MM-129 Counteracts 5-Fluorouracil-Induced Cellular Senescence in Colon Cancer via SIRT1/STAT3 Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Detection of β-Galactosidase Activity as a Marker of Cellular Senescence
2.3. Capillary Western Blot
2.4. RNA Extraction and Quantitative Analysis
2.5. Cytometry Analysis
2.6. Immunohistochemistry
2.7. Statistical Analysis
3. Results
3.1. MM-129 Counteracts 5-FU-Initiated Senescence of Colon Cancer Cells
3.2. MM-129 Reduces the Number of SA-β-Gal-Positive Senescent Colon Cancer Cells Induced by 5-FU
3.3. MM-129 Inhibits the Senescence-Associated Secretory Phenotype Induced by 5-FU
3.4. MM-129 Induces Senotherapeutic Effect via SIRT1/STAT3 Inhibition
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Hayflick, L. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 1965, 37, 614–636. [Google Scholar] [CrossRef]
- Fumagalli, M.; Rossiello, F.; Clerici, M.; Barozzi, S.; Cittaro, D.; Kaplunov, J.M.; Bucci, G.; Dobreva, M.; Matti, V.; Beausejour, C.M.; et al. Telomeric DNA damage is irreparable and causes persistent DNA-damage-response activation. Nat. Cell Biol. 2012, 14, 355–365. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Lankhorst, L.; Bernards, R. Exploiting senescence for the treatment of cancer. Nat. Rev. Cancer 2022, 22, 340–355. [Google Scholar] [CrossRef]
- Demaria, M.; Ohtani, N.; Youssef, S.A.; Rodier, F.; Toussaint, W.; Mitchell, J.R.; Laberge, R.-M.; Vijg, J.; Van Steeg, H.; Dollé, M.E.; et al. An essential role for senescent cells in optimal wound healing through secretion of PDGF-AA. Dev. Cell 2014, 31, 722–733. [Google Scholar] [CrossRef] [PubMed]
- Ritschka, B.; Storer, M.; Mas, A.; Heinzmann, F.; Ortells, M.C.; Morton, J.P.; Sansom, O.J.; Zender, L.; Keyes, W.M. The senescence-associated secretory phenotype induces cellular plasticity and tissue regeneration. Genes Dev. 2017, 31, 172–183. [Google Scholar] [CrossRef]
- Kim, Y.H.; Park, T.J. Cellular senescence in cancer. BMB Rep. 2019, 52, 42–46. [Google Scholar] [CrossRef]
- Jun, J.I.; Lau, L.F. The matricellular protein CCN1 induces fibroblast senescence and restricts fibrosis in cutaneous wound healing. Nat. Cell Biol. 2010, 12, 676–685. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.H.; Choi, Y.W.; Lee, J.; Soh, E.Y.; Kim, J.H.; Park, T.J. Senescent tumor cells lead the collective invasion in thyroid cancer. Nat. Commun. 2017, 8, 15208. [Google Scholar] [CrossRef]
- Tato-Costa, J.; Casimiro, S.; Pacheco, T.; Pires, R.; Fernandes, A.; Alho, I.; Pereira, P.; Costa, P.; Castelo, H.B.; Ferreira, J.; et al. Therapy-induced cellular senescence induces epithelial-to-mesenchymal transition and increases invasiveness in rectal cancer. Clin. Color. Cancer 2016, 15, 170–178.e3. [Google Scholar] [CrossRef]
- Roninson, I.B. Tumor cell senescence in cancer treatment. Cancer Res. 2003, 63, 2705–2715. [Google Scholar]
- Brabletz, T.; Kalluri, R.; Nieto, M.A.; Weinberg, R.A. EMT in cancer. Nat. Rev. Cancer 2018, 18, 128–134. [Google Scholar] [CrossRef]
