Magnetically Stimulated Myogenesis Recruits a CRY2-TRPC1 Photosensitive Signaling Axis
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Pharmacology
2.2. Cell Count
2.3. Generation of Plasmid and Stable Cell Line
2.4. PEMF Exposure Paradigms
2.5. Light, Dark, and µ-Box Apparatus and Paradigms
2.6. Western Analysis
2.7. Real-Time qPCR
2.8. CRY2 and RFK Silencing
2.9. Immunofluorescence Using Laser Confocal Imaging
2.10. Subcellular Fractionation and Immunoprecipitation Assay
2.11. Statistical Analysis
3. Results
4. Discussion
4.1. TRPCs in Photomodulatory Responses
4.2. Mammalian Cryptochromes
4.3. Radical Pair Mechanism of Magnetoreception
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, L.; Malkemper, E.P. Cryptochromes in mammals: A magnetoreception misconception? Front. Physiol. 2023, 14, 1250798. [Google Scholar] [CrossRef]
- Sherrard, R.M.; Morellini, N.; Jourdan, N.; El-Esawi, M.; Arthaut, L.D.; Niessner, C.; Rouyer, F.; Klarsfeld, A.; Doulazmi, M.; Witczak, J.; et al. Low-intensity electromagnetic fields induce human cryptochrome to modulate intracellular reactive oxygen species. PLoS Biol. 2018, 16, e2006229. [Google Scholar] [CrossRef] [PubMed]
- Margiotta, J.F.; Howard, M.J. Cryptochromes Mediate Intrinsic Photomechanical Transduction in Avian Iris and Somatic Striated Muscle. Front. Physiol. 2020, 11, 128. [Google Scholar] [CrossRef]
- Lowe, M.; Lage, J.; Paatela, E.; Munson, D.; Hostager, R.; Yuan, C.; Katoku-Kikyo, N.; Ruiz-Estevez, M.; Asakura, Y.; Staats, J.; et al. Cry2 Is Critical for Circadian Regulation of Myogenic Differentiation by Bclaf1-Mediated mRNA Stabilization of Cyclin D1 and Tmem176b. Cell Rep. 2018, 22, 2118–2132. [Google Scholar] [CrossRef]
- da Rocha, G.L.; Mizobuti, D.S.; da Silva, H.N.M.; Covatti, C.; de Lourenco, C.C.; Salvador, M.J.; Pereira, E.C.L.; Minatel, E. Multiple LEDT wavelengths modulate the Akt signaling pathways and attenuate pathological events in mdx dystrophic muscle cells. Photochem. Photobiol. Sci. 2022, 21, 1257–1272. [Google Scholar] [CrossRef]
- Ambudkar, I.S.; de Souza, L.B.; Ong, H.L. TRPC1, Orai1, and STIM1 in SOCE: Friends in tight spaces. Cell Calcium 2017, 63, 33–39. [Google Scholar] [CrossRef]
- Patel, A.; Sharif-Naeini, R.; Folgering, J.R.; Bichet, D.; Duprat, F.; Honore, E. Canonical TRP channels and mechanotransduction: From physiology to disease states. Pflugers Arch. 2010, 460, 571–581. [Google Scholar] [CrossRef]
- Cox, C.D.; Poole, K.; Martinac, B. Re-evaluating TRP channel mechanosensitivity. Trends Biochem. Sci. 2024, 49, 693–702. [Google Scholar] [CrossRef]
- Yap, J.L.Y.; Tai, Y.K.; Frohlich, J.; Fong, C.H.H.; Yin, J.N.; Foo, Z.L.; Ramanan, S.; Beyer, C.; Toh, S.J.; Casarosa, M.; et al. Ambient and supplemental magnetic fields promote myogenesis via a TRPC1-mitochondrial axis: Evidence of a magnetic mitohormetic mechanism. FASEB J. 2019, 33, 12853–12872. [Google Scholar] [CrossRef] [PubMed]
- Bocchero, U.; Falleroni, F.; Mortal, S.; Li, Y.; Cojoc, D.; Lamb, T.; Torre, V. Mechanosensitivity is an essential component of phototransduction in vertebrate rods. PLoS Biol. 2020, 18, e3000750. [Google Scholar] [CrossRef] [PubMed]
- Formoso, K.; Susperreguy, S.; Freichel, M.; Birnbaumer, L. RNA-seq analysis reveals TRPC genes to impact an unexpected number of metabolic and regulatory pathways. Sci. Rep. 2020, 10, 7227. [Google Scholar] [CrossRef] [PubMed]
