The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis
Highlights
- The precursor protein of asprosin (pFBN1) was significantly downregulated in the adipose tissue of Sunite sheep during winter.
- Inhibition of the FBN1 gene in adipocytes not only impeded adipogenesis but also promoted the browning of white adipose tissue, enhancing thermogenesis.
- This study provides novel molecular targets for the selective breeding of sheep with improved cold tolerance.
- The findings offer fresh insights into the regulatory mechanisms of mammalian energy metabolism and adipose tissue adaptation.
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Adipose Tissue Samples
2.2. Proteomic Sequencing and Bioinformatics Analysis
2.3. Differential Protein Screening
2.4. qRT-PCR
2.5. Prediction and Quantification of FBN1 Interacting miRNAs
2.6. Construction of the FBN1 Adipose-Derived Mesenchymal Stem Cell Model
2.7. Induction of Adipose-Derived Mesenchymal Stem Cell Differentiation
2.8. Oil Red O Staining
2.9. TAG Content Measurement
2.10. Measurement of Non-Esterified Fatty Acid Content
2.11. Cell Immunofluorescence Staining
2.12. Statistical Analysis
3. Results
3.1. Sunite Sheep Adipose Proteomics Reveals Seasonal Reprogramming of Energy and Thermogenesis
3.2. Inhibition of Adipogenesis by Low Expression of FBN1
3.3. Low Expression of FBN1 Potentiates the Browning Process in β3-Adrenoceptor Agonist-Stimulated White Adipocytes
3.4. Low Expression of FBN1 Promotes a Thermogenic Phenotype During Directed Differentiation of ADMSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BAT | Brown adipose tissue |
| WAT | White adipose tissue |
| TAG | Triacylglycerol |
| UCP1 | Uncoupling Protein 1 |
| ASP | Asprosin |
| pFBN1 | Profibrillin-1 |
| FBN1 | Fibrillin-1 |
| NPS | Neonatal Progeroid Syndrome |
| mRNA | Messenger RNA |
| GO | Gene Ontology |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| IBMX | 3-isobutyl-1-methyl-7H-xanthine |
| CL | β3-Adrenoceptor agonists |
| ACTB | Actin beta |
| FASN | Fatty acid synthase |
| ACACA | Acetyl-CoA carboxylase alpha |
| FABP4 | Fatty acid binding protein 4 |
| CIDEA | Cell Death-Inducing DNA Fragmentation Factor Alpha-like Effector A |
| PGC-1α | Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1 Alpha |
| Dio2 | Iodothyronine Deiodinase 2 |
| SCD1 | Stearoyl-CoA Desaturase 1 |
References
- Reverte-Salisa, L.; Siddig, S.; Hildebrand, S.; Yao, X.; Zurkovic, J.; Jaeckstein, M.Y.; Heeren, J.; Lezoualc’h, F.; Krahmer, N.; Pfeifer, A. EPAC1 Enhances Brown Fat Growth and Beige Adipogenesis. Nat. Cell Biol. 2024, 26, 113–123. [Google Scholar] [CrossRef] [Scilit]
- Mota-Rojas, D.; Titto, C.G.; Orihuela, A.; Martínez-Burnes, J.; Gómez-Prado, J.; Torres-Bernal, F.; Flores-Padilla, K.; Carvajal-de la Fuente, V.; Wang, D. Physiological and Behavioral Mechanisms of Thermoregulation in Mammals. Animals 2021, 11, 1733. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Q.; Glazier, B.J.; Hinkel, B.C.; Cao, J.; Liu, L.; Liang, C.; Shi, H. Neuroendocrine Regulation of Energy Metabolism Involving Different Types of Adipose Tissues. Int. J. Mol. Sci. 2019, 20, 2707. [Google Scholar] [CrossRef] [Scilit]