- Faheem, M.M.; Seligson, N.D.; Ahmad, S.M.; Rasool, R.U.; Gandhi, S.G.; Bhagat, M.; Goswami, A. Convergence of therapy-induced senescence (TIS) and EMT in multistep carcinogenesis: Current opinions and emerging perspectives. Cell Death Discov. 2020, 6, 51. [Google Scholar] [CrossRef]
- Frey, N.; Venturelli, S.; Zender, L.; Bitzer, M. Cellular senescence in gastrointestinal diseases: From pathogenesis to therapeutics. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 81–95. [Google Scholar] [CrossRef]
- Kellers, F.; Fernandez, A.; Konukiewitz, B.; Schindeldecker, M.; Tagscherer, K.E.; Heintz, A.; Jesinghaus, M.; Roth, W.; Foersch, S. Senescence-associated molecules and tumor-immune-interactions as prognostic biomarkers in colorectal cancer. Front. Med. 2022, 9, 865230. [Google Scholar] [CrossRef]
- Hermanowicz, J.M.; Kalaska, B.; Pawlak, K.; Sieklucka, B.; Miklosz, J.; Mojzych, M.; Pawlak, D. Preclinical toxicity and safety of MM-129-first-in-class BTK/PD-L1 inhibitor as a potential candidate against colon cancer. Pharmaceutics 2021, 13, 1222. [Google Scholar] [CrossRef]
- Hermanowicz, J.M.; Pawlak, K.; Sieklucka, B.; Czarnomysy, R.; Kwiatkowska, I.; Kazberuk, A.; Surazynski, A.; Mojzych, M.; Pawlak, D. MM-129 as a novel inhibitor targeting PI3K/AKT/mTOR and PD-L1 in colorectal cancer. Cancers 2021, 13, 3203. [Google Scholar] [CrossRef] [PubMed]
- Tankiewicz-Kwedlo, A.; Hermanowicz, J.M.; Domaniewski, T.; Pawlak, K.; Rusak, M.; Pryczynicz, A.; Surazynski, A.; Kaminski, T.; Kazberuk, A.; Pawlak, D. Simultaneous use of erythropoietin and LFM-A13 as a new therapeutic approach for colorectal cancer. Br. J. Pharmacol. 2018, 175, 743–762. [Google Scholar] [CrossRef]
- Altieri, P.; Murialdo, R.; Barisione, C.; Lazzarini, E.; Garibaldi, S.; Fabbi, P.; Ruggeri, C.; Borile, S.; Carbone, F.; Armirotti, A.; et al. 5-fluorouracil causes endothelial cell senescence: Potential protective role of glucagon-like peptide 1. Br. J. Pharmacol. 2017, 174, 3713–3726. [Google Scholar] [CrossRef]
- Xia, J.; He, S.; Dai, Q.; Jia, H.; Ge, Y.; Zhou, M.; Wang, X. Atorvastatin calcium alleviates 5-fluorouracil-induced intestinal damage by inhibiting cellular senescence and significantly enhances its antitumor efficacy. Int. Immunopharmacol. 2023, 121, 110465. [Google Scholar] [CrossRef] [PubMed]
- Tóth, F.; Moftakhar, Z.; Sotgia, F.; Lisanti, M.P. In vitro investigation of therapy-induced senescence and senescence escape in breast cancer cells using novel flow cytometry-based methods. Cells 2024, 13, 841. [Google Scholar] [CrossRef]
- Kwiatkowska, I.; Hermanowicz, J.M.; Czarnomysy, R.; Surazynski, A.; Kowalczuk, K.; Kalafut, J.; Przybyszewska-Podstawka, A.; Bielawski, K.; Rivero-Müller, A.; Mojzych, M.; et al. Assessment of an anticancer effect of the simultaneous administration of MM-129 and indoximod in the colorectal cancer model. Cancers 2024, 16, 122. [Google Scholar] [CrossRef]