- Wong, C.J.K.; Tai, Y.K.; Yap, J.L.Y.; Fong, C.H.H.; Loo, L.S.W.; Kukumberg, M.; Frohlich, J.; Zhang, S.; Li, J.Z.; Wang, J.W.; et al. Brief exposure to directionally-specific pulsed electromagnetic fields stimulates extracellular vesicle release and is antagonized by streptomycin: A potential regenerative medicine and food industry paradigm. Biomaterials 2022, 287, 121658. [Google Scholar] [CrossRef]
- Kurth, F.; Tai, Y.K.; Parate, D.; van Oostrum, M.; Schmid, Y.R.F.; Toh, S.J.; Yap, J.L.Y.; Wollscheid, B.; Othman, A.; Dittrich, P.S.; et al. Cell-Derived Vesicles as TRPC1 Channel Delivery Systems for the Recovery of Cellular Respiratory and Proliferative Capacities. Adv. Biosyst. 2020, 4, e2000146. [Google Scholar] [CrossRef] [PubMed]
- Iversen, J.N.; Frohlich, J.; Tai, Y.K.; Franco-Obregon, A. Synergistic Cellular Responses Conferred by Concurrent Optical and Magnetic Stimulation Are Attenuated by Simultaneous Exposure to Streptomycin: An Antibiotic Dilemma. Bioengineering 2024, 11, 637. [Google Scholar] [CrossRef] [PubMed]
- Matsumura, C.Y.; Taniguti, A.P.; Pertille, A.; Santo Neto, H.; Marques, M.J. Stretch-activated calcium channel protein TRPC1 is correlated with the different degrees of the dystrophic phenotype in mdx mice. Am. J. Physiol. Cell Physiol. 2011, 301, C1344–C1350. [Google Scholar] [CrossRef] [PubMed]
- Crocetti, S.; Beyer, C.; Schade, G.; Egli, M.; Frohlich, J.; Franco-Obregon, A. Low intensity and frequency pulsed electromagnetic fields selectively impair breast cancer cell viability. PLoS ONE 2013, 8, e72944. [Google Scholar] [CrossRef] [PubMed]
- Hastings, M.H.; Maywood, E.S.; Brancaccio, M. The Mammalian Circadian Timing System and the Suprachiasmatic Nucleus as Its Pacemaker. Biology 2019, 8, 13. [Google Scholar] [CrossRef]
- Torii, S.; Nakayama, K.; Yamamoto, T.; Nishida, E. Regulatory mechanisms and function of ERK MAP kinases. J. Biochem. 2004, 136, 557–561. [Google Scholar] [CrossRef]
- Calloni, G.; Vabulas, R.M. The structural and functional roles of the flavin cofactor FAD in mammalian cryptochromes. Front. Mol. Biosci. 2022, 9, 1081661. [Google Scholar] [CrossRef]
- Hirano, A.; Braas, D.; Fu, Y.H.; Ptacek, L.J. FAD Regulates CRYPTOCHROME Protein Stability and Circadian Clock in Mice. Cell Rep. 2017, 19, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Strubing, C.; Krapivinsky, G.; Krapivinsky, L.; Clapham, D.E. TRPC1 and TRPC5 form a novel cation channel in mammalian brain. Neuron 2001, 29, 645–655. [Google Scholar] [CrossRef] [PubMed]
- de Freitas, L.F.; Hamblin, M.R. Proposed Mechanisms of Photobiomodulation or Low-Level Light Therapy. IEEE J. Sel. Top. Quantum Electron. 2016, 22, 348–364. [Google Scholar] [CrossRef]
- Franco-Obregon, A.; Tai, Y.K.; Wu, K.Y.; Iversen, J.N.; Wong, C.J.K. The Developmental Implications of Muscle-Targeted Magnetic Mitohormesis: A Human Health and Longevity Perspective. Bioengineering 2023, 10, 956. [Google Scholar] [CrossRef] [PubMed]
- Kiselyov, K.; Patterson, R.L. The integrative function of TRPC channels. Front. Biosci. 2009, 14, 45–58. [Google Scholar] [CrossRef] [PubMed]
