC Degraders with Ligands Recruiting MDM2 E3 Ubiquitin Ligase: An Updated Perspective. Acta Mater. Med. 2022, 1, 244–259. [Google Scholar] [CrossRef]
  7. Miller, C.W.; Aslo, A.; Won, A.; Tan, M.; Lampkin, B.; Koeffler, H.P. Alterations of the p53, Rb and MDM2 genes in osteosarcoma. J. Cancer Res. Clin. Oncol. 1996, 122, 559–565. [Google Scholar] [CrossRef]
  8. Marei, H.E.; Althani, A.; Afifi, N.; Hasan, A.; Caceci, T.; Pozzoli, G.; Morrione, A.; Giordano, A.; Cenciarelli, C. p53 signaling in cancer progression and therapy. Cancer Cell Int. 2021, 21, 703. [Google Scholar] [CrossRef]
  9. Tortorelli, I.; Napolitano, A.; Zhou, Y.; Huang, P.; Jones, R.L. MDM2 inhibitors in sarcomas: Results and next steps. Curr. Opin. Oncol. 2025, 37, 324–330. [Google Scholar] [CrossRef]
  10. Beloglazkina, A.; Zyk, N.; Majouga, A.; Beloglazkina, E. Recent Small-Molecule Inhibitors of the p53-MDM2 Protein-Protein Interaction. Molecules 2020, 25, 1211. [Google Scholar] [CrossRef]
  11. Ding, Q.; Zhang, Z.; Liu, J.-J.; Jiang, N.; Zhang, J.; Ross, T.M.; Chu, X.-J.; Bartkovitz, D.; Podlaski, F.; Janson, C.; et al. Discovery of RG7388, a potent and selective p53-MDM2 inhibitor in clinical development. J. Med. Chem. 2013, 56, 5979–5983. [Google Scholar] [CrossRef]
  12. Zhuang, C.; Miao, Z.; Zhu, L.; Dong, G.; Guo, Z.; Wang, S.; Zhang, Y.; Wu, Y.; Yao, J.; Sheng, C.; et al. Discovery, synthesis, and biological evaluation of orally active pyrrolidone derivatives as novel inhibitors of p53-MDM2 protein-protein interaction. J. Med. Chem. 2012, 55, 9630–9642. [Google Scholar] [CrossRef]
  13. Chutake, Y.K.; Mayo, M.F.; Dumont, N.; Filiatrault, J.; Breitkopf, S.B.; Cho, P.; Chen, D.; Dixit, V.S.; Proctor, W.R.; Kuhn, E.W.; et al. KT-253, a Novel MDM2 Degrader and p53 Stabilizer, Has Superior Potency and Efficacy than MDM2 Small-Molecule Inhibitors. Mol. Cancer Ther. 2025, 24, 497–510. [Google Scholar] [CrossRef]
  14. Chapeau, E.A.; Gembarska, A.; Durand, E.Y.; Mandon, E.; Estadieu, C.; Romanet, V.; Wiesmann, M.; Tiedt, R.; Lehar, J.; de Weck, A.; et al. Resistance mechanisms to TP53-MDM2 inhibition identified by in vivo piggyBac transposon mutagenesis screen in an Arf(-/-) mouse model. Proc. Natl. Acad. Sci. USA 2017, 114, 3151–3156. [Google Scholar] [CrossRef]
  15. Gupta, A.K.; Bharadwaj, M.; Kumar, A.; Mehrotra, R. Spiro-oxindoles as a Promising Class of Small Molecule Inhibitors of p53-MDM2 Interaction Useful in Targeted Cancer Therapy. Top. Curr. Chem. 2017, 375, 3. [Google Scholar] [CrossRef]
  16. Lonardo, F.; Ueda, T.; Huvos, A.G.; Healey, J.; Ladanyi, M. p53 and MDM2 alterations in osteosarcomas. Cancer 1997, 79, 1541–1547. [Google Scholar] [CrossRef]
  17. Crowe, C.; Nakasone, M.A.; Chandler, S.; Craigon, C.; Sathe, G.; Tatham, M.H.; Makukhin, N.; Hay, R.T.; Ciulli, A. Mechanism of degrader-targeted protein ubiquitinability. Sci. Adv. 2024, 10, eado6492. [Google Scholar] [CrossRef]
  18. Neklesa, T.K.; Winkler, J.D.; Crews, C.M. Targeted protein degradation by PROTACs. Pharmacol. Ther. 2017, 174, 138–144. [Google Scholar] [CrossRef]
  19. Lee, J.; Lee, Y.; Jung, Y.M.; Park, J.H.; Yoo, H.S.; Park, J. Discovery of E3 Ligase Ligands for Target Protein Degradation. Molecules 2022, 27, 6515. [Google Scholar] [CrossRef]
  20. Diehl, C.J.; Ciulli, A. Discovery of small molecule ligands for the von Hippel-Lindau (VHL) E3 ligase and their use as inhibitors and PROTAC degraders. Chem. Soc. Rev. 2022, 51, 8216–8257. [Google Scholar] [CrossRef]
  21. Troup, R.I.; Fallan, C.; Baud, M.G.J. Current strategies for the design of PROTAC linkers: A critical review. Explor. Target. Antitumor Ther. 2020, 1, 273–312. [Google Scholar] [CrossRef]
  22. Park, H.; Raikar, S.S.; Kim, Y.; Chae, C.H.; Cho, Y.H.; Kim, P. Discovery of novel benzosultam CRBN ligands. Bull. Korean Chem. Soc. 2025, 46, 48–56. [Google Scholar] [CrossRef]
  23. Konstantinidou, M.; Li, J.; Zhang, B.; Wang, Z.; Shaabani, S.; Ter Brake, F.; Essa, K.; Dömling, A. PROTACs- a game-changing technology. Expert Opin. Drug Discov. 2019, 14, 1255–1268. [Google Scholar] [CrossRef]
  24. Xue, G.; Wang, K.; Zhou, D.; Zhong, H.; Pan, Z. Light-Induced Protein Degradation with Photocaged PROTACs. J. Am. Chem. Soc. 2019, 141, 18370–18374. [Google Scholar] [CrossRef]
  25. Gu, S.; Cui, D.; Chen, X.; Xiong, X.; Zhao, Y. PROTACs: An Emerging Targeting Technique for Protein Degradation in Drug Discovery. Bioessays 2018, 40, e1700247. [Google Scholar] [CrossRef]
  26. Sun, X.; Rao, Y. PROTACs as Potential Therapeutic Agents for Cancer Drug Resistance. Biochemistry 2020, 59, 240–249. [Google Scholar] [CrossRef]
  27. Carvalho, L.A.R.; Sousa, B.B.; Zaidman, D.; Kiely-Collins, H.; Bernardes, G.J.L. Design and Evaluation of PROTACs Targeting Acyl Protein Thioesterase 1. ChemBioChem 2024, 25, e202300736. [Google Scholar] [CrossRef]
  28. Nguyen, T.T.; Kim, J.W.; Choi, H.I.; Maeng, H.J.; Koo, T.S. Development of an LC-MS/MS Method for ARV-110, a PROTAC Molecule, and Applications to Pharmacokinetic Studies. Molecules 2022, 27, 1977. [Google Scholar] [CrossRef]
  29. Nguyen, T.M.; Sreekanth, V.; Deb, A.; Kokkonda, P.; Tiwari, P.K.; Donovan, K.A.; Shoba, V.; Chaudhary, S.K.; Mercer, J.A.M.; Lai, S.; et al. Proteolysis-targeting chimeras with reduced off-targets. Nat. Chem. 2024, 16, 218–228. [Google Scholar] [CrossRef]
  30. Han, X.; Sun, Y. PROTACs: A novel strategy for cancer drug discovery and development. MedComm 2023, 4, e290. [Google Scholar] [CrossRef]
  31. Vemulapalli, V.; Donovan, K.A.; Seegar, T.C.M.; Rogers, J.M.; Bae, M.; Lumpkin, R.J.; Cao, R.; Henke, M.T.; Ray, S.S.; Fischer, E.S.; et al. Targeted Degradation of the Oncogenic Phosphatase SHP2. Biochemistry 2021, 60, 2593–2609. [Google Scholar] [CrossRef]
  32. Chen, Y.; Xia, Z.; Ujjwal, S.; Rappu, P.; Heino, J.; De Wever, O.; De Geest, B.G. Dual-ligand PROTACS mediate superior target protein degradation in vitro and therapeutic efficacy in vivo. Chem. Sci. 2024, 15, 17691–17701. [Google Scholar] [CrossRef]
  33. Pan, M.; Fu, Z.; Hou, H.; Yang, C.; Li, J. Proteolysis-Targeting Chimera (PROTAC): A Revolutionary Tool for Chemical Biology Research. Small Methods 2025, 9, e2500402. [Google Scholar] [CrossRef]
  34. Mancarella, C.; Morrione, A.; Scotlandi, K. PROTAC-Based Protein Degradation as a Promising Strategy for Targeted Therapy in Sarcomas. Int. J. Mol. Sci. 2023, 24, 16346. [Google Scholar] [CrossRef]
  35. Wang, X.; Wang, S.; Feng, C. Detection of p53 and MDM2 gene expression in osteosarcoma with biotin-labelled in situ. Chin. J. Surg. 1997, 35, 178–180. [Google Scholar]
  36. Sugar, E.; Pascoe, A.J.; Azad, N. Reporting of preclinical tumor-graft cancer therapeutic studies. Cancer Biol. Ther. 2012, 13, 1262–1268. [Google Scholar] [CrossRef] [PubMed]
  37. Bishop, M.W.; Janeway, K.A.; Gorlick, R. Future directions in the treatment of osteosarcoma. Curr. Opin. Pediatr. 2016, 28, 26–33. [Google Scholar] [CrossRef] [PubMed]
  38. Fang, S.; Jensen, J.P.; Ludwig, R.L.; Vousden, K.H.; Weissman, A.M. Mdm2 is a RING finger-dependent ubiquitin protein ligase for itself and p53. J. Biol. Chem. 2000, 275, 8945–8951. [Google Scholar] [CrossRef]
  39. Vassilev, L.T.; Vu, B.T.; Graves, B.; Carvajal, D.; Podlaski, F.; Filipovic, Z.; Kong, N.; Kammlott, U.; Lukacs, C.; Klein, C.; et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004, 303, 844–848. [Google Scholar] [CrossRef]
  40. Dale, B.; Cheng, M.; Park, K.S.; Kaniskan, H.U.; Xiong, Y.; Jin, J. Advancing targeted protein degradation for cancer therapy. Nat. Rev. Cancer 2021, 21, 638–654. [Google Scholar] [CrossRef] [PubMed]
  41. Jeong, S.; Cha, J.; Ahmed, W.; Kim, J.; Kim, M.; Hong, K.T.; Choi, W.; Choi, S.; Yoo, T.H.; An, H.; et al. Development of MDM2-Targeting PROTAC for Advancing Bone Regeneration. Adv. Sci. 2025, 12, e2415626. [Google Scholar] [CrossRef]
  42. Lai, A.C.; Crews, C.M. Induced protein degradation: An emerging drug discovery paradigm. Nat. Rev. Drug Discov. 2017, 16, 101–114. [Google Scholar] [CrossRef]
  43. Sincere, N.I.; Anand, K.; Ashique, S.; Yang, J.; You, C. PROTACs: Emerging Targeted Protein Degradation Approaches for Advanced Druggable Strategies. Molecules 2023, 28, 4014. [Google Scholar] [CrossRef]
  44. Naito, M.; Ohoka, N.; Shibata, N.; Tsukumo, Y. Targeted Protein Degradation by Chimeric Small Molecules, PROTACs and SNIPERs. Front. Chem. 2019, 7, 849. [Google Scholar] [CrossRef] [PubMed]
  45. Ruffilli, C.; Roth, S.; Rodrigo, M.; Boyd, H.; Zelcer, N.; Moreau, K. Proteolysis Targeting Chimeras (PROTACs): A Perspective on Integral Membrane Protein Degradation. ACS Pharmacol. Transl. Sci. 2022, 5, 849–858. [Google Scholar] [CrossRef] [PubMed]
  46. Wang, C.; Zhang, Y.; Chen, W.; Wu, Y.; Xing, D. New-generation advanced PROTACs as potential therapeutic agents in cancer therapy. Mol. Cancer 2024, 23, 110. [Google Scholar] [CrossRef]
  47. Peuget, S.; Selivanova, G. MDM2-PROTAC versus MDM2 Inhibitors: Beyond p53 Reactivation. Cancer Discov. 2023, 13, 1043–1045. [Google Scholar] [CrossRef]
  48. Ishioka, C.; Shimodaira, H.; Englert, C.; Shimada, A.; Osada, M.; Jia, L.-Q.; Suzuki, T.; Gamo, M.; Kanamaru, R. Oligomerization is not essential for growth suppression by p53 in p53-deficient osteosarcoma Saos-2 cells. Biochem. Biophys. Res. Commun. 1997, 232, 54–60. [Google Scholar] [CrossRef] [PubMed]
  49. Allan, L.A.; Fried, M. p53-dependent apoptosis or growth arrest induced by different forms of radiation in U2OS cells: P21WAF1/CIP1 repression in UV induced apoptosis. Oncogene 1999, 18, 5403–5412. [Google Scholar] [CrossRef] [PubMed]
  50. Manfredi, J.J. The Mdm2-p53 relationship evolves: Mdm2 swings both ways as an oncogene and a tumor suppressor. Genes Dev. 2010, 24, 1580–1589. [Google Scholar] [CrossRef]
  51. Zeng, X.; Chen, L.; Jost, C.A.; Maya, R.; Keller, D.; Wang, X.; Kaelin, W.G.; Oren, M.; Chen, J.; Lu, H. MDM2 suppresses p73 function without promoting p73 degradation. Mol. Cell Biol. 1999, 19, 3257–3266. [Google Scholar] [CrossRef] [PubMed]
  52. Jost, C.A.; Marin, M.C.; Kaelin, W.G., Jr. p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature 1997, 389, 191–194. [Google Scholar] [CrossRef]
  53. Shangary, S.; Wang, S. Small-molecule inhibitors of the MDM2-p53 protein-protein interaction to reactivate p53 function: A novel approach for cancer therapy. Annu. Rev. Pharmacol Toxicol. 2009, 49, 223–241. [Google Scholar] [CrossRef]
  54. Copeland, R.A. The dynamics of drug-target interactions: Drug-target residence time and its impact on efficacy and safety. Expert Opin. Drug Discov. 2010, 5, 305–310. [Google Scholar] [CrossRef]
  55. Vassilev, L.T. Small-molecule antagonists of p53-MDM2 binding: Research tools and potential therapeutics. Cell Cycle 2004, 3, 419–421. [Google Scholar] [CrossRef]
  56. Showalter, S.A.; Bruschweiler-Li, L.; Johnson, E.; Zhang, F.; Bruschweiler, R. Quantitative lid dynamics of MDM2 reveals differential ligand binding modes of the p53-binding cleft. J. Am. Chem. Soc. 2008, 130, 6472–6478. [Google Scholar] [CrossRef] [PubMed]
  57. Van Maerken, T.; Speleman, F.; Vermeulen, J.; Lambertz, I.; De Clercq, S.; De Smet, E.; Yigit, N.; Coppens, V.; Philippé, J.; De Paepe, A.; et al. Small-molecule MDM2 antagonists as a new therapy concept for neuroblastoma. Cancer Res. 2006, 66, 9646–9655. [Google Scholar] [CrossRef]
  58. Aguilar, A.; Yang, J.; Li, Y.; McEachern, D.; Huang, L.; Razzouk, S.; Wang, S. Discovery of MD-265: A Potent MDM2 Degrader That Achieves Complete Tumor Regression and Improves Long-Term Survival of Mice with Leukemia. J. Med. Chem. 2024, 67, 19503–19518. [Google Scholar] [CrossRef]
  59. Du, W.; Wu, J.; Walsh, E.M.; Zhang, Y.; Chen, C.Y.; Xiao, Z.X. Nutlin-3 affects expression and function of retinoblastoma protein: Role of retinoblastoma protein in cellular response to nutlin-3. J. Biol. Chem. 2009, 284, 26315–26321. [Google Scholar] [CrossRef] [PubMed]
  60. Barak, Y.; Juven, T.; Haffner, R.; Oren, M. mdm2 expression is induced by wild type p53 activity. EMBO J. 1993, 12, 461–468. [Google Scholar] [CrossRef]
  61. Jin, Y.; Fan, J.; Wang, R.; Wang, X.; Li, N.; You, Q.; Jiang, Z. Ligation to Scavenging Strategy Enables On-Demand Termination of Targeted Protein Degradation. J. Am. Chem. Soc. 2023, 145, 7218–7229. [Google Scholar] [CrossRef] [PubMed]