- Shinohara, N.; Tsuduki, T.; Ito, J.; Honma, T.; Kijima, R.; Sugawara, S.; Arai, T.; Yamasaki, M.; Ikezaki, A.; Yokoyama, M.; et al. Jacaric acid, a linolenic acid isomer with a conjugated triene system, has a strong antitumor effect in vitro and in vivo. Biochim. Biophys. Acta 2012, 1821, 980–988. [Google Scholar] [CrossRef]
- Al Bitar, S.; Gali-Muhtasib, H. The Role of the Cyclin Dependent Kinase Inhibitor p21cip1/waf1 in Targeting Cancer: Molecular Mechanisms and Novel Therapeutics. Cancers 2019, 11, 1475. [Google Scholar] [CrossRef]
- Coppé, J.P.; Desprez, P.Y.; Krtolica, A.; Campisi, J. The senescence-associated secretory phenotype: The dark side of tumor suppression. Annu. Rev. Pathol. 2010, 5, 99–118. [Google Scholar] [CrossRef]
- Abaurrea, A.; Araujo, A.M.; Caffarel, M.M. The role of the IL-6 cytokine family in epithelial-mesenchymal plasticity in cancer progression. Int. J. Mol. Sci. 2021, 22, 8334. [Google Scholar] [CrossRef]
- Kandhaya-Pillai, R.; Miro-Mur, F.; Alijotas-Reig, J.; Tchkonia, T.; Kirkland, J.L.; Schwartz, S. TNFα-Senescence Initiates a STAT-Dependent Positive Feedback Loop, Leading to a Sustained Interferon Signature, DNA Damage, and Cytokine Secretion. Aging 2017, 9, 2411–2435. [Google Scholar] [CrossRef]
- Xu, M.; Pirtskhalava, T.; Farr, J.N.; Weigand, B.M.; Palmer, A.K.; Weivoda, M.M.; Inman, C.L.; Ogrodnik, M.B.; Hachfeld, C.M.; Fraser, D.G.; et al. Senolytics improve physical function and increase lifespan in old age. Nat. Med. 2018, 24, 1246–1256. [Google Scholar] [CrossRef] [PubMed]
- Herranz, N.; Gallage, S.; Mellone, M.; Wuestefeld, T.; Klotz, S.; Hanley, C.J.; Raguz, S.; Acosta, J.C.; Innes, A.J.; Banito, A.; et al. mTOR regulates MAPKAPK2 translation to control the senescence-associated secretory phenotype. Nat. Cell Biol. 2015, 17, 1205–1217. [Google Scholar] [CrossRef]
- Huang, W.; Hickson, L.J.; Eirin, A.; Kirkland, J.L.; Lerman, L.O. Cellular senescence: The good, the bad and the unknown. Nat. Rev. Nephrol. 2022, 18, 611–627. [Google Scholar] [CrossRef] [PubMed]
- Chaib, S.; Tchkonia, T.; Kirkland, J.L. Cellular senescence and senolytics: The path to the clinic. Nat. Med. 2022, 28, 1556–1568. [Google Scholar] [CrossRef]
- Zhang, Q.; Lou, Y.; Fang, H.; Sun, S.; Jin, R.; Ji, Y.; Chen, Z. Cancer-associated fibroblasts under therapy-induced senescence in the tumor microenvironment (Review). Exp. Ther. Med. 2024, 27, 150. [Google Scholar] [CrossRef]
- Saleh, T.; Bloukh, S.; Carpenter, V.J.; Alwohoush, E.; Bakeer, J.; Darwish, S.; Azab, B.; Gewirtz, D.A. Therapy-induced senescence: An “old” friend becomes the enemy. Cancers 2020, 12, 822. [Google Scholar] [CrossRef] [PubMed]
- Demaria, M.; O’Leary, M.N.; Chang, J.; Shao, L.; Liu, S.; Alimirah, F.; Koenig, K.; Le, C.; Mitin, N.; Deal, A.M.; et al. Cellular senescence promotes adverse effects of chemotherapy and cancer relapse. Cancer Discov. 2017, 7, 165–176. [Google Scholar] [CrossRef] [PubMed]