- Eijkelkamp, N.; Quick, K.; Wood, J.N. Transient receptor potential channels and mechanosensation. Annu. Rev. Neurosci. 2013, 36, 519–546. [Google Scholar] [CrossRef] [PubMed]
- Dietrich, A.; Fahlbusch, M.; Gudermann, T. Classical Transient Receptor Potential 1 (TRPC1): Channel or Channel Regulator? Cells 2014, 3, 939–962. [Google Scholar] [CrossRef] [PubMed]
- Hardie, R.C. Photosensitive TRPs. Handb. Exp. Pharmacol. 2014, 223, 795–826. [Google Scholar] [CrossRef]
- Montell, C.; Rubin, G.M. Molecular characterization of the Drosophila trp locus: A putative integral membrane protein required for phototransduction. Neuron 1989, 2, 1313–1323. [Google Scholar] [CrossRef]
- Wong, F.; Schaefer, E.L.; Roop, B.C.; LaMendola, J.N.; Johnson-Seaton, D.; Shao, D. Proper function of the Drosophila trp gene product during pupal development is important for normal visual transduction in the adult. Neuron 1989, 3, 81–94. [Google Scholar] [CrossRef]
- Cosens, D.J.; Manning, A. Abnormal electroretinogram from a Drosophila mutant. Nature 1969, 224, 285–287. [Google Scholar] [CrossRef] [PubMed]
- Wes, P.D.; Chevesich, J.; Jeromin, A.; Rosenberg, C.; Stetten, G.; Montell, C. TRPC1, a human homolog of a Drosophila store-operated channel. Proc. Natl. Acad. Sci. USA 1995, 92, 9652–9656. [Google Scholar] [CrossRef] [PubMed]
- Contreras, E.; Nobleman, A.P.; Robinson, P.R.; Schmidt, T.M. Melanopsin phototransduction: Beyond canonical cascades. J. Exp. Biol. 2021, 224, jeb226522. [Google Scholar] [CrossRef] [PubMed]
- Moraes, M.N.; de Assis, L.V.M.; Provencio, I.; Castrucci, A.M.L. Opsins outside the eye and the skin: A more complex scenario than originally thought for a classical light sensor. Cell Tissue Res. 2021, 385, 519–538. [Google Scholar] [CrossRef]
- Liebert, A.; Capon, W.; Pang, V.; Vila, D.; Bicknell, B.; McLachlan, C.; Kiat, H. Photophysical Mechanisms of Photobiomodulation Therapy as Precision Medicine. Biomedicines 2023, 11, 237. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.; Todo, T. The cryptochromes. Genome Biol. 2005, 6, 220. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, M.; Cashmore, A.R. HY4 gene of A. thaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature 1993, 366, 162–166. [Google Scholar] [CrossRef]
- Folta, K.M.; Lieg, E.J.; Durham, T.; Spalding, E.P. Primary inhibition of hypocotyl growth and phototropism depend differently on phototropin-mediated increases in cytoplasmic calcium induced by blue light. Plant Physiol. 2003, 133, 1464–1470. [Google Scholar] [CrossRef]
- Zhao, Q.P.; Zhu, J.D.; Li, N.N.; Wang, X.N.; Zhao, X.; Zhang, X. Cryptochrome-mediated hypocotyl phototropism was regulated antagonistically by gibberellic acid and sucrose in Arabidopsis. J. Integr. Plant Biol. 2020, 62, 614–630. [Google Scholar] [CrossRef]
- Chaves, I.; Pokorny, R.; Byrdin, M.; Hoang, N.; Ritz, T.; Brettel, K.; Essen, L.O.; van der Horst, G.T.; Batschauer, A.; Ahmad, M. The cryptochromes: Blue light photoreceptors in plants and animals. Annu. Rev. Plant Biol. 2011, 62, 335–364. [Google Scholar] [CrossRef]
- Liu, H.; Liu, B.; Zhao, C.; Pepper, M.; Lin, C. The action mechanisms of plant cryptochromes. Trends Plant Sci. 2011, 16, 684–691. [Google Scholar] [CrossRef]
- Wiltschko, R.; Niessner, C.; Wiltschko, W. The Magnetic Compass of Birds: The Role of Cryptochrome. Front. Physiol. 2021, 12, 667000. [Google Scholar] [CrossRef]