- Choe, S.S.; Huh, J.Y.; Hwang, I.J.; Kim, J.I.; Kim, J.B. Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders. Front. Endocrinol. 2016, 7, 30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hussain, M.F.; Roesler, A.; Kazak, L. Regulation of Adipocyte Thermogenesis: Mechanisms Controlling Obesity. FEBS J. 2020, 287, 3370–3385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Porter, C.; Herndon, D.N.; Chondronikola, M.; Chao, T.; Annamalai, P.; Bhattarai, N.; Saraf, M.K.; Capek, K.D.; Reidy, P.T.; Daquinag, A.C.; et al. Human and Mouse Brown Adipose Tissue Mitochondria Have Comparable UCP1 Function. Cell Metab. 2016, 24, 246–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Tang, J.; Zhang, R.; Zhan, S.; Zhong, T.; Guo, J.; Wang, Y.; Cao, J.; Li, L.; Zhang, H.; et al. Cold Exposure Induces Lipid Dynamics and Thermogenesis in Brown Adipose Tissue of Goats. BMC Genom. 2022, 23, 528. [Google Scholar] [CrossRef] [Scilit]
- Bertholet, A.M.; Natale, A.M.; Bisignano, P.; Suzuki, J.; Fedorenko, A.; Hamilton, J.; Brustovetsky, T.; Kazak, L.; Garrity, R.; Chouchani, E.T.; et al. Mitochondrial Uncouplers Induce Proton Leak by Activating AAC and UCP1. Nature 2022, 606, 180–187. [Google Scholar] [CrossRef] [Scilit]
- Jiao, D.; Ji, K.; Wang, W.; Liu, H.; Zhou, J.; Degen, A.A.; Zhang, Y.; Zhou, P.; Yang, G. Transcriptome Profiles of the Liver in Two Cold-Exposed Sheep Breeds Revealed Different Mechanisms and Candidate Genes for Thermogenesis. Genet. Res. 2021, 2021, 5510297. [Google Scholar] [CrossRef] [Scilit]
- Bordicchia, M.; Liu, D.; Amri, E.-Z.; Ailhaud, G.; Dessì-Fulgheri, P.; Zhang, C.; Takahashi, N.; Sarzani, R.; Collins, S. Cardiac Natriuretic Peptides Act via P38 MAPK to Induce the Brown Fat Thermogenic Program in Mouse and Human Adipocytes. J. Clin. Investig. 2012, 122, 1022–1036. [Google Scholar] [CrossRef] [Scilit]
- Golozoubova, V.; Cannon, B.; Nedergaard, J. UCP1 Is Essential for Adaptive Adrenergic Nonshivering Thermogenesis. Am. J. Physiol. Endocrinol. Metab. 2006, 291, E350–E357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Liu, Y.; Wu, X.; Zhu, R.; Sun, Y.; Zou, S.; Zhang, D.; Yang, X. Molecular Regulation of Thermogenic Mechanisms in Beige Adipocytes. Int. J. Mol. Sci. 2024, 25, 6303. [Google Scholar] [CrossRef] [Scilit]
- Giordano, A.P.; Gambaro, S.E.; Alzamendi, A.; Harnichar, A.E.; Rey, M.A.; Ongaro, L.; Spinedi, E.; Zubiría, M.G.; Giovambattista, A. Dexamethasone Inhibits White Adipose Tissue Browning. Int. J. Mol. Sci. 2024, 25, 2714. [Google Scholar] [CrossRef] [Scilit]
- Ikeda, K.; Yamada, T. UCP1 Dependent and Independent Thermogenesis in Brown and Beige Adipocytes. Front. Endocrinol. 2020, 11, 498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.-M.; Erdene, K.; Zhao, Y.-B.; Li, C.-Q.; Wang, L.; Tian, F.; Ao, C.-J.; Jin, H. Role of White Adipose Tissue Browning in Cold Seasonal Acclimation in Grazing Mongolian Sheep (Ovis aries). J. Therm. Biol. 2022, 109, 103333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Et, C.; S, K. Metabolic Adaptation and Maladaptation in Adipose Tissue. Nat. Metab. 2019, 1, 189–200. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.L.; Long, M. Research progress of novel adipokines in obesity and type 2 diabetes mellitus. Chin. J. Clin. Res. 2023, 36, 1769–1775. [Google Scholar] [CrossRef]