- Fletcher-Sananikone, E.; Kanji, S.; Tomimatsu, N.; Di Cristofaro, L.F.M.; Kollipara, R.K.; Saha, D.; Floyd, J.R.; Sung, P.; Hromas, R.; Burns, T.C.; et al. Elimination of radiation-induced senescence in the brain tumor microenvironment attenuates glioblastoma recurrence. Cancer Res. 2021, 81, 5935–5947. [Google Scholar] [CrossRef] [PubMed]
- Townsley, D.M.; Dumitriu, B.; Liu, D.; Biancotto, A.; Weinstein, B.; Chen, C.; Hardy, N.; Mihalek, A.D.; Lingala, S.; Kim, Y.J.; et al. Danazol treatment for telomere diseases. N. Engl. J. Med. 2016, 374, 1922–1931. [Google Scholar] [CrossRef]
- Kawaguchi, K.; Komoda, K.; Mikawa, R.; Asai, A.; Sugimoto, M. Cellular senescence promotes cancer metastasis by enhancing soluble E-cadherin production. iScience 2021, 24, 103022. [Google Scholar] [CrossRef]
- Prasanna, P.G.; Citrin, D.E.; Hildesheim, J.; Ahmed, M.M.; Venkatachalam, S.; Riscuta, G.; Xi, D.; Zheng, G.; van Deursen, J.; Goronzy, J.; et al. Therapy-induced senescence: Opportunities to improve anticancer therapy. J. Natl. Cancer Inst. 2021, 113, 1285–1298. [Google Scholar] [CrossRef]
- Wang, L.; Leite de Oliveira, R.; Wang, C.; Fernandes Neto, J.M.; Mainardi, S.; Evers, B.; Lieftink, C.; Morris, B.; Jochems, F.; Willemsen, L.; et al. High-throughput functional genetic and compound screens identify targets for senescence induction in cancer. Cell Rep. 2017, 21, 773–783. [Google Scholar] [CrossRef]
- Leite de Oliveira, R.; Bernards, R. Anti-cancer therapy: Senescence is the new black. EMBO J. 2018, 37, e99386. [Google Scholar] [CrossRef]
- Saatloo, M.V.; Delisi, D.; Eskandari, N.; Krieg, C.; Gentile, S. Kv11.1-Dependent Senescence Activates a Lethal Immune Response via Tumor Necrosis Factor Alpha. Neoplasia 2025, 63, 101148. [Google Scholar] [CrossRef]
- Wang, B.; Kohli, J.; Demaria, M. Senescent cells in cancer therapy: Friends or foes? Trends Cancer 2020, 6, 838–857. [Google Scholar] [CrossRef]
- de Paula, B.; Kieran, R.; Koh, S.S.Y.; Crocamo, S.; Abdelhay, E.; Muñoz-Espín, D. Targeting senescence as a therapeutic opportunity for triple-negative breast cancer. Mol. Cancer Ther. 2023, 22, 583–598. [Google Scholar] [CrossRef]
- Herbstein, F.; Sapochnik, M.; Attorresi, A.; Pollak, C.; Senin, S.; Gonilski-Pacin, D.; del Giudice, N.C.; Fiz, M.; Elguero, B.; Fuertes, M.; et al. The SASP factor IL-6 sustains cell-autonomous senescent cells via a cGAS-STING-NFκB intracrine senescent noncanonical pathway. Aging Cell 2024, 23, e14258. [Google Scholar] [CrossRef]
- Kuilman, T.; Michaloglou, C.; Vredeveld, L.C.; Douma, S.; van Doorn, R.; Desmet, C.J.; Aarden, L.A.; Mooi, W.J.; Peeper, D.S. Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network. Cell 2008, 133, 1019–1031. [Google Scholar] [CrossRef]
- Sapo Sapochnik, M.; Haedo, M.R.; Fuertes, M.; Ajler, P.; Carrizo, G.; Cervio, A.; Sevlever, G.; Stalla, G.K.; Arzt, E. Autocrine IL-6 mediates pituitary tumor senescence. Oncotarget 2017, 8, 4690–4702. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.W.; Wang, D.; Cai, H.; Cao, M.Q.; Zhang, Y.Y.; Zhuang, P.Y.; Shen, J. IL-6 plays a crucial role in epithelial-mesenchymal transition and pro-metastasis induced by sorafenib in liver cancer. Oncol. Rep. 2021, 45, 1105–1117. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Yu, Y.; Chen, Y.; Zhuang, J.; Sun, C. Tumor Immunosenescence Driven by Chronic Inflammation: Mechanisms, Microenvironment Remodeling and Therapeutic Strategies. Aging Dis. 2025. [Google Scholar] [CrossRef]