- Bazalova, O.; Kvicalova, M.; Valkova, T.; Slaby, P.; Bartos, P.; Netusil, R.; Tomanova, K.; Braeunig, P.; Lee, H.J.; Sauman, I.; et al. Cryptochrome 2 mediates directional magnetoreception in cockroaches. Proc. Natl. Acad. Sci. USA 2016, 113, 1660–1665. [Google Scholar] [CrossRef] [PubMed]
- Hore, P.J.; Mouritsen, H. The Radical-Pair Mechanism of Magnetoreception. Annu. Rev. Biophys. 2016, 45, 299–344. [Google Scholar] [CrossRef]
- Usselman, R.J.; Chavarriaga, C.; Castello, P.R.; Procopio, M.; Ritz, T.; Dratz, E.A.; Singel, D.J.; Martino, C.F. The Quantum Biology of Reactive Oxygen Species Partitioning Impacts Cellular Bioenergetics. Sci. Rep. 2016, 6, 38543. [Google Scholar] [CrossRef]
- Cartes-Saavedra, B.; Ghosh, A.; Hajnoczky, G. The roles of mitochondria in global and local intracellular calcium signalling. Nat. Rev. Mol. Cell Biol. 2025, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Usselman, R.J.; Hill, I.; Singel, D.J.; Martino, C.F. Spin biochemistry modulates reactive oxygen species (ROS) production by radio frequency magnetic fields. PLoS ONE 2014, 9, e93065. [Google Scholar] [CrossRef]
- Brown, S.A. Circadian clock-mediated control of stem cell division and differentiation: Beyond night and day. Development 2014, 141, 3105–3111. [Google Scholar] [CrossRef]
Antibody Name | Dilution Factor | Cat. No. | Manufacturer |
---|---|---|---|
GFP | 1:300 | sc-9996 | Santa Cruz |
TRPC1 | 1:300 | sc-133076 | Santa Cruz |
Cyclin B1 | 1:1000 | 4138S | Cell Signaling Technology |
Cyclin D1 | 1:300 | sc-8396 | Santa Cruz |
MyoD | 1:300 | sc-71629 | Santa Cruz |
Phospho-ERK | 1:300 | sc-7383 | Santa Cruz |
ERK | 1:300 | sc-514302 | Santa Cruz |
GAPDH | 1:10,000 | 60004-1-1g | Proteintech |
FLAG Tag | 1:1000 | 20543-1-AP | Proteintech |
Gene | Forward (from 5′ to 3′) | Reverse (from 5′ to 3′) |
---|---|---|
CRY2 | GTGCACTGGTTCCGCAAAG | CACGGGTCGAGGATGTAGAC |
PER1 | GAAACGGCAAGCGGATGGAG | GGAGGACGAAACAGGGAAGG |
PER3 | ATTTAAGCACGTGGGGCTCA | GACCCTGCTTGAACACAGGA |
BCLAF | ATCACATTCTTCAAGATCCAAGTC | CTGGAACGAGACCTAGAACTGTAT |
CLOCK | TCTCAGACCCTTCCTCCACA | GAGCTGGCAAATGCTGTCTG |
TIMELESS | CTTCAGAGGACTCGCGGAGA | GGCTCCTTGTGGTAAGTCCC |
RFK | CAGGTGGTGCGTGGCTTC | CATCCAATGCTCACCACCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iversen, J.N.; Tai, Y.K.; Wu, K.Y.; Wong, C.J.K.; Lim, H.Y.; Franco-Obregón, A. Magnetically Stimulated Myogenesis Recruits a CRY2-TRPC1 Photosensitive Signaling Axis. Cells 2025, 14, 231. https://doi.org/10.3390/cells14030231
Iversen JN, Tai YK, Wu KY, Wong CJK, Lim HY, Franco-Obregón A. Magnetically Stimulated Myogenesis Recruits a CRY2-TRPC1 Photosensitive Signaling Axis. Cells. 2025; 14(3):231. https://doi.org/10.3390/cells14030231
Chicago/Turabian StyleIversen, Jan Nikolas, Yee Kit Tai, Kwan Yu Wu, Craig Jun Kit Wong, Hao Yang Lim, and Alfredo Franco-Obregón. 2025. "Magnetically Stimulated Myogenesis Recruits a CRY2-TRPC1 Photosensitive Signaling Axis" Cells 14, no. 3: 231. https://doi.org/10.3390/cells14030231
APA StyleIversen, J. N., Tai, Y. K., Wu, K. Y., Wong, C. J. K., Lim, H. Y., & Franco-Obregón, A. (2025). Magnetically Stimulated Myogenesis Recruits a CRY2-TRPC1 Photosensitive Signaling Axis. Cells, 14(3), 231. https://doi.org/10.3390/cells14030231