- Zhao, L.; Yang, H.; Li, M.; Xiao, M.; Li, X.; Cheng, L.; Cheng, W.; Chen, M.; Zhao, Y. Global Gene Expression Profiling of Perirenal Brown Adipose Tissue Whitening in Goat Kids Reveals Novel Genes Linked to Adipose Remodeling. J. Anim. Sci. Biotechnol. 2024, 15, 47. [Google Scholar] [CrossRef] [Scilit]
- Basse, A.L.; Dixen, K.; Yadav, R.; Tygesen, M.P.; Qvortrup, K.; Kristiansen, K.; Quistorff, B.; Gupta, R.; Wang, J.; Hansen, J.B. Global Gene Expression Profiling of Brown to White Adipose Tissue Transformation in Sheep Reveals Novel Transcriptional Components Linked to Adipose Remodeling. BMC Genom. 2015, 16, 215. [Google Scholar] [CrossRef] [Scilit]
- Muthu, M.L.; Reinhardt, D.P. Fibrillin-1 and Fibrillin-1-Derived Asprosin in Adipose Tissue Function and Metabolic Disorders. J. Cell Commun. Signal. 2020, 14, 159–173. [Google Scholar] [CrossRef] [Scilit]
- Davis, M.R.; Summers, K.M. Structure and Function of the Mammalian Fibrillin Gene Family: Implications for Human Connective Tissue Diseases. Mol. Genet. Metab. 2012, 107, 635–647. [Google Scholar] [CrossRef] [Scilit]
- Mo, Y.-Y.; Han, Y.-X.; Xu, S.-N.; Jiang, H.-L.; Wu, H.-X.; Cai, J.-M.; Li, L.; Bu, Y.-H.; Xiao, F.; Liang, H.-D.; et al. Adipose Tissue Plasticity: A Comprehensive Definition and Multidimensional Insight. Biomolecules 2024, 14, 1223. [Google Scholar] [CrossRef] [Scilit]
- Yuan, M.; Li, W.; Zhu, Y.; Yu, B.; Wu, J. Asprosin: A Novel Player in Metabolic Diseases. Front. Endocrinol. 2020, 11, 64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ovali, M.A.; Bozgeyik, I. Asprosin, a C-Terminal Cleavage Product of Fibrillin 1 Encoded by the FBN1 Gene, in Health and Disease. Mol. Syndr. 2022, 13, 175–183. [Google Scholar] [CrossRef] [Scilit]
- Greenhill, C. Liver: Asprosin-New Hormone Involved in Hepatic Glucose Release. Nat. Rev. Endocrinol. 2016, 12, 312. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.-H.; Kim, S.E.; Chun, Y.H. The Association of Plasma Asprosin with Anthropometric and Metabolic Parameters in Korean Children and Adolescents. Front. Endocrinol. 2024, 15, 1452277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cy, W.; Ta, L.; Kh, L.; Ch, L.; Yy, L.; Vc, W.; Ms, W.; Ts, Y. Serum Asprosin Levels and Bariatric Surgery Outcomes in Obese Adults. Int. J. Obes. 2019, 43, 1019–1025. [Google Scholar] [CrossRef] [Scilit]
- Ugur, K.; Aydin, S. Saliva and Blood Asprosin Hormone Concentration Associated with Obesity. Int. J. Endocrinol. 2019, 2019, 2521096. [Google Scholar] [CrossRef] [Scilit]
- Sünnetçi Silistre, E.; Hatipoğl, H.U. Increased Serum Circulating Asprosin Levels in Children with Obesity. Pediatr. Int. 2020, 62, 467–476. [Google Scholar] [CrossRef] [Scilit]