- Li, C.W.; Xia, W.; Huo, L.; Lim, S.O.; Wu, Y.; Hsu, J.L.; Chao, C.H.; Yamaguchi, H.; Yang, N.K.; Ding, Q.; et al. Epithelial-Mesenchymal Transition Induced by TNF-α Requires NF-κB-Mediated Transcriptional Upregulation of Twist1. Cancer Res. 2012, 72, 1290–1300. [Google Scholar] [CrossRef]
- Shinde, A.; Tang, X.; Singh, R.; Brindley, D.N. Infliximab, a Monoclonal Antibody against TNF-α, Inhibits NF-κB Activation, Autotaxin Expression and Breast Cancer Metastasis to Lungs. Cancers 2023, 16, 52. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Wang, X.; Gong, Y.; Deng, J. E-cadherin on epithelial-mesenchymal transition in thyroid cancer. Cancer Cell Int. 2021, 21, 695. [Google Scholar] [CrossRef]
- Christou, N.; Perraud, A.; Blondy, S.; Jauberteau, M.O.; Battu, S.; Mathonnet, M. The extracellular domain of E-cadherin linked to invasiveness in colorectal cancer: A new resistance and relapses monitoring serum-bio marker? J. Cancer Res. Clin. Oncol. 2017, 143, 1177–1190. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Ye, M.; Zhou, J.; Wang, Z.W.; Zhu, X. Restoring E-cadherin expression by natural compounds for anticancer therapies in genital and urinary cancers. Mol. Ther. Oncolytics 2019, 14, 130–138. [Google Scholar] [CrossRef] [PubMed]
- Kolesnichenko, M.; Hong, L.; Liao, R.; Vogt, P.K.; Sun, P. Attenuation of TORC1 signaling delays replicative and oncogenic RAS-induced senescence. Cell Cycle 2012, 11, 2391–2401. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Li, N.; Xiang, R.; Sun, P. Emerging roles of the p38 MAPK and PI3K/AKT/mTOR pathways in oncogene-induced senescence. Trends Biochem. Sci. 2014, 39, 268–276. [Google Scholar] [CrossRef]
- Fung, A.S.; Wu, L.; Tannock, I.F. Concurrent and sequential administration of chemotherapy and the mammalian target of rapamycin inhibitor temsirolimus in human cancer cells and xenografts. Clin. Cancer Res. 2009, 15, 5389–5395. [Google Scholar] [CrossRef]
- Lee, S.H.; Yang, J.H.; Park, U.H.; Choi, H.; Kim, Y.S.; Yoon, B.E.; Han, H.-J.; Kim, H.-T.; Um, S.-J.; Kim, E.-J. SIRT1 ubiquitination is regulated by opposing activities of APC/C-Cdh1 and AROS during stress-induced premature senescence. Exp. Mol. Med. 2023, 55, 1232–1246. [Google Scholar] [CrossRef]
- Hayakawa, T.; Iwai, M.; Aoki, S.; Takimoto, K.; Maruyama, M.; Maruyama, W.; Motoyama, N. SIRT1 suppresses the senescence-associated secretory phenotype through epigenetic gene regulation. PLoS ONE 2015, 10, e0116480. [Google Scholar] [CrossRef]
- Lu, J.; Zhang, L.; Chen, X.; Lu, Q.; Yang, Y.; Liu, J.; Ma, X. SIRT1 counteracted the activation of STAT3 and NF-κB to repress the gastric cancer growth. Int. J. Clin. Exp. Med. 2014, 7, 5050–5058. [Google Scholar]
- Ray, L.B. STAT3 as longevity protein partner. Sci. Signal. 2009, 2, ec121. [Google Scholar] [CrossRef]
- Kojima, H.; Inoue, T.; Kunimoto, H.; Nakajima, K. IL-6-STAT3 signaling and premature senescence. JAKSTAT 2013, 2, e25763. [Google Scholar] [CrossRef]
- Yasuda, T.; Koiwa, M.; Yonemura, A.; Miyake, K.; Kariya, R.; Kubota, S.; Yokomizo-Nakano, T.; Yasuda-Yoshihara, N.; Uchihara, T.; Itoyama, R.; et al. Inflammation-driven senescence-associated secretory phenotype in cancer-associated fibroblasts enhances peritoneal dissemination. Cell Rep. 2021, 34, 108779. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.Q.; Man, Q.W.; Huo, F.Y.; Gao, X.; Lin, H.; Li, S.R.; Wang, J.; Su, F.; Cai, L.; Shi, Y.; et al. STAT3 pathway in cancers: Past, present, and future. MedComm 2022, 3, e124. [Google Scholar] [CrossRef] [PubMed]
- Cho, H.J.; Hwang, J.A.; Yang, E.J.; Kim, E.C.; Kim, J.R.; Kim, S.Y.; Kim, Y.Z.; Park, S.C.; Lee, Y.-S. Nintedanib induces senolytic effect via STAT3 inhibition. Cell Death Dis. 2022, 13, 760. [Google Scholar] [CrossRef] [PubMed]







| Gene | Primer Sequence (5′→3′) |
|---|---|
| SIRT1 | Forward: TAGACACGCTGGAACAGGTTGC Reverse: CTCCTCGTACAGCTTCACAGTC |
| STAT3 | Forward: CTTTGAGACCGAGGTGTATCACC Reverse: GGTCAGCATGTTGTACCACAGG |
| CDH1 | Forward: GCCTCCTGAAAAGAGAGTGGAAG Reverse: TGGCAGTGTCTCTCCAAATCCG |
| IL-6 | Forward: AGACAGCCACTCACCTCTTCAG Reverse: TTCTGCCAGTGCCTCTTTGCTG |
| TNF-α | Forward: CTCTTCTGCCTGCTGCACTTTG Reverse: ATGGGCTACAGGCTTGTCACTC |
| p21 | Forward: AGGTGGACCTGGAGACTCTCAG Reverse: TCCTCTTGGAGAAGATCAGCCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Klepacki, H.; Sieklucka, B.; Kalafut, J.; Kowalczuk, K.; Surazynski, A.; Mojzych, M.; Pryczynicz, A.; Pawlak, D.; Tiso, N.; Hermanowicz, J.M. MM-129 Counteracts 5-Fluorouracil-Induced Cellular Senescence in Colon Cancer via SIRT1/STAT3 Signaling Pathway. Cells 2025, 14, 1498. https://doi.org/10.3390/cells14191498
Klepacki H, Sieklucka B, Kalafut J, Kowalczuk K, Surazynski A, Mojzych M, Pryczynicz A, Pawlak D, Tiso N, Hermanowicz JM. MM-129 Counteracts 5-Fluorouracil-Induced Cellular Senescence in Colon Cancer via SIRT1/STAT3 Signaling Pathway. Cells. 2025; 14(19):1498. https://doi.org/10.3390/cells14191498
Chicago/Turabian StyleKlepacki, Hubert, Beata Sieklucka, Joanna Kalafut, Krystyna Kowalczuk, Arkadiusz Surazynski, Mariusz Mojzych, Anna Pryczynicz, Dariusz Pawlak, Natascia Tiso, and Justyna Magdalena Hermanowicz. 2025. "MM-129 Counteracts 5-Fluorouracil-Induced Cellular Senescence in Colon Cancer via SIRT1/STAT3 Signaling Pathway" Cells 14, no. 19: 1498. https://doi.org/10.3390/cells14191498
APA StyleKlepacki, H., Sieklucka, B., Kalafut, J., Kowalczuk, K., Surazynski, A., Mojzych, M., Pryczynicz, A., Pawlak, D., Tiso, N., & Hermanowicz, J. M. (2025). MM-129 Counteracts 5-Fluorouracil-Induced Cellular Senescence in Colon Cancer via SIRT1/STAT3 Signaling Pathway. Cells, 14(19), 1498. https://doi.org/10.3390/cells14191498

