Molecular Characterization and Subtyping of Breast Cancer Cell Lines Provide Novel Insights into Cancer Relevant Genes
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Sample Preparation
2.2. Immunoblotting
2.3. mRNA-Sequencing and Expression Analysis
2.4. Quantitative PCR
2.5. Mutation Calling
2.6. Fusion Calling and Analysis of Fusion Transcripts
2.7. SNP Array
2.8. Transfection of siRNAs
3. Results
3.1. Molecular Subtyping of BC Cell Lines Separate Basal-like from Luminal BC Models
3.2. Mutations in BC Cell Lines Frequently Affect TP53 and BRCA2
3.3. Identification of Novel Fusion Transcripts in BC Cell Lines
3.4. Identification of IRX Genes and KLF15 as Candidate Tumor Suppressor Genes in BC
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Arnold, M.; Morgan, E.; Rumgay, H.; Mafra, A.; Singh, D.; Laversanne, M.; Vignat, J.; Gralow, J.R.; Cardoso, F.; Siesling, S.; et al. Current and future burden of breast cancer: Global statistics for 2020 and 2040. Breast 2022, 66, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Harbeck, N.; Penault-Llorca, F.; Cortes, J.; Gnant, M.; Houssami, N.; Poortmans, P.; Ruddy, K.; Tsang, J.; Cardoso, F. Breast cancer. Nat. Rev. Dis. Primers 2019, 5, 66. [Google Scholar] [CrossRef] [PubMed]
- Rivenbark, A.G.; O’Connor, S.M.; Coleman, W.B. Molecular and cellular heterogeneity in breast cancer: Challenges for personalized medicine. Am. J. Pathol. 2013, 183, 1113–1124. [Google Scholar] [CrossRef] [PubMed]
- WHO Classification of Tumours of the Breast; Lakhani, S.R., Ellis, I.O., Schnitt, S.J., Tan, P.H., van de Vijver, M., Eds.; IARC Press: Lyon, France, 2012. [Google Scholar]
- Perou, C.M.; Sorlie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S.; Rees, C.A.; Pollack, J.R.; Ross, D.T.; Johnsen, H.; Akslen, L.A.; et al. Molecular portraits of human breast tumours. Nature 2000, 406, 747–752. [Google Scholar] [CrossRef]
- Parker, J.S.; Mullins, M.; Cheang, M.C.; Leung, S.; Voduc, D.; Vickery, T.; Davies, S.; Fauron, C.; He, X.; Hu, Z.; et al. Supervised risk predictor of breast cancer based on intrinsic subtypes. J. Clin. Oncol. 2009, 27, 1160–1167. [Google Scholar] [CrossRef]
- Duffy, M.J.; Harbeck, N.; Nap, M.; Molina, R.; Nicolini, A.; Senkus, E.; Cardoso, F. Clinical use of biomarkers in breast cancer: Updated guidelines from the European Group on Tumor Markers (EGTM). Eur. J. Cancer 2017, 75, 284–298. [Google Scholar] [CrossRef]
- Vargo-Gogola, T.; Rosen, J.M. Modelling breast cancer: One size does not fit all. Nat. Rev. Cancer 2007, 7, 659–672. [Google Scholar] [CrossRef]
- Soule, H.D.; Vazguez, J.; Long, A.; Albert, S.; Brennan, M. A human cell line from a pleural effusion derived from a breast carcinoma. J. Natl. Cancer Inst. 1973, 51, 1409–1416. [Google Scholar] [CrossRef]
- Carlson, R.W. The history and mechanism of action of fulvestrant. Clin. Breast Cancer 2005, 6 (Suppl. 1), S5–S8. [Google Scholar] [CrossRef]
- Neve, R.M.; Chin, K.; Fridlyand, J.; Yeh, J.; Baehner, F.L.; Fevr, T.; Clark, L.; Bayani, N.; Coppe, J.P.; Tong, F.; et al. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 2006, 10, 515–527. [Google Scholar] [CrossRef]
- Kao, J.; Salari, K.; Bocanegra, M.; Choi, Y.L.; Girard, L.; Gandhi, J.; Kwei, K.A.; Hernandez-Boussard, T.; Wang, P.; Gazdar, A.F.; et al. Molecular profiling of breast cancer cell lines defines relevant tumor models and provides a resource for cancer gene discovery. PLoS ONE 2009, 4, e6146. [Google Scholar] [CrossRef]
- Jiang, G.; Zhang, S.; Yazdanparast, A.; Li, M.; Pawar, A.V.; Liu, Y.; Inavolu, S.M.; Cheng, L. Comprehensive comparison of molecular portraits between cell lines and tumors in breast cancer. BMC Genom. 2016, 17 (Suppl. 7), 525. [Google Scholar] [CrossRef]
- Ben-David, U.; Siranosian, B.; Ha, G.; Tang, H.; Oren, Y.; Hinohara, K.; Strathdee, C.A.; Dempster, J.; Lyons, N.J.; Burns, R.; et al. Genetic and transcriptional evolution alters cancer cell line drug response. Nature 2018, 560, 325–330. [Google Scholar] [CrossRef]
- Quentmeier, H.; Pommerenke, C.; Dirks, W.G.; Eberth, S.; Koeppel, M.; MacLeod, R.A.F.; Nagel, S.; Steube, K.; Uphoff, C.C.; Drexler, H.G. The LL-100 panel: 100 cell lines for blood cancer studies. Sci. Rep. 2019, 9, 8218. [Google Scholar] [CrossRef]
- Lasfargues, E.Y.; Coutinho, W.G.; Redfield, E.S. Isolation of two human tumor epithelial cell lines from solid breast carcinomas. J. Natl. Cancer Inst. 1978, 61, 967–978. [Google Scholar]
- Gioanni, J.; Mazeau, C.; Zanghellini, E.; Milano, G.; Fischel, J.L.; Turc-Carel, C.; Schneider, M. Etablissement de deux lignées cellulaires humaines à partir d’une même patiente atteinte d’adénocarcinome mammaire et exprimant de facon diferentielle le gène MDR. Bull. Du Cancer 1993, 80, 472. [Google Scholar]
- Gioanni, J.; Le Francois, D.; Zanghellini, E.; Mazeau, C.; Ettore, F.; Lambert, J.C.; Schneider, M.; Dutrillaux, B. Establishment and characterisation of a new tumorigenic cell line with a normal karyotype derived from a human breast adenocarcinoma. Br. J. Cancer 1990, 62, 8–13. [Google Scholar] [CrossRef] [PubMed]
- Langlois, A.J.; Holder, W.D., Jr.; Iglehart, J.D.; Nelson-Rees, W.A.; Wells, S.A., Jr.; Bolognesi, D.P. Morphological and biochemical properties of a new human breast cancer cell line. Cancer Res. 1979, 39, 2604–2613. [Google Scholar] [PubMed]
- Simon, W.E.; Albrecht, M.; Trams, G.; Dietel, M.; Holzel, F. In vitro growth promotion of human mammary carcinoma cells by steroid hormones, tamoxifen, and prolactin. J. Natl. Cancer Inst. 1984, 73, 313–321. [Google Scholar] [CrossRef] [PubMed]
- Yong, J.W.; Choong, M.L.; Wang, S.; Wang, Y.; Lim, S.Q.; Lee, M.A. Characterization of ductal carcinoma in situ cell lines established from breast tumor of a Singapore Chinese patient. Cancer Cell Int. 2014, 14, 94. [Google Scholar] [CrossRef][Green Version]
- Lippman, M.; Bolan, G.; Huff, K. The effects of estrogens and antiestrogens on hormone-responsive human breast cancer in long-term tissue culture. Cancer Res. 1976, 36, 4595–4601. [Google Scholar]
- Gazdar, A.F.; Kurvari, V.; Virmani, A.; Gollahon, L.; Sakaguchi, M.; Westerfield, M.; Kodagoda, D.; Stasny, V.; Cunningham, H.T.; Wistuba, I.I.; et al. Characterization of paired tumor and non-tumor cell lines established from patients with breast cancer. Int. J. Cancer 1998, 78, 766–774. [Google Scholar] [CrossRef]
- Wang, C.S.; Goulet, F.; Lavoie, J.; Drouin, R.; Auger, F.; Champetier, S.; Germain, L.; Têtu, B. Establishment and characterization of a new cell line derived from a human primary breast carcinoma. Cancer Genet. Cytogen 2000, 120, 58–72. [Google Scholar] [CrossRef]
- Hackett, A.J.; Smith, H.S.; Springer, E.L.; Owens, R.B.; Nelson-Rees, W.A.; Riggs, J.L.; Gardner, M.B. Two syngeneic cell lines from human breast tissue: The aneuploid mammary epithelial (Hs578T) and the diploid myoepithelial (Hs578Bst) cell lines. J. Natl. Cancer Inst. 1977, 58, 1795–1806. [Google Scholar] [CrossRef] [PubMed]
- Christgen, M.; Bruchhardt, H.; Hadamitzky, C.; Rudolph, C.; Steinemann, D.; Gadzicki, D.; Hasemeier, B.; Romermann, D.; Focken, T.; Krech, T.; et al. Comprehensive genetic and functional characterization of IPH-926: A novel CDH1-null tumour cell line from human lobular breast cancer. J. Pathol. 2009, 217, 620–632. [Google Scholar] [CrossRef]
- Tanner, M.; Kapanen, A.I.; Junttila, T.; Raheem, O.; Grenman, S.; Elo, J.; Elenius, K.; Isola, J. Characterization of a novel cell line established from a patient with Herceptin-resistant breast cancer. Mol. Cancer Ther. 2004, 3, 1585–1592. [Google Scholar] [CrossRef] [PubMed]
- Cailleau, R.; Olive, M.; Cruciger, Q.V. Long-term human breast carcinoma cell lines of metastatic origin: Preliminary characterization. In Vitro 1978, 14, 911–915. [Google Scholar] [CrossRef]
- Hackenberg, R.; Luttchens, S.; Hofmann, J.; Kunzmann, R.; Holzel, F.; Schulz, K.D. Androgen sensitivity of the new human breast cancer cell line MFM-223. Cancer Res. 1991, 51, 5722–5727. [Google Scholar]
- Trempe, G.L. Human breast cancer in culture. Recent Results Cancer Res. 1976, 57, 33–41. [Google Scholar] [CrossRef]
- Keydar, I.; Chen, L.; Karby, S.; Weiss, F.R.; Delarea, J.; Radu, M.; Chaitcik, S.; Brenner, H.J. Establishment and characterization of a cell line of human breast carcinoma origin. Eur. J. Cancer (1965) 1979, 15, 659–670. [Google Scholar] [CrossRef]
- Pommerenke, C.; Geffers, R.; Bunk, B.; Bhuju, S.; Eberth, S.; Drexler, H.G.; Quentmeier, H. Enhanced whole exome sequencing by higher DNA insert lengths. BMC Genom. 2016, 17, 399. [Google Scholar] [CrossRef] [PubMed]
- Koblitz, J.; Dirks, W.G.; Eberth, S.; Nagel, S.; Steenpass, L.; Pommerenke, C. DSMZCellDive: Diving into high-throughput cell line data. F1000Res 2022, 11, 420. [Google Scholar] [CrossRef] [PubMed]
- Chen, S. Ultrafast one-pass FASTQ data preprocessing, quality control, and deduplication using fastp. iMeta 2023, 2, e107. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Van der Auwera, G.A.; O’Connor, B.D. Genomics in the Cloud: Using Docker, GATK, and WDL in Terra, 1st ed.; O’Reilly Media: Sebastopol, CA, USA, 2020. [Google Scholar]
- Genomes Project, C.; Abecasis, G.R.; Altshuler, D.; Auton, A.; Brooks, L.D.; Durbin, R.M.; Gibbs, R.A.; Hurles, M.E.; McVean, G.A. A map of human genome variation from population-scale sequencing. Nature 2010, 467, 1061–1073. [Google Scholar] [CrossRef]
- Gudmundsson, S.; Singer-Berk, M.; Watts, N.A.; Phu, W.; Goodrich, J.K.; Solomonson, M.; Genome Aggregation Database, C.; Rehm, H.L.; MacArthur, D.G.; O’Donnell-Luria, A. Variant interpretation using population databases: Lessons from gnomAD. Hum. Mutat. 2022, 43, 1012–1030. [Google Scholar] [CrossRef]
- Kitts, A.; Phan, L.; Ward, M.; Holmes, J.B. The Database of Short Genetic Variation (dbSNP). In The NCBI Handbook [Internet], 2nd ed.; National Center for Biotechnology Information: Bethesda, MD, USA, 2013. [Google Scholar]
- Cingolani, P.; Patel, V.M.; Coon, M.; Nguyen, T.; Land, S.J.; Ruden, D.M.; Lu, X. Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift. Front. Genet. 2012, 3, 35. [Google Scholar] [CrossRef]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef]
- Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; DePristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. The variant call format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef] [PubMed]
- Kandoth, C. vcf2maf, v1.6.19 ed. Convert a VCF into a MAF, Where Each Variant is Annotated to Only One of All Possible Gene Isoforms; Zenodo, Zern, European Organization for Nuclear Research: Genève, Switzerland, 2020. [Google Scholar] [CrossRef]
- McLaren, W.; Gil, L.; Hunt, S.E.; Riat, H.S.; Ritchie, G.R.; Thormann, A.; Flicek, P.; Cunningham, F. The Ensembl Variant Effect Predictor. Genome Biol. 2016, 17, 122. [Google Scholar] [CrossRef]
- Skidmore, Z.L.; Wagner, A.H.; Lesurf, R.; Campbell, K.M.; Kunisaki, J.; Griffith, O.L.; Griffith, M. GenVisR: Genomic Visualizations in R. Bioinformatics 2016, 32, 3012–3014. [Google Scholar] [CrossRef]
- Nicorici, D.; Satalan, M.; Edgren, H.; Kangaspeska, S.; Murumägi, A.; Kallioiemi, O.; Vitranen, S.; Kilkku, O. FusionCatcher—A tool for finding somatic fusion genes in paired-end RNA-sequencing data. bioRxiv 2014. [Google Scholar] [CrossRef]
- Kolyvas, E.A.; Caldas, C.; Kelly, K.; Ahmad, S.S. Androgen receptor function and targeted therapeutics across breast cancer subtypes. Breast Cancer Res. 2022, 24, 79. [Google Scholar] [CrossRef]
- Sokilde, R.; Persson, H.; Ehinger, A.; Pirona, A.C.; Ferno, M.; Hegardt, C.; Larsson, C.; Loman, N.; Malmberg, M.; Ryden, L.; et al. Refinement of breast cancer molecular classification by miRNA expression profiles. BMC Genom. 2019, 20, 503. [Google Scholar] [CrossRef]
- Wang, X.; Li, Y.; Qi, W.; Zhang, N.; Sun, M.; Huo, Q.; Cai, C.; Lv, S.; Yang, Q. MicroRNA-99a inhibits tumor aggressive phenotypes through regulating HOXA1 in breast cancer cells. Oncotarget 2015, 6, 32737–32747. [Google Scholar] [CrossRef]
- Kumar, N.; Zhao, D.; Bhaumik, D.; Sethi, A.; Gann, P.H. Quantification of intrinsic subtype ambiguity in Luminal A breast cancer and its relationship to clinical outcomes. BMC Cancer 2019, 19, 215. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, K.; Oshima, T.; Morimoto, T.; Ikeda, S.; Yoshikawa, H.; Shiwa, Y.; Ishikawa, S.; Linak, M.C.; Hirai, A.; Takahashi, H.; et al. Sequence-specific error profile of Illumina sequencers. Nucleic Acids Res. 2011, 39, e90. [Google Scholar] [CrossRef]
- Minoche, A.E.; Dohm, J.C.; Himmelbauer, H. Evaluation of genomic high-throughput sequencing data generated on Illumina HiSeq and genome analyzer systems. Genome Biol. 2011, 12, R112. [Google Scholar] [CrossRef] [PubMed]
- Ciriello, G.; Gatza, M.L.; Beck, A.H.; Wilkerson, M.D.; Rhie, S.K.; Pastore, A.; Zhang, H.; McLellan, M.; Yau, C.; Kandoth, C.; et al. Comprehensive Molecular Portraits of Invasive Lobular Breast Cancer. Cell 2015, 163, 506–519. [Google Scholar] [CrossRef] [PubMed]
- Breast Cancer Association, C.; Dorling, L.; Carvalho, S.; Allen, J.; Gonzalez-Neira, A.; Luccarini, C.; Wahlstrom, C.; Pooley, K.A.; Parsons, M.T.; Fortuno, C.; et al. Breast Cancer Risk Genes—Association Analysis in More than 113,000 Women. N. Engl. J. Med. 2021, 384, 428–439. [Google Scholar] [CrossRef] [PubMed]
- Ikediobi, O.N.; Davies, H.; Bignell, G.; Edkins, S.; Stevens, C.; O’Meara, S.; Santarius, T.; Avis, T.; Barthorpe, S.; Brackenbury, L.; et al. Mutation analysis of 24 known cancer genes in the NCI-60 cell line set. Mol. Cancer Ther. 2006, 5, 2606–2612. [Google Scholar] [CrossRef] [PubMed]
- Cancer Genome Atlas, N. Comprehensive molecular portraits of human breast tumours. Nature 2012, 490, 61–70. [Google Scholar] [CrossRef] [PubMed]
- Gao, Q.S.; Liang, W.W.; Foltz, S.M.; Mutharasu, G.; Jayasinghe, R.G.; Cao, S.; Liao, W.W.; Reynolds, S.M.; Wyczalkowski, M.A.; Yao, L.J.; et al. Driver Fusions and Their Implications in the Development and Treatment of Human Cancers. Cell Rep. 2018, 23, 227–238. [Google Scholar] [CrossRef]
- Edgren, H.; Murumagi, A.; Kangaspeska, S.; Nicorici, D.; Hongisto, V.; Kleivi, K.; Rye, I.H.; Nyberg, S.; Wolf, M.; Borresen-Dale, A.L.; et al. Identification of fusion genes in breast cancer by paired-end RNA-sequencing. Genome Biol. 2011, 12, R6. [Google Scholar] [CrossRef]
- Lips, E.H.; Michaut, M.; Hoogstraat, M.; Mulder, L.; Besselink, N.J.M.; Koudijs, M.J.; Cuppen, E.; Voest, E.E.; Bernards, R.; Nederlof, P.M.; et al. Next generation sequencing of triple negative breast cancer to find predictors for chemotherapy response. Breast Cancer Res. 2015, 17, 134. [Google Scholar] [CrossRef]
- Tao, Z.H.; Liu, J.X.; Li, T.; Xu, H.; Chen, K.; Zhang, J.; Zhou, H.; Sun, J.; Han, J.M.; Guo, Z.J.; et al. Profiling Receptor Tyrosine Kinase Fusions in Chinese Breast Cancers. Front. Oncol. 2021, 11, 741142. [Google Scholar] [CrossRef]
- Krijgsman, O.; Carvalho, B.; Meijer, G.A.; Steenbergen, R.D.; Ylstra, B. Focal chromosomal copy number aberrations in cancer-Needles in a genome haystack. Biochim. Biophys. Acta 2014, 1843, 2698–2704. [Google Scholar] [CrossRef]
- Nagel, S.; Meyer, C. Normal and Aberrant TALE-Class Homeobox Gene Activities in Pro-B-Cells and B-Cell Precursor Acute Lymphoblastic Leukemia. Int. J. Mol. Sci. 2022, 23, 11874. [Google Scholar] [CrossRef]
- Nagel, S.; Pommerenke, C.; Meyer, C.; MacLeod, R.A.F.; Drexler, H.G. Establishment of the TALE-code reveals aberrantly activated homeobox gene PBX1 in Hodgkin lymphoma. PLoS ONE 2021, 16, e0246603. [Google Scholar] [CrossRef]
- Nagel, S.; Pommerenke, C.; Meyer, C.; MacLeod, R.A.F. The Hematopoietic TALE-Code Shows Normal Activity of IRX1 in Myeloid Progenitors and Reveals Ectopic Expression of IRX3 and IRX5 in Acute Myeloid Leukemia. Int. J. Mol. Sci. 2022, 23, 3192. [Google Scholar] [CrossRef]
- Nagel, S. The Role of IRX Homeobox Genes in Hematopoietic Progenitors and Leukemia. Genes 2023, 14, 297. [Google Scholar] [CrossRef] [PubMed]
- Tarantino, P.; Viale, G.; Press, M.F.; Hu, X.; Penault-Llorca, F.; Bardia, A.; Batistatou, A.; Burstein, H.J.; Carey, L.A.; Cortes, J.; et al. ESMO expert consensus statements (ECS) on the definition, diagnosis, and management of HER2-low breast cancer. Ann. Oncol. 2023, 34, 645–659. [Google Scholar] [CrossRef]
- Incorvaia, L.; Fanale, D.; Bono, M.; Calo, V.; Fiorino, A.; Brando, C.; Corsini, L.R.; Cutaia, S.; Cancelliere, D.; Pivetti, A.; et al. BRCA1/2 pathogenic variants in triple-negative versus luminal-like breast cancers: Genotype-phenotype correlation in a cohort of 531 patients. Ther. Adv. Med. Oncol. 2020, 12, 1758835920975326. [Google Scholar] [CrossRef]
- Ray, M.E.; Su, Y.A.; Meltzer, P.S.; Trent, J.M. Isolation and characterization of genes associated with chromosome-6 mediated tumor suppression in human malignant melanoma. Oncogene 1996, 12, 2527–2533. [Google Scholar] [PubMed]
- Ray, M.E.; Wistow, G.; Su, Y.A.; Meltzer, P.S.; Trent, J.M. AIM1, a novel non-lens member of the beta gamma-crystallin superfamily, is associated with the control of tumorigenicity in human malignant melanoma. Proc. Natl. Acad. Sci. USA 1997, 94, 3229–3234. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.F.; Zhang, Y.M.; Yin, L.N.; Cai, B.H.; Huang, P.; Li, X.K.; Liang, G. Fibroblast growth factor receptor fusions in cancer: Opportunities and challenges. J. Exp. Clin. Canc Res. 2021, 40, 345. [Google Scholar] [CrossRef]
- Haffner, M.C.; Esopi, D.M.; Chaux, A.; Gürel, M.; Ghosh, S.; Vaghasia, A.M.; Tsai, H.; Kim, K.; Castagna, N.; Lam, H.; et al. AIM1 is an actin-binding protein that suppresses cell migration and micrometastatic dissemination. Nat. Commun. 2017, 8, 142. [Google Scholar] [CrossRef]
- Wu, F.; Cheng, L.K.; Yu, Q.; Zhang, L.; Li, H.; Wang, C.Y. Purification and Functional Characterization of the C-Terminal Domain of the -Actin-Binding Protein AIM1 In Vitro. Molecules 2018, 23, 3281. [Google Scholar] [CrossRef]
- Park, I.; Kim, K.E.; Kim, J.; Kim, A.K.; Bae, S.; Jung, M.; Choi, J.; Mishra, P.K.; Kim, T.M.; Kwak, C.; et al. Mitochondrial matrix RTN4IP1/OPA10 is an oxidoreductase for coenzyme Q synthesis. Nat. Chem. Biol. 2023, 20, 221–233. [Google Scholar] [CrossRef]
- Hu, W.H.; Hausmann, O.N.; Yan, M.S.; Walters, W.M.; Wong, P.K.; Bethea, J.R. Identification and characterization of a novel Nogo-interacting mitochondrial protein (NIMP). J. Neurochem. 2002, 81, 36–45. [Google Scholar] [CrossRef]
- Angebault, C.; Guichet, P.O.; Talmat-Amar, Y.; Charif, M.; Gerber, S.; Fares-Taie, L.; Gueguen, N.; Halloy, F.; Moore, D.; Amati-Bonneau, P.; et al. Recessive Mutations in RTN4IP1 Cause Isolated and Syndromic Optic Neuropathies. Am. J. Hum. Genet. 2015, 97, 754–760. [Google Scholar] [CrossRef]
- Wang, X.; Li, X.; Jiang, W. High expression of RTN4IP1 predicts adverse prognosis for patients with breast cancer. Transl. Cancer Res. 2023, 12, 859–872. [Google Scholar] [CrossRef]
- Lewis, M.T.; Ross, S.; Strickland, P.A.; Snyder, C.J.; Daniel, C.W. Regulated expression patterns of IRX-2, an Iroquois-class homeobox gene, in the human breast. Cell Tissue Res. 1999, 296, 549–554. [Google Scholar] [CrossRef] [PubMed]
- Kamalakaran, S.; Varadan, V.; Giercksky Russnes, H.E.; Levy, D.; Kendall, J.; Janevski, A.; Riggs, M.; Banerjee, N.; Synnestvedt, M.; Schlichting, E.; et al. DNA methylation patterns in luminal breast cancers differ from non-luminal subtypes and can identify relapse risk independent of other clinical variables. Mol. Oncol. 2011, 5, 77–92. [Google Scholar] [CrossRef]
- Werner, S.; Stamm, H.; Pandjaitan, M.; Kemming, D.; Brors, B.; Pantel, K.; Wikman, H. Iroquois homeobox 2 suppresses cellular motility and chemokine expression in breast cancer cells. BMC Cancer 2015, 15, 896. [Google Scholar] [CrossRef] [PubMed]
- Yoda, T.; McNamara, K.M.; Miki, Y.; Onodera, Y.; Takagi, K.; Nakamura, Y.; Ishida, T.; Suzuki, T.; Ohuchi, N.; Sasano, H. KLF15 in breast cancer: A novel tumor suppressor? Cell Oncol. 2015, 38, 227–235. [Google Scholar] [CrossRef]
- Boehm, J.S.; Golub, T.R. An ecosystem of cancer cell line factories to support a cancer dependency map. Nat. Rev. Genet. 2015, 16, 373–374. [Google Scholar] [CrossRef]
- Comsa, S.; Cimpean, A.M.; Raica, M. The Story of MCF-7 Breast Cancer Cell Line: 40 years of Experience in Research. Anticancer. Res. 2015, 35, 3147–3154. [Google Scholar] [PubMed]







| Cell Line | Origin | Stage | Histologic Subtype | Sex | Age | Site of Sampling | P/M | Refs |
|---|---|---|---|---|---|---|---|---|
| BT-474 | breast ductal carcinoma | invasive | ductal | f | 60 | breast | P | [17] |
| CAL-120 | breast adenocarcinoma | invasive | na | f | 43 | PE | M | * |
| CAL-148 | breast adenocarcinoma | invasive | ductal | f | 58 | PE | M | [18] |
| CAL-51 | breast adenocarcinoma | invasive | ductal | f | 45 | PE | M | [19] |
| CAL-85-1 | breast adenocarcinoma | invasive | ductal | f | 35 | breast | M | [18] |
| COLO-824 | breast carcinoma | invasive | na | f | 52 | PE | M | * |
| DU-4475 | breast ductal carcinoma | invasive | ductal | f | 62 | skin | M | [20] |
| EFM-19 | breast ductal carcinoma | invasive | ductal | f | 50 | PE | M | [21] |
| EFM-192A 1 | breast adenocarcinoma | invasive | na | f | 46 | PE | M | * |
| EFM-192B 1 | breast adenocarcinoma | invasive | na | f | 46 | PE | M | * |
| EFM-192C 1 | breast adenocarcinoma | invasive | na | f | 46 | PE | M | * |
| ETCC-006 2 | breast ductal carcinoma | in situ | ductal | f | 47 | breast | P | [22] |
| ETCC-007 2 | breast ductal carcinoma | in situ | ductal | f | 47 | breast | P | [22] |
| EVSA-T | breast carcinoma | invasive | na | f | 58 | ascites | M | [23] |
| HCC-1143 3 | breast ductal carcinoma | invasive | ductal | f | 52 | breast | P | [24] |
| HCC-1599 3 | breast ductal carcinoma | invasive | ductal | f | 44 | breast | P | [24] |
| HCC-1937 3 | breast ductal carcinoma | invasive | ductal | f | 24 | breast | P | [24] |
| HDQ-P1 | breast ductal carcinoma | invasive | ductal | f | 50 | breast | P | [25] |
| HS-578T | breast carcinosarcoma | invasive | ductal | f | 74 | breast | P | [26] |
| IPH-926 | breast lobular carcinoma | invasive | lobular | f | 72 | ascites | M | [27] |
| JIMT-1 | breast ductal carcinoma | invasive | ductal | f | 62 | PE | M | [28] |
| KPL-1 4 | breast adenocarcinoma | invasive | na | f | 69 | PE | M | [10] |
| MCF-7 | breast adenocarcinoma | invasive | na | f | 69 | PE | M | [10] |
| MDA-MB-231 | breast carcinoma | invasive | na | f | 51 | PE | M | [29] |
| MDA-MB-453 | breast carcinoma | invasive | na | f | 48 | PF | M | [29] |
| MDA-MB-468 | breast carcinoma | invasive | na | f | 51 | PE | M | [29] |
| MFM-223 | breast ductal carcinoma | invasive | ductal | f | >45 | PE | M | [30] |
| SK-BR-3 | breast adenocarcinoma | invasive | na | f | 43 | PE | M | [31] |
| T-47D | breast ductal carcinoma | invasive | ductal | f | 54 | PE | M | [32] |
| Name | Sequence (5′→3′) | Product Size [bp] |
|---|---|---|
| FGFR2_ex9_fwd 1 | TGTATGGTGGTAACAGTCATCC | 240 and 246 |
| CRYBG1_ex18_rev 2 | CTGAACAGAGCGTATTTGTGTG | |
| RTN4IP1_ex8_fwd 3 | GGAAAGGAGTCCATTATCGCTG | 206 |
| CRYBG1_ex3_rev 2 | TGATCTGGTGGGACTCTCTAAC | |
| ABL1_fwd | TGACTTTGAGCCTCAGGGTCTGAGTGAAGCC | 216 (mRNA) 779 (gene) |
| ABL1_rev | CCATTTTTGGTTTGGGCTTCACACCATTCC |
| Cell Line | ER | PR | AR | HER2 | TNBC | Cluster | PAM50 Subtype |
|---|---|---|---|---|---|---|---|
| BT-474 | ++ | ++ | ++ | +++ | A | luminal | |
| CAL-120 | yes | B | basal-like | ||||
| CAL-148 | + | + | yes | A | luminal | ||
| CAL-51 | + | yes | B | basal-like | |||
| CAL-85-1 | + | yes | B | basal-like | |||
| COLO-824 | + | yes | B | basal-like | |||
| DU-4475 | yes | B | luminal | ||||
| EFM-19 | +++ | ++ | ++ | ++ | A | luminal | |
| EFM-192A | + | +++ | A | luminal | |||
| EFM-192B | + | +++ | A | luminal | |||
| EFM-192C | ++ | + | + | +++ | A | luminal | |
| ETCC-006 | yes | B | basal-like | ||||
| ETCC-007 | + | yes | B | luminal | |||
| EVSA-T | ++ | A | luminal | ||||
| HCC-1143 | + | yes | B | basal-like | |||
| HCC-1599 | + | yes | B | basal-like | |||
| HCC-1937 | + | yes | B | basal-like | |||
| HDQ-P1 | + | yes | B | luminal | |||
| HS-578T | yes | B | luminal | ||||
| IPH-926 | ++ | A | luminal | ||||
| JIMT-1 | ++ | B | luminal | ||||
| KPL-1 | +++ | +++ | + | A | luminal | ||
| MCF-7 | +++ | + | A | luminal | |||
| MDA-MB-231 | yes | B | basal-like | ||||
| MDA-MB-453 | +++ | ++ | A | luminal | |||
| MDA-MB-468 | yes | B | basal-like | ||||
| MFM-223 | +++ | yes | A | luminal | |||
| SK-BR-3 | ++ | A | luminal | ||||
| T-47D | +++ | +++ | ++ | ++ | A | luminal |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pommerenke, C.; Nagel, S.; Haake, J.; Koelz, A.L.; Christgen, M.; Steenpass, L.; Eberth, S. Molecular Characterization and Subtyping of Breast Cancer Cell Lines Provide Novel Insights into Cancer Relevant Genes. Cells 2024, 13, 301. https://doi.org/10.3390/cells13040301
Pommerenke C, Nagel S, Haake J, Koelz AL, Christgen M, Steenpass L, Eberth S. Molecular Characterization and Subtyping of Breast Cancer Cell Lines Provide Novel Insights into Cancer Relevant Genes. Cells. 2024; 13(4):301. https://doi.org/10.3390/cells13040301
Chicago/Turabian StylePommerenke, Claudia, Stefan Nagel, Josephine Haake, Anne Leena Koelz, Matthias Christgen, Laura Steenpass, and Sonja Eberth. 2024. "Molecular Characterization and Subtyping of Breast Cancer Cell Lines Provide Novel Insights into Cancer Relevant Genes" Cells 13, no. 4: 301. https://doi.org/10.3390/cells13040301
APA StylePommerenke, C., Nagel, S., Haake, J., Koelz, A. L., Christgen, M., Steenpass, L., & Eberth, S. (2024). Molecular Characterization and Subtyping of Breast Cancer Cell Lines Provide Novel Insights into Cancer Relevant Genes. Cells, 13(4), 301. https://doi.org/10.3390/cells13040301