- Duerrschmid, C.; He, Y.; Wang, C.; Li, C.; Bournat, J.C.; Romere, C.; Saha, P.K.; Lee, M.E.; Phillips, K.J.; Jain, M.; et al. Asprosin Is a Centrally Acting Orexigenic Hormone. Nat. Med. 2017, 23, 1444–1453. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Yao, B.; Yang, Q.; Deng, J.; Song, Y.; Sui, T.; Zhou, L.; Yao, H.; Xu, Y.; Ouyang, H.; et al. Truncated C-Terminus of Fibrillin-1 Induces Marfanoid-Progeroid-Lipodystrophy (MPL) Syndrome in Rabbit. Dis. Models Mech. 2018, 11, dmm031542. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Lu, J.; Jiang, Y.; Feng, Y. Asprosin Contributes to Nonalcoholic Fatty Liver Disease through Regulating Lipid Accumulation and Inflammatory Response via AMPK Signaling. Immun. Inflamm. Dis. 2023, 11, e947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miao, Y.; Qin, H.; Zhong, Y.; Huang, K.; Rao, C. Novel Adipokine Asprosin Modulates Browning and Adipogenesis in White Adipose Tissue. J. Endocrinol. 2021, 249, 83–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Yuan, W.; Huang, Q.; Xiong, X.; Wang, C.; Zeng, W.; Wang, L.; Huang, Y.; Liu, Y.; Wang, Y.; et al. Asprosin Contributes to Pathogenesis of Obesity by Adipocyte Mitophagy Induction to Inhibit White Adipose Browning in Mice. Int. J. Obes. 2024, 48, 913–922. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Yang, P.; Zhang, X.; Liu, S.; Lou, K. Asprosin: Its Function as a Novel Endocrine Factor in Metabolic-Related Diseases. J. Endocrinol. Investig. 2024, 47, 1839–1850. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.Y. Molecular Mechanisms of Cold Resistance in Mongolian Sheep Revealed by Adipose Tissue Transcriptome. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2022. [Google Scholar]
- Blaszkiewicz, M.; Johnson, C.P.; Willows, J.W.; Gardner, M.L.; Taplin, D.R.; Freitas, M.A.; Townsend, K.L. The Early Transition to Cold-Induced Browning in Mouse Subcutaneous White Adipose Tissue (scWAT) Involves Proteins Related to Nerve Remodeling, Cytoskeleton, Mitochondria, and Immune Cells. Adipocyte 2024, 13, 2428938. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Shi, H.-X.; Li, J.; Du, H.; Jia, R.; Liang, Y.-H.; Huang, X.-Y.; Gao, X.-L.; Gun, S.-B.; Yang, Q.-L. Adaptive Thermogenesis and Lipid Metabolism Modulation in Inguinal and Perirenal Adipose Tissues of Hezuo Pigs in Response to Low-Temperature Exposure. Cells 2025, 14, 392. [Google Scholar] [CrossRef] [Scilit]
- Bartelt, A.; Bruns, O.T.; Reimer, R.; Hohenberg, H.; Ittrich, H.; Peldschus, K.; Kaul, M.G.; Tromsdorf, U.I.; Weller, H.; Waurisch, C.; et al. Brown Adipose Tissue Activity Controls Triglyceride Clearance. Nat. Med. 2011, 17, 200–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cannon, B.; Nedergaard, J. Brown Adipose Tissue: Function and Physiological Significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef] [Scilit]
- Ikeda, K.; Kang, Q.; Yoneshiro, T.; Camporez, J.P.; Maki, H.; Homma, M.; Shinoda, K.; Chen, Y.; Lu, X.; Maretich, P.; et al. UCP1-Independent Signaling Involving SERCA2b-Mediated Calcium Cycling Regulates Beige Fat Thermogenesis and Systemic Glucose Homeostasis. Nat. Med. 2017, 23, 1454–1465. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Boström, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.-H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige Adipocytes Are a Distinct Type of Thermogenic Fat Cell in Mouse and Human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, P.; Levy, J.D.; Zhang, Y.; Frontini, A.; Kolodin, D.P.; Svensson, K.J.; Lo, J.C.; Zeng, X.; Ye, L.; Khandekar, M.J.; et al. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell 2014, 156, 304–316. [Google Scholar] [CrossRef] [Scilit]
- Kopecky, J.; Clarke, G.; Enerbäck, S.; Spiegelman, B.; Kozak, L.P. Expression of the Mitochondrial Uncoupling Protein Gene from the aP2 Gene Promoter Prevents Genetic Obesity. J. Clin. Investig. 1995, 96, 2914–2923. [Google Scholar] [CrossRef] [Scilit]
- Yin, T.; Chen, S.; Zeng, G.; Yuan, W.; Lu, Y.; Zhang, Y.; Huang, Q.; Xiong, X.; Xu, B.; Huang, Q. Angiogenesis-Browning Interplay Mediated by Asprosin-Knockout Contributes to Weight Loss in Mice with Obesity. Int. J. Mol. Sci. 2022, 23, 16166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Ma, H.; Wang, L.; Wang, F.; Xia, J.; Liu, D.; Mu, L.; Yang, X.; Liu, D. The Role of Β3-Adrenergic Receptors in Cold-Induced Beige Adipocyte Production in Pigs. Cells 2024, 13, 709. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene Symbol | Gene ID | Primer | Annealing Temperature (°C) | Product Length (bp) |
|---|---|---|---|---|
| ACTB | 443052 | F:GGCATTCACGAAACTACCTT | 58 | 180 |
| R:GGGCGCGATGATCTTGA | ||||
| FBN1 | 101109620 | F:ACCTGAGATAGAAGCCAATGTG | 58 | 98 |
| R:TTCGGACCTTGTTACTGATGTG | ||||
| UCP1 | 494434 | F:CGCTGTTGTTGCTGGATTCTG | 58 | 94 |
| R:TGTGTACTGTCCTGGTGAAGAG | ||||
| PGC-1α | 443270 | F:GTGCTGCTCTGGTTGGTGAA | 58 | 167 |
| R:TGAAGGCTCGTTGTTGTACTGA | ||||
| Dio2 | 100310793 | F:CGTGGCTGACTTCCTGTTGG | 58 | 122 |
| R:CGCATCGGTCTTCCTGGTTC | ||||
| CIDEA | 101108619 | F:CCTTCCGTGTCTCCAACCAT | 58 | 161 |
| R:GAACTCCTCTGTGTCCACCA | ||||
| SCD1 | 443185 | F:ACTCGTGCCGTGGTATCTATG | 58 | 152 |
| R:GGTTGATGGTCTTGTCGTAAGG | ||||
| FASN | 100170327 | F:GCTGCTCTGGAAGGACAACTG | 58 | 118 |
| R:GTGGATGTAGATGGCGGTGATG | ||||
| ACACA | 443186 | F:GCAACATCACATCCGTCCTCT | 58 | 188 |
| R:GTCCATCACCACAGCCTTCAT | ||||
| FABP4 | 100137067 | F:TGAAGGTGCTCTGGTACAAGT | 58 | 133 |
| R:TGCTCTCTCGTAAACTCTGGTA |
| miRNA Symbol | Primer |
|---|---|
| oar-let-7d | GCGGAGAGGTAGTAGGTTGCATAG |
| oar-miR-29b | CCGCTAGCACCATTTGAAATCAGTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Meng, F.; Zi, Y.; Han, C.; Zhao, M.; Wang, L.; Chang, L.; Zhou, X.; Zhou, T.; Xiao, H.; Zhang, W.; et al. The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis. Cells 2026, 15, 329. https://doi.org/10.3390/cells15040329
Meng F, Zi Y, Han C, Zhao M, Wang L, Chang L, Zhou X, Zhou T, Xiao H, Zhang W, et al. The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis. Cells. 2026; 15(4):329. https://doi.org/10.3390/cells15040329
Chicago/Turabian StyleMeng, Fanhua, Yanyun Zi, Cong Han, Min Zhao, Lin Wang, Longwei Chang, Xinyu Zhou, Tong Zhou, Hongmei Xiao, Wenguang Zhang, and et al. 2026. "The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis" Cells 15, no. 4: 329. https://doi.org/10.3390/cells15040329
APA StyleMeng, F., Zi, Y., Han, C., Zhao, M., Wang, L., Chang, L., Zhou, X., Zhou, T., Xiao, H., Zhang, W., & Zhang, D. (2026). The Asp-Encoding Gene FBN1 Mediates Cold Adaptation in Sunite Sheep by Reprogramming Adipocyte Differentiation Towards Thermogenesis. Cells, 15(4), 329. https://doi.org/10.3390/cells15040329