  62. Li, Y.; Yang, J.; Aguilar, A.; McEachern, D.; Przybranowski, S.; Liu, L.; Yang, C.-Y.; Wang, M.; Han, X.; Wang, S. Discovery of MD-224 as a First-in-Class, Highly Potent, and Efficacious Proteolysis Targeting Chimera Murine Double Minute 2 Degrader Capable of Achieving Complete and Durable Tumor Regression. J. Med. Chem. 2019, 62, 448–466. [Google Scholar] [CrossRef]
  63. Chatterjee, S.; Kundu, S.; Sengupta, S.; Bhattacharyya, A. Divergence to apoptosis from ROS induced cell cycle arrest: Effect of cadmium. Mutat. Res. 2009, 663, 22–31. [Google Scholar] [CrossRef] [PubMed]
  64. Ren, S.X.; Cheng, A.S.; To, K.F.; Tong, J.H.; Li, M.S.; Shen, J.; Wong, C.C.; Zhang, L.; Chan, R.L.; Wang, X.J.; et al. Host immune defense peptide LL-37 activates caspase-independent apoptosis and suppresses colon cancer. Cancer Res. 2012, 72, 6512–6523. [Google Scholar] [CrossRef] [PubMed]
  65. Liao, X.; Huang, J.; Lin, W.; Long, Z.; Xie, Y.; Ma, W. APTM, a Thiophene Heterocyclic Compound, Inhibits Human Colon Cancer HCT116 Cell Proliferation Through p53-Dependent Induction of Apoptosis. DNA Cell Biol. 2018, 37, 70–77. [Google Scholar] [CrossRef]
  66. Uehara, I.; Tanaka, N. Role of p53 in the Regulation of the Inflammatory Tumor Microenvironment and Tumor Suppression. Cancers 2018, 10, 219. [Google Scholar] [CrossRef]
  67. Hines, J.; Lartigue, S.; Dong, H.; Qian, Y.; Crews, C.M. MDM2-Recruiting PROTAC Offers Superior, Synergistic Antiproliferative Activity via Simultaneous Degradation of BRD4 and Stabilization of p53. Cancer Res. 2019, 79, 251–262. [Google Scholar] [CrossRef]
  68. Liu, J.; Chen, H.; Liu, Y.; Shen, Y.; Meng, F.; Kaniskan, H.Ü.; Jin, J.; Wei, W. Cancer Selective Target Degradation by Folate-Caged PROTACs. J. Am. Chem. Soc. 2021, 143, 7380–7387. [Google Scholar] [CrossRef]
  69. Murayama, T.; Gotoh, N. Patient-Derived Xenograft Models of Breast Cancer and Their Application. Cells 2019, 8, 621. [Google Scholar] [CrossRef]
  70. Rej, R.K.; Allu, S.R.; Roy, J.; Acharyya, R.K.; Kiran, I.N.C.; Addepalli, Y.; Dhamodharan, V. Orally Bioavailable Proteolysis-Targeting Chimeras: An Innovative Approach in the Golden Era of Discovering Small-Molecule Cancer Drugs. Pharmaceuticals 2024, 17, 494. [Google Scholar] [CrossRef] [PubMed]
  71. Lai, A.C.; Toure, M.; Hellerschmied, D.; Salami, J.; Jaime-Figueroa, S.; Ko, E.; Hines, J.; Crews, C.M. Modular PROTAC Design for the Degradation of Oncogenic BCR-ABL. Angew. Chem. Int. Ed. Engl. 2016, 55, 807–810. [Google Scholar] [CrossRef]
  72. Chen, C.; Yang, Y.; Wang, Z.; Li, H.; Dong, C.; Zhang, X. Recent Advances in Pro-PROTAC Development to Address On-Target Off-Tumor Toxicity. J. Med. Chem. 2023, 66, 8428–8440. [Google Scholar] [CrossRef] [PubMed]
  73. Wu, M.; Zhao, Y.; Zhang, C.; Pu, K. Advancing Proteolysis Targeting Chimera (PROTAC) Nanotechnology in Protein Homeostasis Reprograming for Disease Treatment. ACS Nano 2024, 18, 28502–28530. [Google Scholar] [CrossRef]
  74. He, S.; Gao, F.; Ma, J.; Ma, H.; Dong, G.; Sheng, C. Aptamer-PROTAC Conjugates (APCs) for Tumor-Specific Targeting in Breast Cancer. Angew. Chem. Int. Ed. Engl. 2021, 60, 23299–23305. [Google Scholar] [CrossRef]
  75. Shi, J.; Li, Y.; Jia, R.; Fan, X. The fidelity of cancer cells in PDX models: Characteristics, mechanism and clinical significance. Int. J. Cancer 2020, 146, 2078–2088. [Google Scholar] [CrossRef]
  76. Pierrevelcin, M.; Flacher, V.; Mueller, C.G.; Vauchelles, R.; Guerin, E.; Lhermitte, B.; Pencreach, E.; Reisch, A.; Muller, Q.; Doumard, L.; et al. Engineering Novel 3D Models to Recreate High-Grade Osteosarcoma and its Immune and Extracellular Matrix Microenvironment. Adv. Healthc. Mater. 2022, 11, e2200195. [Google Scholar] [CrossRef]
  77. Bouska, A.; Eischen, C.M. Mdm2 affects genome stability independent of p53. Cancer Res. 2009, 69, 1697–1701. [Google Scholar] [CrossRef]
  78. Rayburn, E.; Zhang, R.; He, J.; Wang, H. MDM2 and human malignancies: Expression, clinical pathology, prognostic markers, and implications for chemotherapy. Curr. Cancer Drug Targets 2005, 5, 27–41. [Google Scholar] [CrossRef] [PubMed]
  79. Song, Y.; Dong, Q.Q.; Ni, Y.K.; Xu, X.L.; Chen, C.X.; Chen, W. Nano-Proteolysis Targeting Chimeras (Nano-PROTACs) in Cancer Therapy. Int. J. Nanomed. 2024, 19, 5739–5761. [Google Scholar] [CrossRef]
  80. Vicente, A.T.S.; Salvador, J.A.R. MDM2-Based Proteolysis-Targeting Chimeras (PROTACs): An Innovative Drug Strategy for Cancer Treatment. Int. J. Mol. Sci. 2022, 23, 11068. [Google Scholar] [CrossRef] [PubMed]
  81. Ibrahim, S.; Khan, M.U.; Khurram, I.; Rehman, R.; Rauf, A.; Ahmad, Z.; Aljohani, A.S.M.; Al Abdulmonem, W.; Quradha, M. Navigating PROTACs in Cancer Therapy: Advancements, Challenges, and Future Horizons. Food Sci. Nutr. 2025, 13, e70011. [Google Scholar] [CrossRef]
  82. Sakamoto, K.M.; Kim, K.B.; Kumagai, A.; Mercurio, F.; Crews, C.M.; Deshaies, R.J. Protacs: Chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation. Proc. Natl. Acad. Sci. USA 2001, 98, 8554–8559. [Google Scholar] [CrossRef] [PubMed]
Cells 15 00473 g001
Figure 1. Comparison of MDM2-targeting PROTACs with Other MDM2 Inhibitors: (A) Chemical structure of PROTAC (CL0144, CL0174). (B) Comparative analysis of the growth-inhibitory effects of MDM2-targeting PROTACs (CL0144 and CL0174) and established MDM2 inhibitors. In panel (B), black lines below the x-axis indicate grouping of compounds into conventional MDM2 inhibitors and MDM2-targeting PROTACs. (C) Representative MDM2 inhibitors (Nutlin-3, RG7112, and RG7388) were selected for IC50 analysis alongside the PROTACs. IC50 values were determined by nonlinear regression of the dose–response curves, showing that CL0144 and CL0174 exhibited lower IC50 values than the conventional MDM2 inhibitors. Both PROTACs showed lower cell viability compared with the inhibitor control. In panel (C), black curves correspond to conventional MDM2 inhibitors, whereas colored curves with dots indicate the MDM2-targeting PROTAC compounds. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 1. Comparison of MDM2-targeting PROTACs with Other MDM2 Inhibitors: (A) Chemical structure of PROTAC (CL0144, CL0174). (B) Comparative analysis of the growth-inhibitory effects of MDM2-targeting PROTACs (CL0144 and CL0174) and established MDM2 inhibitors. In panel (B), black lines below the x-axis indicate grouping of compounds into conventional MDM2 inhibitors and MDM2-targeting PROTACs. (C) Representative MDM2 inhibitors (Nutlin-3, RG7112, and RG7388) were selected for IC50 analysis alongside the PROTACs. IC50 values were determined by nonlinear regression of the dose–response curves, showing that CL0144 and CL0174 exhibited lower IC50 values than the conventional MDM2 inhibitors. Both PROTACs showed lower cell viability compared with the inhibitor control. In panel (C), black curves correspond to conventional MDM2 inhibitors, whereas colored curves with dots indicate the MDM2-targeting PROTAC compounds. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Cells 15 00473 g001
Cells 15 00473 g002
Figure 2. Determination of optimal concentrations for MDM2-targeting PROTACs treatment using Western blot analysis. (A,B) Changes in the expression of p53 and MDM2 proteins in Saos-2 and U2OS cells following treatment at different concentrations and time points with control, Nutlin-3, and PROTAC (CL0144, CL0174). No notable changes were detected at 12 h, while at 24 h, PROTAC treatment modulated p73 and MDM2 expression in Saos-2 cells and modulated p53, p73, and MDM2 expression in U2OS cells. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 2. Determination of optimal concentrations for MDM2-targeting PROTACs treatment using Western blot analysis. (A,B) Changes in the expression of p53 and MDM2 proteins in Saos-2 and U2OS cells following treatment at different concentrations and time points with control, Nutlin-3, and PROTAC (CL0144, CL0174). No notable changes were detected at 12 h, while at 24 h, PROTAC treatment modulated p73 and MDM2 expression in Saos-2 cells and modulated p53, p73, and MDM2 expression in U2OS cells. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Cells 15 00473 g002
Cells 15 00473 g003
Figure 3. MDM2-targeting PROTACs modulate protein levels and cell-cycle progression in osteosarcoma cells: (A) Changes in the expression of p53 and MDM2 proteins in Saos-2 and U2OS cells following treatment with control (DMSO), Nutlin-3, or PROTACs (CL0144 and CL0174) at varying concentrations. At higher concentrations, PROTAC treatment modulated p73 and MDM2 expression in Saos-2 cells, and similarly modulated p53, p73, and MDM2 expression in U2OS cells. (B) Saos-2 (p53-null) and U2OS cells were treated with CL0144 or CL0174 for 72 h at the indicated concentrations, followed by PI staining and flow-cytometric analysis to determine cell-cycle distribution. In Saos-2 cells, a slight increase in the G2/M population was observed, whereas U2OS cells showed a modest increase in the G0/G1 fraction. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 3. MDM2-targeting PROTACs modulate protein levels and cell-cycle progression in osteosarcoma cells: (A) Changes in the expression of p53 and MDM2 proteins in Saos-2 and U2OS cells following treatment with control (DMSO), Nutlin-3, or PROTACs (CL0144 and CL0174) at varying concentrations. At higher concentrations, PROTAC treatment modulated p73 and MDM2 expression in Saos-2 cells, and similarly modulated p53, p73, and MDM2 expression in U2OS cells. (B) Saos-2 (p53-null) and U2OS cells were treated with CL0144 or CL0174 for 72 h at the indicated concentrations, followed by PI staining and flow-cytometric analysis to determine cell-cycle distribution. In Saos-2 cells, a slight increase in the G2/M population was observed, whereas U2OS cells showed a modest increase in the G0/G1 fraction. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Cells 15 00473 g003
Cells 15 00473 g004
Figure 4. MDM2-targeting PROTACs induce apoptosis in osteosarcoma cells: (A) Effects of PROTAC compounds (CL0144 and CL0174) on intracellular reactive oxygen species (ROS) levels in Saos-2 and U2OS cells, both of which showed increased ROS levels upon PROTAC treatment. (B) Effects of PROTAC compounds (CL0144 and CL0174) on apoptosis in Saos-2 and U2OS cells, both of which showed increased apoptotic cell populations following PROTAC treatment. (C) Changes in the expression of apoptosis-related proteins (Bax, Bak, and BCL-2) in Saos-2 and U2OS cells treated with control and PROTAC compounds (CL0144 and CL0174), which showed PROTAC-induced modulation of Bax, Bak, and BCL-2 levels. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4. MDM2-targeting PROTACs induce apoptosis in osteosarcoma cells: (A) Effects of PROTAC compounds (CL0144 and CL0174) on intracellular reactive oxygen species (ROS) levels in Saos-2 and U2OS cells, both of which showed increased ROS levels upon PROTAC treatment. (B) Effects of PROTAC compounds (CL0144 and CL0174) on apoptosis in Saos-2 and U2OS cells, both of which showed increased apoptotic cell populations following PROTAC treatment. (C) Changes in the expression of apoptosis-related proteins (Bax, Bak, and BCL-2) in Saos-2 and U2OS cells treated with control and PROTAC compounds (CL0144 and CL0174), which showed PROTAC-induced modulation of Bax, Bak, and BCL-2 levels. The results are presented as means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Cells 15 00473 g004
Cells 15 00473 g005
Figure 5. MDM2-targeting PROTACs inhibit osteosarcoma cell proliferation: (A) Morphology of osteosarcoma (Saos-2 and U2OS) cells treated with PROTAC compounds (CL0144 and CL0174). (B) Growth-inhibitory effects of PROTAC treatment (CL0144 and CL0174). (C) Inhibitory effects of PROTAC compounds (CL0144 and CL0174) on colony formation. (D) Changes in the expression of proliferation-related proteins (p-AKT, AKT, p-ERK, and ERK) in Saos-2 and U2OS cells treated with control and PROTAC compounds (CL0144 and CL0174), which showed PROTAC-induced modulation of p-AKT, AKT, p-ERK, and ERK levels. The results are presented as means ± SD (n = 3). ** p < 0.01, *** p < 0.001.
Figure 5. MDM2-targeting PROTACs inhibit osteosarcoma cell proliferation: (A) Morphology of osteosarcoma (Saos-2 and U2OS) cells treated with PROTAC compounds (CL0144 and CL0174). (B) Growth-inhibitory effects of PROTAC treatment (CL0144 and CL0174). (C) Inhibitory effects of PROTAC compounds (CL0144 and CL0174) on colony formation. (D) Changes in the expression of proliferation-related proteins (p-AKT, AKT, p-ERK, and ERK) in Saos-2 and U2OS cells treated with control and PROTAC compounds (CL0144 and CL0174), which showed PROTAC-induced modulation of p-AKT, AKT, p-ERK, and ERK levels. The results are presented as means ± SD (n = 3). ** p < 0.01, *** p < 0.001.
Cells 15 00473 g005
Cells 15 00473 g006
Figure 6. MDM2-targeting PROTACs repress sphere formation, migration, and invasion in osteosarcoma cells: (A) Effects of PROTAC compounds (CL0144 and CL0174) on sphere formation in Saos-2 and U2OS cells. Representative microscopy images are shown, with PROTAC treatment reducing both the number and diameter of spheres. (B) Effects of PROTAC compounds (CL0144 and CL0174) on cell migration and invasion in Saos-2 and U2OS cells. Representative microscopy images are shown, with PROTAC treatment inhibiting both migration and invasion. The results are presented as means ± SD (n = 3). ** p < 0.01, *** p < 0.001.
Figure 6. MDM2-targeting PROTACs repress sphere formation, migration, and invasion in osteosarcoma cells: (A) Effects of PROTAC compounds (CL0144 and CL0174) on sphere formation in Saos-2 and U2OS cells. Representative microscopy images are shown, with PROTAC treatment reducing both the number and diameter of spheres. (B) Effects of PROTAC compounds (CL0144 and CL0174) on cell migration and invasion in Saos-2 and U2OS cells. Representative microscopy images are shown, with PROTAC treatment inhibiting both migration and invasion. The results are presented as means ± SD (n = 3). ** p < 0.01, *** p < 0.001.
Cells 15 00473 g006
Cells 15 00473 g007
Figure 7. Treatment with MDM2-targeting PROTACs inhibits tumor growth in a xenograft mouse model: (A) Body weight of mice in the control and PROTAC-treated groups over the treatment period. (B) Anti-tumor efficacy of PROTAC compounds (CL0144 and CL0174) in a xenograft mouse model. BALB/c nude mice (n = 5) were treated intratumorally with PBS (control) or PROTACs (15 mg/kg). Tumor volumes were measured every 5 days, and PROTAC treatment resulted in reduced tumor volume compared with controls. (C) Comparison of final tumor weight, showing reduced tumor weight in mice treated with either PROTAC compound. (D) Representative IHC staining of tumor sections using antibodies against BAX, PCNA, and MDM2. (E) Representative images of excised tumors from each group. Mice were sacrificed after 25 days of treatment with PROTAC compounds (CL0144 and CL0174). (F) Western blot analysis of tumor xenografts showing changes in the protein levels of BAX, BAK, E-cadherin, ITGβ8, and MDM2, with PROTAC treatment modulating the expression of these proteins. (G) RT-PCR analysis of tumor xenografts showing changes in the mRNA expression of BAX, CDH1, PCNA, MKI67, BCL2, ITGB8, and CCND1, with PROTAC treatment modulating the expression of these transcripts. The results are presented as means ± SD (n = 5). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 7. Treatment with MDM2-targeting PROTACs inhibits tumor growth in a xenograft mouse model: (A) Body weight of mice in the control and PROTAC-treated groups over the treatment period. (B) Anti-tumor efficacy of PROTAC compounds (CL0144 and CL0174) in a xenograft mouse model. BALB/c nude mice (n = 5) were treated intratumorally with PBS (control) or PROTACs (15 mg/kg). Tumor volumes were measured every 5 days, and PROTAC treatment resulted in reduced tumor volume compared with controls. (C) Comparison of final tumor weight, showing reduced tumor weight in mice treated with either PROTAC compound. (D) Representative IHC staining of tumor sections using antibodies against BAX, PCNA, and MDM2. (E) Representative images of excised tumors from each group. Mice were sacrificed after 25 days of treatment with PROTAC compounds (CL0144 and CL0174). (F) Western blot analysis of tumor xenografts showing changes in the protein levels of BAX, BAK, E-cadherin, ITGβ8, and MDM2, with PROTAC treatment modulating the expression of these proteins. (G) RT-PCR analysis of tumor xenografts showing changes in the mRNA expression of BAX, CDH1, PCNA, MKI67, BCL2, ITGB8, and CCND1, with PROTAC treatment modulating the expression of these transcripts. The results are presented as means ± SD (n = 5). * p < 0.05, ** p < 0.01, *** p < 0.001.
Cells 15 00473 g007
Table 1. The list of MDM2 inhibitors used in this study.
Table 1. The list of MDM2 inhibitors used in this study.
No.CompanyMolecule NameCat. No.Solvent
1SigmaNutlin-3N6287DMSO
2MCERG7112 (RO5045337)HY-15676DMSO
3MCEIdasanutlin (RG7388)HY-15676DMSO
4MCENavtemadlin (AMG-232)HY-12296DMSO
5MCEAlrizomadlin (APG-115)HY101518DMSO
6MCENVP-CGM097 (CGM097)HY-15954DMSO
7MCESiremadlin (NVP-HDM201)HY-18658DMSO
8MCEMI-773HY-17493DMSO
9AdooqYH239-EEA14118DMSO
10MCENSC 66811HY-14967DMSO
11MCELithocholic acidHY-B0172DMSO
12Sigmaα-MangostinMeOHMeOH
13SigmaR,S-Gambogic acidPHL80455DMSO
14MCESJ-172550HY-16664DMSO
15MCESerdemetan (JNJ-26854165)HY-12025DMSO
16TocrisRITA2443DMSO
17MCESP-141HY110182DMSO
18MedKooCytarabine hydrochloride (MK8242)100200DMSO
19CalbiochemRO-5963444153DMSO
20MCEMI-1061HY125858DMSO
Table 2. Sequences of primers used for real-time PCR.
Table 2. Sequences of primers used for real-time PCR.
Gene SymbolFull NameForward Primer (5′→3′)Description/Function
BAXBCL2-associated X proteinF: CCCGAGAGGTCTTTTTCCGAGPro-apoptotic protein promoting mitochondrial apoptosis
R: CCAGCCCATGATGGTTCTGAT
CDH1Cadherin 1 (E-cadherin)F: ATTTTTCCCTCGACACCCGATCell–cell adhesion molecule; epithelial marker suppressed during EMT
R: TCCCAGGCGTAGACCAAGA
PCNAProliferating Cell Nuclear AntigenF: TTGCACGTATATGCCGAGACCCell–cell adhesion molecule; epithelial marker suppressed during EMT
R: GGTGAACAGGCTCATTCATCTCT
MKI67Marker of Proliferation Ki-67F: GAAAGAGTGGCAACCTGCCTTCNuclear protein associated with cellular proliferation
R: GCACCAAGTTTTACTACATCTGCC
BCL2B-cell lymphoma 2F: TCTACACCGACAACTCCATCCGAnti-apoptotic protein regulating mitochondrial membrane integrity
R: TCTGGCATTTTGGAGAGGAAGTG
ITGB8Integrin subunit beta 8F: CGTGACTTTCGTCTTGGATTTGGMediates cell adhesion and ECM interactions
R: TCCTTTCGGGGTGGATGCTAA
CCND1Cyclin D1F: ATCGCCCTGTGGATGACTGAGTRegulates G1/S phase transition in the cell cycle
R: GCCAGGAGAAATCAAACAGAGGC
GAPDHGlyceraldehyde-3-phosphate dehydrogenaseF: GGAGCGAGATCCCTCCAAAATHousekeeping gene used as internal control
R: GGCTGTTGTCATACTTCTCATGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kim, Y.; Kim, J.-W.; Choi, J.; Kim, J.; Park, S.; Choi, W.; An, H.; Kim, J.; Kim, M.; Choi, S.; et al. PROTAC-Mediated Targeted Degradation of MDM2 Induces Tumor-Suppressive Signaling in Osteosarcoma Cells. Cells 2026, 15, 473. https://doi.org/10.3390/cells15050473

AMA Style

Kim Y, Kim J-W, Choi J, Kim J, Park S, Choi W, An H, Kim J, Kim M, Choi S, et al. PROTAC-Mediated Targeted Degradation of MDM2 Induces Tumor-Suppressive Signaling in Osteosarcoma Cells. Cells. 2026; 15(5):473. https://doi.org/10.3390/cells15050473

Chicago/Turabian Style

Kim, Yeongji, Jin-Woo Kim, Junwon Choi, Jinhyeong Kim, Soyeon Park, Wonji Choi, Hyunju An, Jinman Kim, Minsup Kim, Sujin Choi, and et al. 2026. "PROTAC-Mediated Targeted Degradation of MDM2 Induces Tumor-Suppressive Signaling in Osteosarcoma Cells" Cells 15, no. 5: 473. https://doi.org/10.3390/cells15050473

APA Style

Kim, Y., Kim, J.-W., Choi, J., Kim, J., Park, S., Choi, W., An, H., Kim, J., Kim, M., Choi, S., Lim, J., Lee, H. I., & Lee, S. (2026). PROTAC-Mediated Targeted Degradation of MDM2 Induces Tumor-Suppressive Signaling in Osteosarcoma Cells. Cells, 15(5), 473. https://doi.org/10.3390/cells15050473

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop