Next Article in Journal
Gender-Associated Differences in the Regulation of Potassium Channels in Astrocytes of Type 2 Diabetic Mice
Next Article in Special Issue
Regenerative Potential of Autologously Processed White Adipose Tissue for Peripheral Nerve Regeneration: Evaluation of Growth Factor Profiles and Electrical Stimulation
Previous Article in Journal
Stem Cell-Based Therapies in Autoimmune Diseases: Current Evidence, Unmet Needs, and Future Directions—A Closing Editorial Review
Previous Article in Special Issue
RETRACTED: Zuccarini et al. Multipotent Stromal Cells from Subcutaneous Adipose Tissue of Normal Weight and Obese Subjects: Modulation of Their Adipogenic Differentiation by Adenosine A1 Receptor Ligands. Cells 2021, 10, 3560
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis

1
College of Life Science, Inner Mongolia Agricultural University, Hohhot 010018, China
2
Inner Mongolia Regional Speciality Livestock Biotechnology Innovation Team, Hohhot 010018, China
3
Inner Mongolia Autonomous Region Key Laboratory of Biomanufacturing, Hohhot 010018, China
4
Inner Mongolia Engineering Research Centre of Genomic Big Data for Agriculture, Hohhot 010018, China
5
College of Grassland Science, Inner Mongolia Agricultural University, Hohhot 010018, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Cells 2026, 15(4), 329; https://doi.org/10.3390/cells15040329
Submission received: 26 December 2025 / Revised: 6 February 2026 / Accepted: 7 February 2026 / Published: 11 February 2026
(This article belongs to the Collection Research on Adipose Stem Cells)

Highlights

What are the main findings?
  • The precursor protein of asprosin (pFBN1) was significantly downregulated in the adipose tissue of Sunite sheep during winter.
  • Inhibition of the FBN1 gene in adipocytes not only impeded adipogenesis but also promoted the browning of white adipose tissue, enhancing thermogenesis.
What are the implications of the main findings?
  • This study provides novel molecular targets for the selective breeding of sheep with improved cold tolerance.
  • The findings offer fresh insights into the regulatory mechanisms of mammalian energy metabolism and adipose tissue adaptation.

Abstract

Sunite sheep are well-adapted to the cold Mongolian steppe, exhibiting robust metabolic flexibility in which adipose tissue contributes significantly to energy homeostasis. Proteomics analysis of scapular fat in Sunite sheep during winter and summer identified 432 upregulated and 493 downregulated differentially expressed proteins (DEPs). These DEPs were notably enriched in essential biological functions such as energy metabolism, lipogenesis, and thermogenesis. Furthermore, they exhibited significant enrichment of signaling pathways such as oxidative phosphorylation and fatty acid metabolism. Meanwhile, the precursor protein of asprosin (ASP),profibrillin-1 (pFBN1), showed a marked decrease during winter. Given that ASP had been demonstrated to exert metabolic regulatory effects promoting lipid synthesis and suppressing thermogenesis in model animals, it was hypothesized that the seasonal downregulation of pFBN1 might drive adaptive thermogenesis through ASP. Therefore, this study focused on functional validation of the ASP-encoding gene FBN1 (fibrillin-1). In Adipose-Derived Mesenchymal Stem Cells (ADMSCs), FBN1 was specifically downregulated through overexpressing of its regulatory factor miR-29b-1. The results indicated that downregulation of the FBN1 led to the inhibition of adipogenesis in ADMSCs. This was reflected by a reduction in the number of lipid droplets, a decrease in the expression of adipogenesis marker genes, and a significant drop in triglyceride levels. Furthermore, the reduction in FBN1 levels enhanced the thermogenic function of differentiated adipocytes derived from ADMSCs, as evidenced by enhanced expression of thermogenic marker genes, along with a notable rise in both uncoupling protein 1 (UCP1) and non-esterified fatty acid (NEFA) levels.

Graphical Abstract

1. Introduction

The Sunite sheep is a unique breed native to the Inner Mongolia region of China. It is renowned for its outstanding cold resistance, tolerance to coarse feed, and high lean meat yield. It constitutes a major economic source for local herders. The winters in the region are long and harsh, and the predominant method of sheep farming is grazing, traveling an average of 15–20 km daily. This extensive movement facilitates thermoregulation, which represents a key adaptive strategy [1]. Such behavioral adaptations are supported by internal physiological processes; specifically, the sustained stability of their core body temperature is underpinned by the complex interplay of multiple regulatory systems, including the nervous and bodily fluid systems [2]. Within this intricate regulatory system, adipose tissue serves as both a crucial energy storage site and a dynamic endocrine organ, fundamental to maintaining energy balance and thermoregulation [3].
Adipose tissue is a highly plastic, multifunctional organ. It is generally categorized into three distinct forms according to its structure and purpose: Brown (BAT), White (WAT), and Beige adipose tissue [4,5]. BAT serves as a crucial thermogenic organ in most mammals, owing to its cells’ high mitochondrial density and elevated expression of uncoupling protein 1 (UCP1) [6,7]. UCP1 dissipates the proton gradient as thermal energy rather than driving ATP production, thereby powering non-shivering thermogenesis in sheep [8,9]. Studies have shown that in animal models such as mice, the induction of lipolysis and subsequent release of nonesterified fatty acids in response to cold is mediated by both natriuretic peptides and the sympathetic nerve-catecholamine system. The released fatty acids function as activators of UCP1 [10]. Moreover, they have the capacity to enhance thermogenic gene expression and fatty acid oxidation via the cAMP-PKA-CREB signaling cascade [11]. The highly vascularized and well-innervated structure of BAT enables it to efficiently respond to cold and maintain body temperature balance. Beige adipose tissue generally originates from WAT precursor cells or mature white adipocytes under specific stimuli (e.g., cold exposure, exercise, or β3-Adrenoceptor agonists CL 316,243 (hereafter referred to as CL)), undergoing “browning” or “beigeing”; this process has been extensively studied in mice [12,13]. Throughout this process, the rise in mitochondrial quantity and the elevated expression of UCP1 within these cells demonstrate thermogenic characteristics comparable to those of BAT [14]. Unlike BAT, however, when the specific stimulus subsides, its thermogenic capacity can reversibly decrease, reverting to a WAT-like state [15,16]. WAT is now recognized as a significant endocrine organ, secreting a diverse array of adipokines. These include both well-established ones like leptin and adiponectin, and more recently identified factors such as asprosin (ASP), meteorin, and neuroregulin 4 [17]. These adipokines have been demonstrated in humans and model organisms such as mice to regulate systemic metabolic homeostasis through endocrine and paracrine mechanisms. Given the scarcity of BAT in adult large mammals like humans and ruminants, the browning of WAT represents a key mechanism for body temperature regulation [18,19].
Recent studies have revealed that the protein pFBN1, encoded by the FBN1 gene, is secreted and immediately cleaved by furin, releasing both the FBN1 protein and the adipokine ASP [20]. FBN1 is a core structural component of extracellular matrix microfibrils, playing a crucial role in mechanical support and signaling regulation within connective tissue [21]. As a prototypical connective tissue, adipose tissue is abundant in the extracellular matrix and critically depends on its dynamic remodeling for proper function [22]. ASP was initially identified in patients with Neonatal Progeroid Syndrome (NPS) patients, who showed lower ASP levels owing to alterations in the FBN1 gene responsible for the ASP sequence. Consequently, this results in a phenotype characterized by adipose hypoplasia, extreme metabolic hyperactivity, and cachexia [23]. This syndrome results from mutations in the FBN1 gene, which reduces ASP levels [24]. The observed phenotype is characterized by reduced body fat levels and the occurrence of metabolic conditions, including impaired glucose tolerance and hepatic steatosis [25]. Elevated circulating ASP is now well-documented in individuals with obesity, a finding closely intertwined with the development of insulin resistance and increased adiposity [26,27,28,29]. Using CRISPR/Cas9 gene editing technology, FBN1NPS/+ mouse and rabbit models were constructed, recapitulating the phenotypic characteristics of NPS, with significant reductions in body weight and fat accumulation [30,31]. From a mechanistic perspective, ASP engages in metabolic control by stimulating the AMPK signaling cascade and inflammatory mediators (including TNF-α and IL-6) [32], while it modulates energy homeostasis via two distinct routes: (1) inhibiting thermogenesis, where ASP inhibits the Nrf2 pathway, downregulates the expression of thermogenic genes like PGC1α and UCP1, and induces mitophagy (via upregulation of PINK1/Parkin), thereby reducing mitochondrial function, inhibiting thermogenesis, and decreasing oxygen consumption and thermoregulation ability [33,34]; (2) promoting fat storage, where ASP enhances the expression of adipogenic genes (e.g., FASN, PPARγ), guiding metabolic substrates toward lipid synthesis rather than oxidative breakdown, indirectly suppressing thermogenesis [35]. These results indicate that ASP is crucial for thermogenesis and cold adaptation in animals. To date, this process has mainly been confirmed in model species such as mice and rabbits, whereas research involving larger animals, including sheep, is still comparatively scarce. Whether there are species-specific differences in its regulatory pathways still requires further investigation.
This study analyzed the scapular adipose tissue proteome of Sunite sheep, comparing winter and summer samples, which revealed significantly lower pFBN1 levels in winter. Given the metabolic regulatory role of its enzymatic product ASP in other species, we focused on its encoding gene (FBN1) and established a cell model with reduced FBN1 expression. We aimed to investigate ASP’s function in lipid metabolism, thereby elucidating its role in the cold adaptation of Sunite sheep. The aim of this study was to discover new physiological control mechanisms within the species, offering a theoretical foundation for the breeding of superior cold-resistant livestock and the enhancement of breeding techniques.

2. Materials and Methods

2.1. Collection of Adipose Tissue Samples

In January (winter) and July (summer) of the same year, three 18-month-old, healthy, castrated male Sunite sheep of similar weight were randomly selected from a pasture in Sunite Right Banner, Inner Mongolia, China (i.e., n = 3 independent biological replicates per season). After slaughter, subcutaneous adipose tissue was collected from the scapular region. The tissue samples were rinsed with physiological saline, gently blotted dry on sterile filter paper, and then dissected to remove visible fascia and blood vessels using sterile surgical scissors. Subsequently, the tissue was minced into small fragments of approximately 4 mm3. The fragments were transferred to cryopreservation tubes and snap-frozen in liquid nitrogen. The entire procedure from tissue collection to freezing was completed within 15 min.

2.2. Proteomic Sequencing and Bioinformatics Analysis

Proteomics sequencing was performed on subcutaneous adipose tissue samples collected from the scapular region of six Sunite sheep, with three samples collected in January and three in July. First, the adipose tissue was pulverized in liquid nitrogen, and total protein was isolated with a lysis buffer that included 1% Triton X-100 (Sigma Sangon Biotech, Shanghai, China) and a proteinase inhibitor (Merck Millipore, Darmstadt, Germany). After sonication and centrifugation, the supernatant was subjected to acetone precipitation (Hangzhou Hanno Chemicals, Hangzhou, China). The precipitate was reduced and alkylated, followed by overnight enzymatic digestion at 37 °C with trypsin (1:50, m/m) (Promega, Madison, WI, USA). The resulting peptides were separated on an EASY-nLC 1200 system (Thermo Fisher Scientific, Waltham, MA, USA) and subsequently analyzed via data-independent acquisition (DIA) on an Orbitrap ExplorisTM 480 mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). The mass spectrometry data underwent analysis with DIA-NN (v1.8), while GO annotation, GO enrichment, and KEGG pathway assessments were carried out utilizing resources including eggNOG (v5.0.2), Diamond (v2.0.11.149), and KEGG Mapper (v5.0).

2.3. Differential Protein Screening

Based on protein quantification data from three biological replicates per group, t-tests were performed to determine fold change (FC) and statistical significance (p-value) between winter and summer groups. Proteins with a fold change (FC) > 1.5 and a p-value < 0.05 were defined as significantly upregulated. Conversely, proteins with an FC less than 1/1.5 and a p-value under 0.05 were identified as significantly downregulated.

2.4. qRT-PCR

Total RNA was isolated from subcutaneous adipose tissue (or cells) collected during both winter and summer seasons using the TRNzol Universal Total RNA Extraction Reagent (TIANGEN, Beijing, China), following the supplier’s protocol. Complementary DNA (cDNA) was generated with the PrimeScriptTM RT Master Mix (TaKaRa, Beijing, China), employing a 2:1:7 ratio of enzyme-free water to RNA (800–1000 ng/μL) for the reverse transcription process. Gene expression was quantified by qRT-PCR using TB Green® Premix Ex TaqTM II (TaKaRa, Beijing, China) with ACTB as the internal control. The sequence-specific primers, synthesized by Sangon Biotech (Shanghai, China), are listed in Table 1, and relative expression levels were calculated via the 2−ΔΔCt method.

2.5. Prediction and Quantification of FBN1 Interacting miRNAs

Potential microRNAs (miRNAs) targeting the FBN1 gene were predicted using the online tool miRWalk (http://mirwalk.umm.uni-heidelberg.de/ (accessed on 30 June 2024)). The resulting prediction data (including potential binding sites) was downloaded for further analysis. miRNAs were identified through comparison against the sheep miRNA database. The sequence of the selected miRNA was queried using UGENE software (v.47.0). Binding sites were then predicted using the BiBiServ2 tool (https://bibiserv.cebitec.uni-bielefeld.de/tools (accessed on 30 June 2024)), and a miRNA with a high binding probability was selected to construct an overexpression lentiviral vector.
The miRNA was confirmed through quantitative PCR analysis. Reverse transcription was carried out with the miRNA Reverse Transcription Kit (GenScript Biotechnology, Nanjing, China) under the following thermal conditions: Following the reverse transcription procedure (37 °C for 60 min, 85 °C for 5 min, hold at 4 °C), qPCR was carried out in compliance with the protocol of the miRNA Quantitative PCR Kit (GenScript Biotechnology, Nanjing, China). The specific miRNA primers used are listed in Table 2. Cycle threshold (Ct) values were recorded for all samples, and relative gene expression fold changes were determined using the 2−ΔΔCt method. Statistical evaluation and graphical representation of the data were performed with Prism 10 software, applying methods such as t-tests.

2.6. Construction of the FBN1 Adipose-Derived Mesenchymal Stem Cell Model

A lentiviral overexpression vector targeting oar-mir-29b-1 (a negative regulator of FBN1) was constructed (GeneChem, Shanghai, China). Based on preliminary results, MOI = 40 and HiTransG P auxiliary dye were selected as transfection conditions. We introduced oar-mir-29b-1-overexpressing lentivirus (FBN1) into P3-passaged ADMSCs from Sunite sheep adipose tissue (sourced from our lab-based cell line) and then selected them using puromycin (1.5 μg/mL). Detailed procedures are outlined in Figure 1A. Control and experimental (FBN1) ADMSCs were prepared and passaged to P4 for subsequent use.
The cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Grand Island, NY, USA) supplemented, 10% fetal bovine serum (FBS, ExCell Bio, Shanghai, China) with 500 μL Penicillin-Streptomycin (Pen-Strep). The cell culture incubator (Thermo, Waltham, MA, USA) was maintained at 37 °C with 5% CO2.

2.7. Induction of Adipose-Derived Mesenchymal Stem Cell Differentiation

P4 ADMSCs were seeded at a uniform density and grown to approximately 95% confluence. Following an additional 48 h culture period, cells were induced to differentiate according to the scheme in Figure 1B. The specific media compositions for each differentiation pathway were as follows.
Induction of adipogenic differentiation (White Adipocytes):
The adipogenic protocol was adapted from an established protocol in our laboratory [36] and further optimized. The adipogenic differentiation medium consisted of high-glucose DMEM supplemented with 10% fetal bovine serum (FBS), 1 μM rosiglitazone (RSG), 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 μM dexamethasone (DEX), and 10 mg/L insulin (INS). Cells were subsequently maintained in an adipogenic maintenance medium (high-glucose DMEM with 10% FBS, 1 μM RSG, and 10 mg/L INS).
Browning induction treatment (thermogenic stimulation):
To induce browning in the differentiated white adipocytes, a protocol adapted from Chen et al. [34] was employed. For the final two days of adipogenic induction, the medium was replaced with a browning induction medium consisting of high-glucose DMEM containing 10% FBS plus 1 μM of the β3-adrenoceptor agonist CL 316,243 (hereafter referred to as CL).
Induction of brown-like adipocyte differentiation:
The brown adipocyte differentiation protocol was adapted from an established protocol in our laboratory [36] and further optimized. The brown adipocyte differentiation cocktail consisted of high-glucose DMEM with 10% FBS, 2 μM RSG, 0.5 mM IBMX, 5 μM DEX, 10 mg/L INS, 125 μM indomethacin (Indo), and 100 nM triiodothyronine (T3). The corresponding maintenance medium contained high-glucose DMEM with 10% FBS, 125 μM Indo, 100 nM T3, and 10 mg/L INS.
(All inducters were obtained from MedChemExpress (MCE, Monmouth Junction, NJ, USA). Cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2, using a CO2 incubator (model 3111, Thermo Fisher Scientific, Waltham, MA, USA). Fluorescence microscopy was performed using an Olympus SZX12 microscope).

2.8. Oil Red O Staining

Oil Red O staining was performed to assess lipid accumulation in differentiated cells using a commercial kit (Yuanye, Shanghai, China, Cat# R23104-4). Briefly, the Oil Red O working solution was freshly prepared before staining by mixing solutions B1 and B2 at a 3:2 ratio, followed by incubation for 20–40 min. Cell samples were fixed with 2 mL of the kit’s fixative for 20 min at room temperature, briefly rinsed with physiological saline, and air-dried. The cells were then immersed in 60% isopropanol for 30 s. Subsequently, they were incubated with the pre-prepared Oil Red O working solution (1 mL per dish) in the dark for 14 min. Excess stain was removed by brief rinsing with 60% isopropanol, followed by a gentle wash with physiological saline. Nuclei were counterstained with 1 mL of Mayer’s hematoxylin solution for 4 min. After hematoxylin removal, cells were incubated with 1 mL of the provided ORO (Oil Red O) buffer for 1 min, rinsed twice with distilled water, and air-dried. Stained samples were imaged under an Olympus SZX12 fluorescence microscope (Olympus, Tokyo, Japan).

2.9. TAG Content Measurement

Following induction, cells were collected and homogenized using an ultrasonic homogenizer (Sonics & Materials, Inc., Newtown, CT, USA). Intracellular triacylglycerol (TAG) content was quantified using a commercial TAG Assay Kit (Aidisheng Bio, Shanghai, China, Cat# ADS-W-ZF103) according to the manufacturer’s instructions. Briefly, after the addition of all reagents as specified, the reaction mixture was incubated at 25 °C for 30 min. Absorbance at 510 nm was measured using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA), after which TAG concentration was calculated using the provided standard curve.

2.10. Measurement of Non-Esterified Fatty Acid Content

After induction, cells were collected for homogenization using an ultrasonic disruptor for lysis. Intracellular non-esterified fatty acid (NEFA) content was quantified using a commercial assay kit (Aidisheng Bio, Shanghai, China, Cat# ADS-W-ZF001-96) according to the manufacturer’s instructions. Briefly, samples and standards were mixed with Reagent 1 in a 96-well plate and incubated at 37 °C for 5 min in a microplate reader. The initial absorbance (A1) at 546 nm was measured. Then, Reagent 2 was added. After mixing well, the plate was incubated at 37 °C for 10 min before the final absorbance (A2) was measured at 546 nm. The NEFA concentration was calculated using the formula provided with the kit.

2.11. Cell Immunofluorescence Staining

Following adipocyte differentiation induction, cells were fixed with 4% paraformaldehyde (Biosharp, Beijing, China) for 30 min. After three 5 min PBS washes, the cells were permeabilized with 0.1% TRITON X-100 (Biosharp, Beijing, China) for 20 min and washed again three times with PBS. Following a 30 min blocking step using 3% BSA (Sigma, St. Louis, MO, USA), the cells were incubated overnight at 4 °C with the primary antibody, Anti-UCP1 Rabbit pAb (1:200, GB112174, Servicebio, Wuhan, China). After three 5 min washes with PBS, cells underwent secondary antibody incubation with Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:300, GB112174, Servicebio) for 50 min at room temperature in the dark. After secondary antibody incubation and PBS washes, nuclei were counterstained with DAPI (Servicebio, China) for 10 min at room temperature in the dark. After washing, autofluorescence was reduced by treating the samples with Autofluorescence Quenching Reagent B (Servicebio, China) for 5 min. A final 10 min wash under running water was then performed prior to mounting for microscopy. Image capture after mounting (Upright Fluorescence Microscope (Nikon Eclipse Ci, Tokyo, Japan): DAPI with excitation wavelengths of 330–380 nm and 420 nm; 488 with excitation wavelengths of 465–495 nm and emission wavelengths of 515–555 nm.
Immunofluorescence images were acquired using a confocal microscope under standardized imaging parameters. Quantitative analysis was performed using ImageJ software (version 1.54f; National Institutes of Health, Bethesda, MD, USA). After background subtraction, all images were subjected to a uniform threshold for segmentation. The mean fluorescence intensity of UCP1 was subsequently quantified within the segmented cellular regions. To account for potential inter-experimental variation, fluorescence intensity data from each independent experiment were normalized to the respective control and presented as relative fluorescence intensity. Data were derived from at least three independent biological replicates and were expressed as the mean ± standard error of the mean (SEM).

2.12. Statistical Analysis

All statistical analyses were performed using GraphPad Prism 10 (GraphPad Software, Boston, MA, USA). Data were presented as the mean ± SEM from at least three independent biological replicates (n ≥ 3). Differences between groups were assessed by unpaired two-tailed Student’s t-tests. A p-value of less than 0.05 was considered statistically significant, denoted as follows: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001; ns, not significant.

3. Results

3.1. Sunite Sheep Adipose Proteomics Reveals Seasonal Reprogramming of Energy and Thermogenesis

A proteomic investigation was carried out on scapular adipose tissue obtained from mature Sunite sheep in the winter (January) and summer (July) seasons. Proteins showing differential expression were identified using a significance threshold of p-value < 0.05, with a fold change (FC) > 1.5 indicating significant upregulation and FC < 1/1.5 representing significant downregulation. A total of 925 differentially expressed proteins (432 upregulated, 493 downregulated) were identified. A global analysis of the differential expression profile (Figure 2B) revealed 10 significantly altered proteins, 7 of which are associated with adipogenesis and thermogenesis. The most significantly downregulated protein was pFBN1 (Uniprot ID: W5QIN8), which is cleaved by furin protease to release the active adipokine ASP (C-terminus, 140 aa) [20]. Results from qPCR analysis confirmed that FBN1 mRNA levels in adipose tissue were significantly lower in winter than in summer (Figure 2A, p < 0.05). Consistent with this, proteomics data also revealed a significant reduction in pFBN1 protein abundance during winter (Figure 2B) (p < 0.05). Taken together, the results suggest a suppression of the ASP biosynthesis pathway at the levels of both transcriptional and translational precursors throughout winter.
To elucidate the biological roles of the DEPs, comprehensive annotation and enrichment analyses were conducted across multiple dimensions. In the GO annotation bar chart (Figure 2C), the DEPs were primarily linked to biological processes such as organic substance metabolism, cellular metabolic processes, regulation of biological processes, primary metabolic processes, and nitrogen compound metabolism. In the GO enrichment Circos plot (Figure 2D), DEPs were enriched in cellular components with a high number of upregulated proteins, including mitochondrial ribosomes, organelle ribosomes, organelle inner membranes, mitochondrial inner membranes, mitochondrial membranes, mitochondrial envelopes, mitochondrial protein complexes, mitochondrial matrices, and ribosomal structural components. Significantly enriched biological pathways included mitochondrial translation elongation, mitochondrial translation termination, translation termination, and oxidative phosphorylation. The GO functional annotation and enrichment significance analysis indicated that, during the cold adaptation process in winter, Sunite sheep’s adipose tissue primarily activates energy mobilization and temperature adaptation.
In the proteomic analysis, pFBN1 was also annotated in the top five biological processes in the GO categories mentioned above (including sub-items under Other) (see table annotation on the right of Figure 2C). Additionally, there were 10 potential biological processes related to cold adaptation, ranked by their potential: small molecule metabolic processes (other), organization or biogenesis of cellular components, anatomical structure development, multicellular organism development, cellular response to stimuli, biological process regulation, positive regulation of cellular protein metabolism (other), molecular function regulation (other), cell communication, and signal transfection (other). Additionally, pFBN1 showed enrichment in the previously mentioned GO functional categories, suggesting its potential involvement in adaptive regulatory processes triggered by cold exposure.
KEGG pathway enrichment analysis using bubble and bar charts revealed significant enrichment of DEPs in the spliceosome, oxidative phosphorylation, thermogenesis, peroxisome, and fatty acid biosynthesis pathways (Figure 3A,B). These pathways coordinated the regulation of winter adaptive strategies through energy-thermogenesis synergy, lipid metabolism reprogramming, and gene expression regulation.

3.2. Inhibition of Adipogenesis by Low Expression of FBN1

Research showed that pFBN1 was cleaved by furin, resulting in the production of FBN1 protein and the adipokine ASP in humans and mice. Therefore, this study aimed to explore the potential functions of ASP. However, due to the lack of commercially available ASP antibodies for sheep, this study initially focused on its encoding gene, systematically investigating the regulatory role of FBN1 in the adipogenic and thermogenic differentiation of adipocytes.
To investigate the proteolytic processing of the pFBN1 protein and the potential functions of its products (such as ASP), this study utilized ADMSCs with low FBN1 expression (FBN1) to systematically analyze the regulatory role of FBN1 in adipocyte differentiation toward lipogenesis and thermogenesis. Using the BiBiServ2 tool, we predicted the binding sites of these miRNAs (oar-miR-29b and oar-let-7d) on FBN1 (Figure 4A). Subsequently, candidate miRNAs were prioritized based on two key criteria: the minimum free energy (mfe) of the miRNA-FBN1 duplex (indicating binding stability) and their endogenous expression levels in relevant tissues. Given its low endogenous expression levels (Figure 4H), oar-miR-29b was overexpressed in ADMSCs to target and downregulate FBN1. The lentivirus containing the overexpressed miRNA (oar-mir-29b-1) was used for transfection, and puromycin selection was applied to obtain positive cells. Identifying miRNA (oar-mir-29b-1) and FBN1 expression in both the control and FBN1 groups showed that the experimental group (FBN1) had increased levels of oar-mir-29b-1 (Figure 4I) and decreased levels of FBN1 (Figure 4J). Representative micrographs illustrated the morphology and transfection efficiency of both control and FBN1 low expression (FBN1) ADMSCs. Specifically, in the control group (P3) (Figure 4B; scale bar: 500 µm), cells exhibited typical mesenchymal stem cell morphology under brightfield illumination 72 h post-transfection (Figure 4C; scale bar: 500 µm). The cell state remained unchanged from before lentiviral treatment. The corresponding darkfield image (Figure 4D) showed strong green fluorescence, indicating high transfection efficiency. For the FBN1 group, cell morphology prior to infection is shown in Figure 4E. At 72 h post-infection, the brightfield image (Figure 4F) revealed that the cells maintained morphology and adherence comparable to the control group (scale bar: 500 µm), suggesting that lentiviral infection and FBN1 low expression did not adversely affect basic cellular health. The corresponding darkfield image (Figure 4G) also confirmed highly efficient transfection.
To evaluate the effect of FBN1 on lipid biogenesis, adipocyte differentiation was induced in ADMSCs derived from both the Experimental and Control groups. On day 8 following induction, Oil Red O staining revealed a significant decrease in lipid droplets in the FBN1 group compared to the Control group (Figure 5A). The levels of key adipogenic marker genes (FASN, ACACA, and FABP4) were markedly reduced in the FBN1 group (Figure 5B). Analysis of intracellular TAG content revealed a significant decrease inintracellular TAG concentrations within the FBN1 group (Figure 5C).

3.3. Low Expression of FBN1 Potentiates the Browning Process in β3-Adrenoceptor Agonist-Stimulated White Adipocytes

The introduction mentions that studies have shown that low expression of ASP encoded by the FBN1 gene in mice could promote browning. Therefore, we used the β3-adrenergic receptor agonist CL to stimulate the browning and thermogenic program in terminally differentiated Sunite sheep white adipose tissue cells. After successful browning induction using CL (1 μM), Oil Red O staining showed (Figure 6A) that, compared to the Control group, the FBN1 group displayed smaller and fewer lipid droplets, indicating that reduced FBN1 expression significantly suppressed lipid accumulation under browning conditions.
At the level of gene expression (Figure 6B), qRT-PCR analysis revealed that under CL stimulation, the mRNA levels of key thermogenic marker genes (UCP1, CIDEA, PGC-1α, Dio2, and SCD1) were all significantly upregulated in the FBN1 group compared to the control group (normalized to ACTB, n = 3 per group; p < 0.01). At the protein level, quantitative immunofluorescence analysis further confirmed (Figure 6D,E) that the UCP1 protein fluorescence intensity in FBN1group cells was significantly higher than that in the control group (n = 3 independent experiments). Furthermore, metabolite analysis revealed that FBN1 also enhanced the lipolysis process. Intracellular NEFA levels were significantly elevated in the FBN1 group (Figure 6C, n = 3 per group; p < 0.01). In summary, in mature white adipocytes, FBN1 knockdown cooperated with β3-adrenergic agonist stimulation to synergistically enhance thermogenic gene expression, UCP1 protein synthesis, and lipid catabolism.

3.4. Low Expression of FBN1 Promotes a Thermogenic Phenotype During Directed Differentiation of ADMSCs

To investigate the role of FBN1 in early adipocyte fate determination, we reduced FBN1 expression in ADMSCs and directed their differentiation using a brown adipocyte induction cocktail. By comparing FBN1 cells with the control group under identical induction conditions, we assessed the impact of FBN1 low expression on thermogenic efficiency. The results demonstrated that FBN1 low expression significantly potentiated the stem cells’ response to thermogenic induction. Oil Red O staining revealed that FBN1 cells contained smaller, more dispersed lipid droplets. (Figure 7A). qRT-PCR analysis of thermogenic marker gene (normalized to ACTB) revealed a substantial increase in UCP1, CIDEA, PGC-1α, Dio2, and SCD1 in the FBN1 group (Figure 7B; n = 3 per group). Concurrently, intracellular NEFA levels were synergistically elevated (* p < 0.05, Figure 7C; n = 3), and immunofluorescence quantification confirmed a significant upregulation of UCP1 protein expression. (Figure 7D,E; quantification based on n = 3 independent experiments).
In summary, reducing FBN1 expression enhanced thermogenesis in both mature adipocytes and differentiating ADMSCs, which established it as a key negative regulator across these physiological contexts. Notably, the thermogenic effect of FBN1 downregulation was more pronounced with CL 316,243 stimulation than with the standard brown adipocyte induction protocol, underscoring the potent synergy between β3-adrenergic signaling and reduced FBN1.

4. Discussion

The cold adaptation mechanisms of Sunite sheep hold the key to improving cold resistance in livestock. While adaptive thermogenesis is a key strategy for mammals to maintain energy homeostasis in cold environments, the specific molecular pathways driving this process in Sunite sheep are not yet fully understood. This study integrated proteomics, bioinformatics analysis, and cellular functional experiments to systematically analyze the molecular basis of the seasonal remodeling of subcutaneous fat in the shoulder region of the Sunite sheep.
Proteomic profiling identified significant seasonal variations in adipose tissue, with 432 upregulated and 493 downregulated proteins. It was also found that Profibrillin-1 (pFBN1; Log2Ratio = −2.746, p = 0.03) was one of the significantly downregulated proteins. After proteolytic cleavage, pFBN1 generated FBN1 protein and bioactive peptide fragments Asprosin (ASP) [20]. FBN1 primarily functioned as a structural component of the extracellular matrix; ASP, on the other hand, was an adipokine that played a crucial regulatory role in adipocyte differentiation and lipid metabolism. Therefore, this study established a model of ADMSCs with low expression of the encoding gene FBN1. The results indicated that it inhibited fat storage and promoted thermogenesis, consistent with reports of reduced active ASP levels in the adipose tissue of cold-exposed mice [34]. The deduction was that decreased ASP production in adipose tissue in winter played a crucial role in Sunite sheep’s adaptive heat production, prompting a transition in fat metabolism from storing fat to generating heat.
Additionally, this change in pFBN1 was not an isolated event, but rather part of a systemic metabolic reprogramming in adipose tissue to adapt to the cold. Bioinformatics analysis of all differentially expressed proteins indicated that winter adipose tissue undergoes a coordinated shift towards enhanced energy metabolism and thermogenesis. GO functional annotation revealed that the top five biological processes were closely associated with energy production and thermogenesis, including organic substance metabolism (covering glycolysis, TCA cycle, fatty acid β-oxidation, and TAG breakdown), cellular metabolism (energy/substrate conversion), and nitrogen compound metabolism. Upregulated proteins were significantly enriched for mitochondrial functions and components, highlighting the central role of mitochondria in cold adaptation. KEGG pathway enrichment analysis further confirmed these findings, with pathways significantly enriched in oxidative phosphorylation, thermogenesis, peroxisomal pathways, and fatty acid biosynthesis. This indicated that winter subcutaneous adipose tissue underwent significant metabolic reprogramming, potentially involving WAT browning, to meet the increased thermogenic demand and maintain energy balance [37,38]. These findings aligned with established cold adaptation models: research by Cannon et al. and Bartelt et al. had confirmed that short-term cold exposure rapidly promoted organic metabolism to quickly respond to environmental changes [39,40]. After a few hours of cold exposure, the body increased thermogenesis by activating thermogenic adipose tissues. This process involved the rapid activation of oxidative phosphorylation pathways (such as a 40% increase in Complex IV activity within 6 h), which was a core mechanism of early thermogenesis [41,42]. Enrichment of fatty acid biosynthesis pathways (e.g., significant elevation of ACACA activity after 2 weeks of cold exposure) reflected the body’s long-term adaptive strategy to achieve energy homeostasis through lipid storage reconstruction [43,44]. The results of the above analysis suggest that WAT browning could be an important mechanism for cold adaptation in Sunite sheep during winter, and that this process may be regulated through multiple levels of control to cope with cold stress.
At the same time, it was discovered that the seasonal downregulation of pFBN1 occurs synchronously with overall metabolic reprogramming. Although one of pFBN1′s enzymatic products—FBN1 protein—was primarily a structural component of the extracellular matrix, another proteolytic product, ASP, has been confirmed by multiple studies as a key regulatory hub for fat storage and browning. Miao et al. were the first to report the regulatory role of ASP in the energy storage function and browning of WAT [33]. Yin et al. further discovered that knocking out ASP promoted weight loss in mice and enhanced browning of white adipocytes [45]. Chen et al. found that ASP facilitated the browning process by promoting mitophagy, highlighting its core position in regulating thermogenesis [34]. These investigations collectively indicate that ASP could function as a pivotal regulatory node in controlling adipocyte destiny—its diminished expression not only suppressed the energy storage capacity of WAT but also encouraged the transformation of white adipocytes into beige adipocytes when exposed to cold stimulation or β3-adrenergic agonist (CL) environments, consequently boosting thermogenic activity [46].
More importantly, we also confirmed this in a cellular model with low expression of the coding gene FBN1, demonstrating that it suppressed fat storage while activating thermogenic pathways. Specifically, during the differentiation of ADMSCs into white adipocytes, the FBN1 group as exhibited reduced lipid droplet formation (as evidenced by Oil Red O staining), decreased intracellular TAG content, and downregulated expression of key adipogenic markers (FASN, ACACA, FABP4) compared to the control group. downregulation. During the browning induction process, FBN1 downregulation functioned as a sensitizer to β3-adrenergic stimulation in mature white adipocytes. When co-treated with CL 316,243, FBN1 cells exhibited a dramatically amplified thermogenic response compared to controls. This was evidenced not only by the enhanced induction of canonical thermogenic genes (UCP1, CIDEA, PGC-1α, Dio2, SCD1) and protein but also by a metabolic shift towards increased lipolysis, as indicated by elevated NEFA levels and reduced lipid droplet size. This indicated that FBN1 functioned to constrain the cellular response to canonical browning stimuli. More significantly, we found that the role of FBN1 extended to the early determination of adipocyte fate. In ADMSCs subjected to a pro-thermogenic differentiation cocktail, reducing FBN1 expression alone was sufficient to strongly bias differentiation towards a thermogenic phenotype. Even in this directed context, FBN1 group displayed hallmark features of beige/brown adipocytes—including a transcriptomic shift, elevated UCP1 protein, a fragmented lipid droplet morphology, and heightened lipolytic activity—more robustly than controls. Notably, the thermogenic potentiation was more pronounced in the mature adipocyte model with CL 316,243 stimulation than in the induced ADMSC model, underscoring the synergistic power of combining FBN1 reduction with acute adrenergic signaling. In Sunite sheep, this regulatory network might be critically important for adaptation. The seasonal or environmentally induced periodic decrease in FBN1/ASP levels could serve as a key switch, promoting the transformation of adipose tissue towards a heat-producing, energy-dissipating phenotype. This would be vital for fulfilling elevated energy demands and maintaining thermostatic balance during cold winters. Our study thus identified the FBN1–ASP axis as a novel and potent endogenous regulator of adipocyte thermogenesis in livestock, with implications for understanding adaptive metabolism and potential agricultural application
In summary, the winter cold stress response in Sunite sheep is the result of multi-level regulation, and ASP may be one of the key influencing factors. The innovation of this study lies in the first-time revelation of the potential core role of pFBN1/ASP in cold-adaptive fat remodeling in Sunite sheep, and the functional verification of the bidirectional regulatory effect of FBN1 downregulation using the ADMSCs model. This finding not only expands our understanding of mammalian environmental adaptation, especially the regulatory mechanism of local adipose tissue plasticity in ruminants, but also provides new potential molecular targets for livestock breeding for cold resistance. But there are still some constraints associated with this research. Initially, the study gathered merely 3 sheep during both the winter and summer seasons from one area, with both the area of sampling and the size of the sample being comparatively small. Subsequent research ought to increase the number of samples to more thoroughly confirm the seasonal fluctuations of pFBN1 and its possible ASP expression. Furthermore, despite the elucidation of FBN1 downregulation’s role in cellular models, there is a lack of ASP antibodies in sheep and direct evidence from in vivo interventions at the whole animal level (such as knockdown or overexpression of ASP). Additionally, potential environmental factors, such as exercise and feeding behavior, which may influence ASP expression and thermogenic effects, have not been excluded. Future research should include more controlled experiments to further investigate these effects.

5. Conclusions

Analysis of the scapular fat proteome in Sunite sheep across seasons identified DEPs significantly enriched in biological processes related to energy metabolism and thermogenesis, highlighting key pathways such as spliceosomes, oxidative phosphorylation, and fatty acid biosynthesis. During this procedure, the key precursor protein of the ASP, pFBN1, was found to be significantly downregulated. Further cellular function experiments showed that downregulating the expression of its encoding gene FBN1 could bidirectionally regulate adipocyte fate: a decrease in FBN1 expression promoted a thermogenic phenotype in differentiating adipose-derived mesenchymal stem cells and enhanced the thermogenic response (browning) of white adipocytes, while concurrently suppressing canonical white adipocyte differentiation. In conclusion, the FBN1 gene appeared crucial for Sunite sheep’s cold adaptation by modulating adipose tissue remodeling: it helped reduce energy storage and promote thermogenic energy expenditure. This finding provided novel insights into the molecular mechanisms of cold adaptation in sheep. The FBN1–ASP axis might be a key target for enhancing cold resistance, providing a theoretical basis for genetic improvement and stress-resilience breeding of sheep.

Author Contributions

F.M.: Conceptualization, Supervision, Methodology, Writing—review and editing, Resources, Project administration, Funding acquisition. Y.Z.: Conceptualization, Methodology, Software, Validation, Formal analysis, Investigation, Writing—original draft, Data curation, Visualization Funding acquisition. C.H.: Writing—original draft, Visualization, Validation, Data curation, Conceptualization, Software. M.Z.: Validation, Data curation, Software, Writing—review and editing. L.W.: Conceptualization, Funding acquisition, Methodology. L.C.: Methodology, Conceptualization. X.Z.: Visualization. T.Z.: Methodology. H.X.: Resources, Supervision, Methodology. W.Z.: Resources, Methodology. D.Z.: Methodology, Supervision, Resources, Funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

Department of Science and Technology of Inner Mongolia Autonomous Region (Inner Mongolia Autonomous Region Natural Science Foundation, 2025MS03132; Science and Technology Program Projects of the Inner Mongolia Autonomous Region, 2025KYPT0100). Department of Education of Inner Mongolia Autonomous Region (Inner Mongolia Autonomous Region Graduate Student Research Innovation Project, KC2024029S).

Institutional Review Board Statement

The study was conducted in accordance with the guidelines of the Declaration of Helsinki and was authorized by the Ethics Committee of INNER MONGOLIA AGRICULTURAL UNIVERSITY EXPERIMENTAL ANIMAL WELFARE AND ETHICS COMMITTEE (protocol code NND2021100 and 10 November 2021).

Data Availability Statement

The findings presented in this research are accessible from the corresponding author upon submission of a reasonable request. The mass spectrometry proteomics data have been submitted to the Proteomexchange Consortium (https://proteomecentral.proteomexchange.org (accessed on 7 June 2024) through the iProX partner repository under the dataset identifier PXD050546.

Acknowledgments

We express our sincere appreciation to every participant for their involvement in choosing topics, developing the research framework, conducting experimental investigations, analyzing data, and providing financial backing.

Conflicts of Interest

The authors affirm that no financial or personal connections with individuals or entities have unduly impacted the findings of this research. No professional or commercial affiliations exist that could be interpreted as potential conflicts of interest. Additionally, the data detailed in this investigation are accessible upon reasonable inquiry directed to the corresponding author.

Abbreviations

BATBrown adipose tissue
WATWhite adipose tissue
TAGTriacylglycerol
UCP1Uncoupling Protein 1
ASPAsprosin
pFBN1Profibrillin-1
FBN1Fibrillin-1
NPSNeonatal Progeroid Syndrome
mRNAMessenger RNA
GOGene Ontology
KEGGKyoto Encyclopedia of Genes and Genomes
IBMX3-isobutyl-1-methyl-7H-xanthine
CLβ3-Adrenoceptor agonists
ACTBActin beta
FASNFatty acid synthase
ACACAAcetyl-CoA carboxylase alpha
FABP4Fatty acid binding protein 4
CIDEACell Death-Inducing DNA Fragmentation Factor Alpha-like Effector A
PGC-1αPeroxisome Proliferator-Activated Receptor Gamma Coactivator 1 Alpha
Dio2Iodothyronine Deiodinase 2
SCD1Stearoyl-CoA Desaturase 1

References

  1. Reverte-Salisa, L.; Siddig, S.; Hildebrand, S.; Yao, X.; Zurkovic, J.; Jaeckstein, M.Y.; Heeren, J.; Lezoualc’h, F.; Krahmer, N.; Pfeifer, A. EPAC1 Enhances Brown Fat Growth and Beige Adipogenesis. Nat. Cell Biol. 2024, 26, 113–123. [Google Scholar] [CrossRef] [Scilit]
  2. Mota-Rojas, D.; Titto, C.G.; Orihuela, A.; Martínez-Burnes, J.; Gómez-Prado, J.; Torres-Bernal, F.; Flores-Padilla, K.; Carvajal-de la Fuente, V.; Wang, D. Physiological and Behavioral Mechanisms of Thermoregulation in Mammals. Animals 2021, 11, 1733. [Google Scholar] [CrossRef] [Scilit]
  3. Zhu, Q.; Glazier, B.J.; Hinkel, B.C.; Cao, J.; Liu, L.; Liang, C.; Shi, H. Neuroendocrine Regulation of Energy Metabolism Involving Different Types of Adipose Tissues. Int. J. Mol. Sci. 2019, 20, 2707. [Google Scholar] [CrossRef] [Scilit]
  4. Choe, S.S.; Huh, J.Y.; Hwang, I.J.; Kim, J.I.; Kim, J.B. Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders. Front. Endocrinol. 2016, 7, 30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Hussain, M.F.; Roesler, A.; Kazak, L. Regulation of Adipocyte Thermogenesis: Mechanisms Controlling Obesity. FEBS J. 2020, 287, 3370–3385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Porter, C.; Herndon, D.N.; Chondronikola, M.; Chao, T.; Annamalai, P.; Bhattarai, N.; Saraf, M.K.; Capek, K.D.; Reidy, P.T.; Daquinag, A.C.; et al. Human and Mouse Brown Adipose Tissue Mitochondria Have Comparable UCP1 Function. Cell Metab. 2016, 24, 246–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Liu, X.; Tang, J.; Zhang, R.; Zhan, S.; Zhong, T.; Guo, J.; Wang, Y.; Cao, J.; Li, L.; Zhang, H.; et al. Cold Exposure Induces Lipid Dynamics and Thermogenesis in Brown Adipose Tissue of Goats. BMC Genom. 2022, 23, 528. [Google Scholar] [CrossRef] [Scilit]
  8. Bertholet, A.M.; Natale, A.M.; Bisignano, P.; Suzuki, J.; Fedorenko, A.; Hamilton, J.; Brustovetsky, T.; Kazak, L.; Garrity, R.; Chouchani, E.T.; et al. Mitochondrial Uncouplers Induce Proton Leak by Activating AAC and UCP1. Nature 2022, 606, 180–187. [Google Scholar] [CrossRef] [Scilit]
  9. Jiao, D.; Ji, K.; Wang, W.; Liu, H.; Zhou, J.; Degen, A.A.; Zhang, Y.; Zhou, P.; Yang, G. Transcriptome Profiles of the Liver in Two Cold-Exposed Sheep Breeds Revealed Different Mechanisms and Candidate Genes for Thermogenesis. Genet. Res. 2021, 2021, 5510297. [Google Scholar] [CrossRef] [Scilit]
  10. Bordicchia, M.; Liu, D.; Amri, E.-Z.; Ailhaud, G.; Dessì-Fulgheri, P.; Zhang, C.; Takahashi, N.; Sarzani, R.; Collins, S. Cardiac Natriuretic Peptides Act via P38 MAPK to Induce the Brown Fat Thermogenic Program in Mouse and Human Adipocytes. J. Clin. Investig. 2012, 122, 1022–1036. [Google Scholar] [CrossRef] [Scilit]
  11. Golozoubova, V.; Cannon, B.; Nedergaard, J. UCP1 Is Essential for Adaptive Adrenergic Nonshivering Thermogenesis. Am. J. Physiol. Endocrinol. Metab. 2006, 291, E350–E357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Yang, S.; Liu, Y.; Wu, X.; Zhu, R.; Sun, Y.; Zou, S.; Zhang, D.; Yang, X. Molecular Regulation of Thermogenic Mechanisms in Beige Adipocytes. Int. J. Mol. Sci. 2024, 25, 6303. [Google Scholar] [CrossRef] [Scilit]
  13. Giordano, A.P.; Gambaro, S.E.; Alzamendi, A.; Harnichar, A.E.; Rey, M.A.; Ongaro, L.; Spinedi, E.; Zubiría, M.G.; Giovambattista, A. Dexamethasone Inhibits White Adipose Tissue Browning. Int. J. Mol. Sci. 2024, 25, 2714. [Google Scholar] [CrossRef] [Scilit]
  14. Ikeda, K.; Yamada, T. UCP1 Dependent and Independent Thermogenesis in Brown and Beige Adipocytes. Front. Endocrinol. 2020, 11, 498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Zhang, Y.-M.; Erdene, K.; Zhao, Y.-B.; Li, C.-Q.; Wang, L.; Tian, F.; Ao, C.-J.; Jin, H. Role of White Adipose Tissue Browning in Cold Seasonal Acclimation in Grazing Mongolian Sheep (Ovis aries). J. Therm. Biol. 2022, 109, 103333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Et, C.; S, K. Metabolic Adaptation and Maladaptation in Adipose Tissue. Nat. Metab. 2019, 1, 189–200. [Google Scholar] [CrossRef] [Scilit]
  17. Zhang, Y.L.; Long, M. Research progress of novel adipokines in obesity and type 2 diabetes mellitus. Chin. J. Clin. Res. 2023, 36, 1769–1775. [Google Scholar] [CrossRef]
  18. Zhao, L.; Yang, H.; Li, M.; Xiao, M.; Li, X.; Cheng, L.; Cheng, W.; Chen, M.; Zhao, Y. Global Gene Expression Profiling of Perirenal Brown Adipose Tissue Whitening in Goat Kids Reveals Novel Genes Linked to Adipose Remodeling. J. Anim. Sci. Biotechnol. 2024, 15, 47. [Google Scholar] [CrossRef] [Scilit]
  19. Basse, A.L.; Dixen, K.; Yadav, R.; Tygesen, M.P.; Qvortrup, K.; Kristiansen, K.; Quistorff, B.; Gupta, R.; Wang, J.; Hansen, J.B. Global Gene Expression Profiling of Brown to White Adipose Tissue Transformation in Sheep Reveals Novel Transcriptional Components Linked to Adipose Remodeling. BMC Genom. 2015, 16, 215. [Google Scholar] [CrossRef] [Scilit]
  20. Muthu, M.L.; Reinhardt, D.P. Fibrillin-1 and Fibrillin-1-Derived Asprosin in Adipose Tissue Function and Metabolic Disorders. J. Cell Commun. Signal. 2020, 14, 159–173. [Google Scholar] [CrossRef] [Scilit]
  21. Davis, M.R.; Summers, K.M. Structure and Function of the Mammalian Fibrillin Gene Family: Implications for Human Connective Tissue Diseases. Mol. Genet. Metab. 2012, 107, 635–647. [Google Scholar] [CrossRef] [Scilit]
  22. Mo, Y.-Y.; Han, Y.-X.; Xu, S.-N.; Jiang, H.-L.; Wu, H.-X.; Cai, J.-M.; Li, L.; Bu, Y.-H.; Xiao, F.; Liang, H.-D.; et al. Adipose Tissue Plasticity: A Comprehensive Definition and Multidimensional Insight. Biomolecules 2024, 14, 1223. [Google Scholar] [CrossRef] [Scilit]
  23. Yuan, M.; Li, W.; Zhu, Y.; Yu, B.; Wu, J. Asprosin: A Novel Player in Metabolic Diseases. Front. Endocrinol. 2020, 11, 64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Ovali, M.A.; Bozgeyik, I. Asprosin, a C-Terminal Cleavage Product of Fibrillin 1 Encoded by the FBN1 Gene, in Health and Disease. Mol. Syndr. 2022, 13, 175–183. [Google Scholar] [CrossRef] [Scilit]
  25. Greenhill, C. Liver: Asprosin-New Hormone Involved in Hepatic Glucose Release. Nat. Rev. Endocrinol. 2016, 12, 312. [Google Scholar] [CrossRef] [Scilit]
  26. Kim, S.-H.; Kim, S.E.; Chun, Y.H. The Association of Plasma Asprosin with Anthropometric and Metabolic Parameters in Korean Children and Adolescents. Front. Endocrinol. 2024, 15, 1452277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Cy, W.; Ta, L.; Kh, L.; Ch, L.; Yy, L.; Vc, W.; Ms, W.; Ts, Y. Serum Asprosin Levels and Bariatric Surgery Outcomes in Obese Adults. Int. J. Obes. 2019, 43, 1019–1025. [Google Scholar] [CrossRef] [Scilit]
  28. Ugur, K.; Aydin, S. Saliva and Blood Asprosin Hormone Concentration Associated with Obesity. Int. J. Endocrinol. 2019, 2019, 2521096. [Google Scholar] [CrossRef] [Scilit]
  29. Sünnetçi Silistre, E.; Hatipoğl, H.U. Increased Serum Circulating Asprosin Levels in Children with Obesity. Pediatr. Int. 2020, 62, 467–476. [Google Scholar] [CrossRef] [Scilit]
  30. Duerrschmid, C.; He, Y.; Wang, C.; Li, C.; Bournat, J.C.; Romere, C.; Saha, P.K.; Lee, M.E.; Phillips, K.J.; Jain, M.; et al. Asprosin Is a Centrally Acting Orexigenic Hormone. Nat. Med. 2017, 23, 1444–1453. [Google Scholar] [CrossRef] [Scilit]
  31. Chen, M.; Yao, B.; Yang, Q.; Deng, J.; Song, Y.; Sui, T.; Zhou, L.; Yao, H.; Xu, Y.; Ouyang, H.; et al. Truncated C-Terminus of Fibrillin-1 Induces Marfanoid-Progeroid-Lipodystrophy (MPL) Syndrome in Rabbit. Dis. Models Mech. 2018, 11, dmm031542. [Google Scholar] [CrossRef] [Scilit]
  32. Zhang, B.; Lu, J.; Jiang, Y.; Feng, Y. Asprosin Contributes to Nonalcoholic Fatty Liver Disease through Regulating Lipid Accumulation and Inflammatory Response via AMPK Signaling. Immun. Inflamm. Dis. 2023, 11, e947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Miao, Y.; Qin, H.; Zhong, Y.; Huang, K.; Rao, C. Novel Adipokine Asprosin Modulates Browning and Adipogenesis in White Adipose Tissue. J. Endocrinol. 2021, 249, 83–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Chen, S.; Yuan, W.; Huang, Q.; Xiong, X.; Wang, C.; Zeng, W.; Wang, L.; Huang, Y.; Liu, Y.; Wang, Y.; et al. Asprosin Contributes to Pathogenesis of Obesity by Adipocyte Mitophagy Induction to Inhibit White Adipose Browning in Mice. Int. J. Obes. 2024, 48, 913–922. [Google Scholar] [CrossRef] [Scilit]
  35. Zhang, Y.; Yang, P.; Zhang, X.; Liu, S.; Lou, K. Asprosin: Its Function as a Novel Endocrine Factor in Metabolic-Related Diseases. J. Endocrinol. Investig. 2024, 47, 1839–1850. [Google Scholar] [CrossRef] [Scilit]
  36. Wang, S.Y. Molecular Mechanisms of Cold Resistance in Mongolian Sheep Revealed by Adipose Tissue Transcriptome. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2022. [Google Scholar]
  37. Blaszkiewicz, M.; Johnson, C.P.; Willows, J.W.; Gardner, M.L.; Taplin, D.R.; Freitas, M.A.; Townsend, K.L. The Early Transition to Cold-Induced Browning in Mouse Subcutaneous White Adipose Tissue (scWAT) Involves Proteins Related to Nerve Remodeling, Cytoskeleton, Mitochondria, and Immune Cells. Adipocyte 2024, 13, 2428938. [Google Scholar] [CrossRef] [Scilit]
  38. Li, Y.; Shi, H.-X.; Li, J.; Du, H.; Jia, R.; Liang, Y.-H.; Huang, X.-Y.; Gao, X.-L.; Gun, S.-B.; Yang, Q.-L. Adaptive Thermogenesis and Lipid Metabolism Modulation in Inguinal and Perirenal Adipose Tissues of Hezuo Pigs in Response to Low-Temperature Exposure. Cells 2025, 14, 392. [Google Scholar] [CrossRef] [Scilit]
  39. Bartelt, A.; Bruns, O.T.; Reimer, R.; Hohenberg, H.; Ittrich, H.; Peldschus, K.; Kaul, M.G.; Tromsdorf, U.I.; Weller, H.; Waurisch, C.; et al. Brown Adipose Tissue Activity Controls Triglyceride Clearance. Nat. Med. 2011, 17, 200–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Cannon, B.; Nedergaard, J. Brown Adipose Tissue: Function and Physiological Significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef] [Scilit]
  41. Ikeda, K.; Kang, Q.; Yoneshiro, T.; Camporez, J.P.; Maki, H.; Homma, M.; Shinoda, K.; Chen, Y.; Lu, X.; Maretich, P.; et al. UCP1-Independent Signaling Involving SERCA2b-Mediated Calcium Cycling Regulates Beige Fat Thermogenesis and Systemic Glucose Homeostasis. Nat. Med. 2017, 23, 1454–1465. [Google Scholar] [CrossRef] [Scilit]
  42. Wu, J.; Boström, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.-H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige Adipocytes Are a Distinct Type of Thermogenic Fat Cell in Mouse and Human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Cohen, P.; Levy, J.D.; Zhang, Y.; Frontini, A.; Kolodin, D.P.; Svensson, K.J.; Lo, J.C.; Zeng, X.; Ye, L.; Khandekar, M.J.; et al. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell 2014, 156, 304–316. [Google Scholar] [CrossRef] [Scilit]
  44. Kopecky, J.; Clarke, G.; Enerbäck, S.; Spiegelman, B.; Kozak, L.P. Expression of the Mitochondrial Uncoupling Protein Gene from the aP2 Gene Promoter Prevents Genetic Obesity. J. Clin. Investig. 1995, 96, 2914–2923. [Google Scholar] [CrossRef] [Scilit]
  45. Yin, T.; Chen, S.; Zeng, G.; Yuan, W.; Lu, Y.; Zhang, Y.; Huang, Q.; Xiong, X.; Xu, B.; Huang, Q. Angiogenesis-Browning Interplay Mediated by Asprosin-Knockout Contributes to Weight Loss in Mice with Obesity. Int. J. Mol. Sci. 2022, 23, 16166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Yang, S.; Ma, H.; Wang, L.; Wang, F.; Xia, J.; Liu, D.; Mu, L.; Yang, X.; Liu, D. The Role of Β3-Adrenergic Receptors in Cold-Induced Beige Adipocyte Production in Pigs. Cells 2024, 13, 709. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Construction of the FBN1 Adipose-Derived Mesenchymal Stem Cell Model (A) Establishment of ADMSCs with reduced FBN1 expression by infecting Sunite sheep ADMSCs with lentivirus carrying an oar-miR-29b-1 overexpression construct. The schematic outlines key steps: cell seeding, lentiviral infection (using a mixture of virus, polybrene, and complete medium), puromycin selection, and expansion until confluence. (B) Methods for adipogenic differentiation, browning induction, and brown-like adipocyte differentiation in FBN1 and control ADMSCs.
Figure 1. Construction of the FBN1 Adipose-Derived Mesenchymal Stem Cell Model (A) Establishment of ADMSCs with reduced FBN1 expression by infecting Sunite sheep ADMSCs with lentivirus carrying an oar-miR-29b-1 overexpression construct. The schematic outlines key steps: cell seeding, lentiviral infection (using a mixture of virus, polybrene, and complete medium), puromycin selection, and expansion until confluence. (B) Methods for adipogenic differentiation, browning induction, and brown-like adipocyte differentiation in FBN1 and control ADMSCs.
Cells 15 00329 g001
Figure 2. Differential Protein Screening and GO Enrichment Analysis (A) Expression levels of FBN1 in adipose tissues during winter and summer by qRT-PCR. **** p < 0.0001 compared to the Control. (B) Volcano plot illustrating DEPs. The tables on the left and right sides of the figure display the top 5 most significantly upregulated proteins and the top 5 most significantly downregulated proteins. (C) Secondary Classification of GO Terms for DEPs. The table on the right side of the figure displays annotations to the GO entry where pFBN1 is located. (D) GO-enriched Circos plot for DEPs. Concentric visualization of GO enrichment analysis. From periphery to center: I. GO terms colored by functional domain (BP/CC/MF); II. DEP count and enrichment significance (−log10 p value, red gradient); III. Up/down-regulated DEP distribution (pink/blue bars); IV. Log2 fold enrichment intensity. The table on the right side of the figure shows GO entries significantly enriched in proteins whose expression is upregulated during winter.
Figure 2. Differential Protein Screening and GO Enrichment Analysis (A) Expression levels of FBN1 in adipose tissues during winter and summer by qRT-PCR. **** p < 0.0001 compared to the Control. (B) Volcano plot illustrating DEPs. The tables on the left and right sides of the figure display the top 5 most significantly upregulated proteins and the top 5 most significantly downregulated proteins. (C) Secondary Classification of GO Terms for DEPs. The table on the right side of the figure displays annotations to the GO entry where pFBN1 is located. (D) GO-enriched Circos plot for DEPs. Concentric visualization of GO enrichment analysis. From periphery to center: I. GO terms colored by functional domain (BP/CC/MF); II. DEP count and enrichment significance (−log10 p value, red gradient); III. Up/down-regulated DEP distribution (pink/blue bars); IV. Log2 fold enrichment intensity. The table on the right side of the figure shows GO entries significantly enriched in proteins whose expression is upregulated during winter.
Cells 15 00329 g002
Figure 3. KEGG enrichment analysis of DEPs reveals pathways associated with FBN1 downregulation. (A) Bubble chart illustrating the statistically enriched. The size of each bubble represents the number of DEPs mapped to the pathway, and the color indicates the significance level (−log10(p-value)). (B) Bar plot displaying the top 12 most significantly enriched KEGG pathways among the differentially expressed genes, ranked by their enrichment score (−log10(p-value)).
Figure 3. KEGG enrichment analysis of DEPs reveals pathways associated with FBN1 downregulation. (A) Bubble chart illustrating the statistically enriched. The size of each bubble represents the number of DEPs mapped to the pathway, and the color indicates the significance level (−log10(p-value)). (B) Bar plot displaying the top 12 most significantly enriched KEGG pathways among the differentially expressed genes, ranked by their enrichment score (−log10(p-value)).
Cells 15 00329 g003
Figure 4. Construction of FBN1 Low-Expressing ADMSCs. (A) Schematic prediction of binding sites for oar-miR-29b-1 and oar-let-7d at the 3′ untranslated region (3′-UTR) of the FBN1 gene. (BG) Morphology of control and FBN1 low expression ADMSCs. Images were taken at 40× magnification; scale bars: 500 µm. (B,E) Brightfield images of control (B) and experimental group (E) ADMSCs prior to lentiviral transfection. (C,F) Brightfield images at 72 h post-transfection. Both control (C) and FBN1 (F) cells maintained typical adherent mesenchymal stem cell morphology, indicating that the transfection process and the resultant overexpression of oar-miR-29b-1 via lentiviral treatment did not adversely affect cell viability or proliferative capacity. (D,G) Corresponding darkfield images showing robust green fluorescent protein (GFP) signal, confirming high transfection efficiency for oar-miR-29b-1 overexpression in both groups. (H) Relative expression levels of oar-miR-29b and let-7d in ADMSCs (n = 3). (I) Stem-loop qRT-PCR confirmed that oar-miR-29b-1 was successfully overexpressed, mediated by lentiviral transfection (**** p < 0.0001 vs. Control, n = 3). (J) Consistent with the targeting prediction, qRT-PCR analysis revealed a concomitant significant decrease in FBN1 mRNA levels (p < 0.0001). Data are presented as mean ± SEM. Statistical significance was determined using an unpaired Student’s t-test (**** p < 0.0001 vs. Control, n = 3).
Figure 4. Construction of FBN1 Low-Expressing ADMSCs. (A) Schematic prediction of binding sites for oar-miR-29b-1 and oar-let-7d at the 3′ untranslated region (3′-UTR) of the FBN1 gene. (BG) Morphology of control and FBN1 low expression ADMSCs. Images were taken at 40× magnification; scale bars: 500 µm. (B,E) Brightfield images of control (B) and experimental group (E) ADMSCs prior to lentiviral transfection. (C,F) Brightfield images at 72 h post-transfection. Both control (C) and FBN1 (F) cells maintained typical adherent mesenchymal stem cell morphology, indicating that the transfection process and the resultant overexpression of oar-miR-29b-1 via lentiviral treatment did not adversely affect cell viability or proliferative capacity. (D,G) Corresponding darkfield images showing robust green fluorescent protein (GFP) signal, confirming high transfection efficiency for oar-miR-29b-1 overexpression in both groups. (H) Relative expression levels of oar-miR-29b and let-7d in ADMSCs (n = 3). (I) Stem-loop qRT-PCR confirmed that oar-miR-29b-1 was successfully overexpressed, mediated by lentiviral transfection (**** p < 0.0001 vs. Control, n = 3). (J) Consistent with the targeting prediction, qRT-PCR analysis revealed a concomitant significant decrease in FBN1 mRNA levels (p < 0.0001). Data are presented as mean ± SEM. Statistical significance was determined using an unpaired Student’s t-test (**** p < 0.0001 vs. Control, n = 3).
Cells 15 00329 g004
Figure 5. Low expression of FBN1 suppresses adipogenesis in ADMSCs. (A) Representative Oil Red O staining of lipid droplets after 8 days of adipogenic induction (scale bars: 100 µm). Compared to the control cells (1), FBN1 cells (2) exhibited markedly reduced lipid accumulation. (B) qRT-PCR analysis of key adipogenic marker genes (e.g., FASN, FABP4). Expression levels were significantly downregulated in FBN1 low expression cells. (C) Quantitative measurement of intracellular TAG content, corroborating the staining results, showed a significant decrease in the FBN1 group. Data are presented as mean ± SEM. * p < 0. 05 vs. Control, n = 3 per group (unpaired t-test).
Figure 5. Low expression of FBN1 suppresses adipogenesis in ADMSCs. (A) Representative Oil Red O staining of lipid droplets after 8 days of adipogenic induction (scale bars: 100 µm). Compared to the control cells (1), FBN1 cells (2) exhibited markedly reduced lipid accumulation. (B) qRT-PCR analysis of key adipogenic marker genes (e.g., FASN, FABP4). Expression levels were significantly downregulated in FBN1 low expression cells. (C) Quantitative measurement of intracellular TAG content, corroborating the staining results, showed a significant decrease in the FBN1 group. Data are presented as mean ± SEM. * p < 0. 05 vs. Control, n = 3 per group (unpaired t-test).
Cells 15 00329 g005
Figure 6. Low expression of FBN1 promotes brownification and thermogenesis in white adipocytes of Sunite sheep. (A) Representative Oil Red O staining after 8-day browning induction (1 μM CL 316243, scale bars: 100 µm). Compared to the control cells (1), FBN1 low expression cells (2) exhibited markedly reduced lipid accumulation. (B) qRT-PCR analysis of key thermogenic markers (UCP1, CIDEA, PGC-1α, Dio2 and SCD1). Their mRNA levels were significantly upregulated in FBN1 adipocytes (*** p < 0.001, **** p < 0.0001 vs. Control; n = 3 per group). (C) Quantification of intracellular NEFA content. Levels were significantly elevated in the FBN1 group (** p < 0.01 vs. Control), indicating enhanced lipolysis. (D,E) Immunofluorescence analysis of UCP1 protein expression. (D) Quantitative analysis confirmed a significant increase in UCP1 fluorescence intensity in the FBN1 group compared to the control (* p < 0.05; n = 3). (E) Representative images (scale bar: 200 μm, Green: UCP1, Blue: DAPI). * Data are presented as mean ± SEM (unpaired t-test).
Figure 6. Low expression of FBN1 promotes brownification and thermogenesis in white adipocytes of Sunite sheep. (A) Representative Oil Red O staining after 8-day browning induction (1 μM CL 316243, scale bars: 100 µm). Compared to the control cells (1), FBN1 low expression cells (2) exhibited markedly reduced lipid accumulation. (B) qRT-PCR analysis of key thermogenic markers (UCP1, CIDEA, PGC-1α, Dio2 and SCD1). Their mRNA levels were significantly upregulated in FBN1 adipocytes (*** p < 0.001, **** p < 0.0001 vs. Control; n = 3 per group). (C) Quantification of intracellular NEFA content. Levels were significantly elevated in the FBN1 group (** p < 0.01 vs. Control), indicating enhanced lipolysis. (D,E) Immunofluorescence analysis of UCP1 protein expression. (D) Quantitative analysis confirmed a significant increase in UCP1 fluorescence intensity in the FBN1 group compared to the control (* p < 0.05; n = 3). (E) Representative images (scale bar: 200 μm, Green: UCP1, Blue: DAPI). * Data are presented as mean ± SEM (unpaired t-test).
Cells 15 00329 g006
Figure 7. FBN1 downregulation potentiated the thermogenic differentiation of ADMSCs under induction conditions. Lower FBN1 expression in Sunite sheep adipocytes promoted brown adipocyte formation. (A) Representative Oil Red O staining after brown adipogenic induction. In contrast to the control, FBN1 cells displayed a morphology characterized by fewer and smaller intracellular lipid droplets. (scale bars: 50 µm). (B) qRT-PCR analysis of key thermogenic marker genes (e.g., UCP1, CIDEA, PGC-1α, PRDM16). Their expression was significantly higher in the FBN1 group (**** p < 0. 0001, ** p < 0.01, * p < 0.05 vs. Control; n = 3). (C) Intracellular NEFA levels were significantly elevated in FBN1 brown adipocytes (* p < 0.05 vs. Control; n = 3), reflecting enhanced lipid mobilization (D,E) Immunofluorescence analysis confirmed enhanced UCP1 protein expression. (D) Quantitative analysis of fluorescence intensity (normalized to control, set as 1) demonstrated a significant increase in the FBN1 group (n = 3). (E) Representative images showing UCP1 (green) and DAPI (blue). * Data are presented as mean ± SEM (unpaired t-test).
Figure 7. FBN1 downregulation potentiated the thermogenic differentiation of ADMSCs under induction conditions. Lower FBN1 expression in Sunite sheep adipocytes promoted brown adipocyte formation. (A) Representative Oil Red O staining after brown adipogenic induction. In contrast to the control, FBN1 cells displayed a morphology characterized by fewer and smaller intracellular lipid droplets. (scale bars: 50 µm). (B) qRT-PCR analysis of key thermogenic marker genes (e.g., UCP1, CIDEA, PGC-1α, PRDM16). Their expression was significantly higher in the FBN1 group (**** p < 0. 0001, ** p < 0.01, * p < 0.05 vs. Control; n = 3). (C) Intracellular NEFA levels were significantly elevated in FBN1 brown adipocytes (* p < 0.05 vs. Control; n = 3), reflecting enhanced lipid mobilization (D,E) Immunofluorescence analysis confirmed enhanced UCP1 protein expression. (D) Quantitative analysis of fluorescence intensity (normalized to control, set as 1) demonstrated a significant increase in the FBN1 group (n = 3). (E) Representative images showing UCP1 (green) and DAPI (blue). * Data are presented as mean ± SEM (unpaired t-test).
Cells 15 00329 g007
Table 1. Gene primers for quantitative reverse transcription polymerase chain reaction.
Table 1. Gene primers for quantitative reverse transcription polymerase chain reaction.
Gene SymbolGene IDPrimerAnnealing Temperature (°C)Product Length (bp)
ACTB443052F:GGCATTCACGAAACTACCTT58180
R:GGGCGCGATGATCTTGA
FBN1101109620F:ACCTGAGATAGAAGCCAATGTG5898
R:TTCGGACCTTGTTACTGATGTG
UCP1494434F:CGCTGTTGTTGCTGGATTCTG5894
R:TGTGTACTGTCCTGGTGAAGAG
PGC-1α443270F:GTGCTGCTCTGGTTGGTGAA58167
R:TGAAGGCTCGTTGTTGTACTGA
Dio2100310793F:CGTGGCTGACTTCCTGTTGG58122
R:CGCATCGGTCTTCCTGGTTC
CIDEA101108619F:CCTTCCGTGTCTCCAACCAT58161
R:GAACTCCTCTGTGTCCACCA
SCD1443185F:ACTCGTGCCGTGGTATCTATG58152
R:GGTTGATGGTCTTGTCGTAAGG
FASN100170327F:GCTGCTCTGGAAGGACAACTG58118
R:GTGGATGTAGATGGCGGTGATG
ACACA443186F:GCAACATCACATCCGTCCTCT58188
R:GTCCATCACCACAGCCTTCAT
FABP4100137067F:TGAAGGTGCTCTGGTACAAGT58133
R:TGCTCTCTCGTAAACTCTGGTA
Table 2. miRNA primers for qRT-PCR 1.
Table 2. miRNA primers for qRT-PCR 1.
miRNA SymbolPrimer
oar-let-7dGCGGAGAGGTAGTAGGTTGCATAG
oar-miR-29bCCGCTAGCACCATTTGAAATCAGTGT
1 All primers were synthesized by Sangon Biotech, Co., Ltd. (Shanghai, China).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Meng, F.; Zi, Y.; Han, C.; Zhao, M.; Wang, L.; Chang, L.; Zhou, X.; Zhou, T.; Xiao, H.; Zhang, W.; et al. The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis. Cells 2026, 15, 329. https://doi.org/10.3390/cells15040329

AMA Style

Meng F, Zi Y, Han C, Zhao M, Wang L, Chang L, Zhou X, Zhou T, Xiao H, Zhang W, et al. The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis. Cells. 2026; 15(4):329. https://doi.org/10.3390/cells15040329

Chicago/Turabian Style

Meng, Fanhua, Yanyun Zi, Cong Han, Min Zhao, Lin Wang, Longwei Chang, Xinyu Zhou, Tong Zhou, Hongmei Xiao, Wenguang Zhang, and et al. 2026. "The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis" Cells 15, no. 4: 329. https://doi.org/10.3390/cells15040329

APA Style

Meng, F., Zi, Y., Han, C., Zhao, M., Wang, L., Chang, L., Zhou, X., Zhou, T., Xiao, H., Zhang, W., & Zhang, D. (2026). The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis. Cells, 15(4), 329. https://doi.org/10.3390/cells15040329

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop