JRM-28, a Novel HDAC2 Inhibitor, Upregulates Plasticity-Associated Proteins in Hippocampal Neurons and Enhances Morphological Plasticity via Activation of CREB: Implications for Alzheimer’s Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Cell Lines
2.2. Reagents for Chemical Synthesis
2.3. Preparation of Structures for Docking
2.4. In Silico Docking of JRM-28a in HDAC2 and HDAC4
2.5. HDAC2 Inhibition Assay
2.6. Luminometric Method
2.7. Fluorimetric Method
2.8. Cell Culture Strategies of Primary Hippocampal Neurons, SHSY5Y, and AD Neurons
2.9. Lactate Dehydrogenase Assay
2.10. TUNEL Assay
2.11. Measurement of Spine Density and Size
2.12. Calcium Influx Assay in Neuronal Stem Cells
2.13. Semi-Quantitative RT-PCR
2.14. Immunofluorescence Analysis
2.15. Immunoblot Assay
2.16. Creb siRNA Transfection
2.17. CRE Luciferase Assay
2.18. Statistical Analyses
3. Results
3.1. Synthesis and Characterization of Novel HDAC2 Inhibitor JRM-28
3.2. JRM-28-Augmented Morphological Plasticity in Neurons
3.3. JRM-28-Induced Morphological Plasticity via Transcriptional Activation of CREB
3.4. JRM-28 Augments Morphological Plasticity in iPSC-Derived AD Neurons via Activation of CREB
4. Discussion
4.1. JRM-28 Is a Selective HDAC2 Inhibitor
4.2. JRM-28 Displays a Strong Neuroprotective Response by Inducing Morphological Plasticity in Neurons
4.3. The JRM-28-Mediated Inactivation of HDAC2 Triggers the Transcriptional Activation of CREB
4.4. JRM-28 Upregulates Neuronal Plasticity in AD Neurons
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Papa, M.; Segal, M. Morphological plasticity in dendritic spines of cultured hippocampal neurons. Neuroscience 1996, 71, 1005–1011. [Google Scholar] [CrossRef] [PubMed]
- Jan, Y.-N.; Jan, L.Y. Branching out: Mechanisms of dendritic arborization. Nat. Rev. Neurosci. 2010, 11, 316–328. [Google Scholar] [CrossRef] [PubMed]
- Borczyk, M.; Śliwińska, M.A.; Caly, A.; Bernas, T.; Radwanska, K. Neuronal plasticity affects correlation between the size of dendritic spine and its postsynaptic density. Sci. Rep. 2019, 9, 1693. [Google Scholar] [CrossRef] [PubMed]
- Yuste, R.; Bonhoeffer, T. Morphological changes in dendritic spines associated with long-term synaptic plasticity. Annu. Rev. Neurosci. 2001, 24, 1071–1089. [Google Scholar] [CrossRef] [PubMed]
- Walmsley, B. Signalling at the synapse: Regulation of the post-synaptic response to quantal transmitter release. Immunol. Cell Biol. 1998, 76, 430–435. [Google Scholar] [CrossRef]
- Roy, A.; Modi, K.K.; Khasnavis, S.; Ghosh, S.; Watson, R.; Pahan, K. Enhancement of Morphological Plasticity in Hippocampal Neurons by a Physically Modified Saline via Phosphatidylinositol-3 Kinase. PLoS ONE 2014, 9, e101883. [Google Scholar] [CrossRef]
- Gipson, C.D.; Olive, M.F. Structural and functional plasticity of dendritic spines–root or result of behavior? Genes Brain Behav. 2017, 16, 101–117. [Google Scholar] [CrossRef]
- Lippman, J.; Dunaevsky, A. Dendritic spine morphogenesis and plasticity. J. Neurobiol. 2005, 64, 47–57. [Google Scholar] [CrossRef]
- Peng, Y.-R.; He, S.; Marie, H.; Zeng, S.-Y.; Ma, J.; Tan, Z.-J.; Lee, S.Y.; Malenka, R.C.; Yu, X. Coordinated changes in dendritic arborization and synaptic strength during neural circuit development. Neuron 2009, 61, 71–84. [Google Scholar] [CrossRef]
- Majewska, A.K.; Newton, J.R.; Sur, M. Remodeling of synaptic structure in sensory cortical areas in vivo. J. Neurosci. 2006, 26, 3021–3029. [Google Scholar] [CrossRef]
- Pérez-González, M.; Badesso, S.; Lorenzo, E.; Guruceaga, E.; Pérez-Mediavilla, A.; García-Osta, A.; Cuadrado-Tejedor, M. Identifying the main functional pathways associated with cognitive resilience to Alzheimer’s disease. Int. J. Mol. Sci. 2021, 22, 9120. [Google Scholar] [CrossRef] [PubMed]
- Walker, C.K.; Herskowitz, J.H. Dendritic spines: Mediators of cognitive resilience in aging and Alzheimer’s disease. Neuroscientist 2021, 27, 487–505. [Google Scholar] [CrossRef] [PubMed]
- Krämer, O.H. HDAC2: A critical factor in health and disease. Trends Pharmacol. Sci. 2009, 30, 647–655. [Google Scholar] [CrossRef] [PubMed]
- Shukla, S.; Tekwani, B.L. Histone deacetylases inhibitors in neurodegenerative diseases, neuroprotection and neuronal differentiation. Front. Pharmacol. 2020, 11, 462398. [Google Scholar] [CrossRef]
- Sada, N.; Fujita, Y.; Mizuta, N.; Ueno, M.; Furukawa, T.; Yamashita, T. Inhibition of HDAC increases BDNF expression and promotes neuronal rewiring and functional recovery after brain injury. Cell Death Dis. 2020, 11, 655. [Google Scholar] [CrossRef]
- Sun, X.-Y.; Zheng, T.; Yang, X.; Liu, L.; Gao, S.-S.; Xu, H.-B.; Song, Y.-T.; Tong, K.; Yang, L.; Gao, Y.; et al. HDAC2 hyperexpression alters hippocampal neuronal transcription and microglial activity in neuroinflammation-induced cognitive dysfunction. J. Neuroinflamm. 2019, 16, 249. [Google Scholar] [CrossRef]
- Hubbert, C.; Guardiola, A.; Shao, R.; Kawaguchi, Y.; Ito, A.; Nixon, A.; Yoshida, M.; Wang, X.-F.; Yao, T.-P. HDAC6 is a microtubule-associated deacetylase. Nature 2002, 417, 455–458. [Google Scholar] [CrossRef]
- Guan, J.-S.; Haggarty, S.J.; Giacometti, E.; Dannenberg, J.-H.; Joseph, N.; Gao, J.; Nieland, T.J.F.; Zhou, Y.; Wang, X.; Mazitschek, R.; et al. HDAC2 negatively regulates memory formation and synaptic plasticity. Nature 2009, 459, 55–60. [Google Scholar] [CrossRef]
- Mwakwari, S.C.; Patil, V.; Guerrant, W.; Oyelere, A.K. Macrocyclic histone deacetylase inhibitors. Curr. Top. Med. Chem. 2010, 10, 1423–1440. [Google Scholar] [CrossRef]
- Finnin, M.S.; Donigian, J.R.; Cohen, A.; Richon, V.M.; Rifkind, R.A.; Marks, P.A.; Breslow, R.; Pavletich, N.P. Structures of a histone deacetylase homologue bound to the TSA and SAHA inhibitors. Nature 1999, 401, 188–193. [Google Scholar] [CrossRef]
- Vannini, A.; Volpari, C.; Filocamo, G.; Casavola, E.C.; Brunetti, M.; Renzoni, D.; Chakravarty, P.; Paolini, C.; De Francesco, R.; Gallinari, P.; et al. Crystal structure of a eukaryotic zinc-dependent histone deacetylase, human HDAC8, complexed with a hydroxamic acid inhibitor. Proc. Natl. Acad. Sci. USA 2004, 101, 15064–15069. [Google Scholar] [CrossRef] [PubMed]
- Belayet, J.B.; Beamish, S.; Rahaman, M.; Alanani, S.; Virdi, R.S.; Frick, D.N.; Rahman, A.; Ulicki, J.S.; Biswas, S.; Arnold, L.A.; et al. Development of a Novel, Small-Molecule Brain-Penetrant Histone Deacetylase Inhibitor That Enhances Spatial Memory Formation in Mice. J. Med. Chem. 2022, 65, 3388–3403. [Google Scholar] [CrossRef] [PubMed]
- Roy, A.; Kundu, M.; Jana, M.; Mishra, R.K.; Yung, Y.; Luan, C.-H.; Gonzalez, F.J.; Pahan, K. Identification and characterization of PPARα ligands in the hippocampus. Nat. Chem. Biol. 2016, 12, 1075–1083. [Google Scholar] [CrossRef] [PubMed]
- Murphy, D.D.; Segal, M. Morphological plasticity of dendritic spines in central neurons is mediated by activation of cAMP response element binding protein. Proc. Natl. Acad. Sci. USA 1997, 94, 1482–1487. [Google Scholar] [CrossRef]
- Roy, A.; Jana, M.; Kundu, M.; Corbett, G.T.; Rangaswamy, S.B.; Mishra, R.K.; Luan, C.H.; Gonzalez, F.J.; Pahan, K. HMG-CoA Reductase Inhibitors Bind to PPARα to Upregulate Neurotrophin Expression in the Brain and Improve Memory in Mice. Cell Metab. 2015, 22, 253–265. [Google Scholar] [CrossRef]
- Gottschalk, G.; Peterson, D.; Knox, K.; Maynard, M.; Whelan, R.J.; Roy, A. Elevated ATG13 in serum of patients with ME/CFS stimulates oxidative stress response in microglial cells via activation of receptor for advanced glycation end products (RAGE). Mol. Cell. Neurosci. 2022, 120, 103731. [Google Scholar] [CrossRef]
- Roy, A.; Jana, M.; Corbett, G.T.; Ramaswamy, S.; Kordower, J.H.; Gonzalez, F.J.; Pahan, K. Regulation of Cyclic AMP Response Element Binding and Hippocampal Plasticity-Related Genes by Peroxisome Proliferator-Activated Receptor α. Cell Rep. 2013, 4, 724–737. [Google Scholar] [CrossRef]
- Gonzalez-Zuniga, M.; Contreras, P.S.; Estrada, L.D.; Chamorro, D.; Villagra, A.; Zanlungo, S.; Seto, E.; Alvarez, A.R. c-Abl stabilizes HDAC2 levels by tyrosine phosphorylation repressing neuronal gene expression in Alzheimer’s disease. Mol. Cell 2014, 56, 163–173. [Google Scholar] [CrossRef]
- Kim, T.; Song, S.; Park, Y.; Kang, S.; Seo, H. HDAC inhibition by valproic acid induces neuroprotection and improvement of PD-like behaviors in LRRK2 R1441G transgenic mice. Exp. Neurobiol. 2019, 28, 504. [Google Scholar] [CrossRef]
- Lin, Y.-H.; Dong, J.; Tang, Y.; Ni, H.-Y.; Zhang, Y.; Su, P.; Liang, H.-Y.; Yao, M.-C.; Yuan, H.-J.; Wang, D.-L. Opening a new time window for treatment of stroke by targeting HDAC2. J. Neurosci. 2017, 37, 6712–6728. [Google Scholar] [CrossRef]
- Behera, J.; Jayaprakash, V.; Sinha, B.N. Histone deacetylase inhibitors: A review on class-I specific inhibition. Mini Rev. Med. Chem. 2015, 15, 731–750. [Google Scholar] [CrossRef] [PubMed]
- Furumai, R.; Matsuyama, A.; Kobashi, N.; Lee, K.H.; Nishiyama, M.; Nakajima, H.; Tanaka, A.; Komatsu, Y.; Nishino, N.; Yoshida, M.; et al. FK228 (depsipeptide) as a natural prodrug that inhibits class I histone deacetylases. Cancer Res. 2002, 62, 4916–4921. [Google Scholar] [PubMed]
- Bertino, E.M.; Otterson, G.A. Romidepsin: A novel histone deacetylase inhibitor for cancer. Expert Opin. Investig. Drugs 2011, 20, 1151–1158. [Google Scholar] [CrossRef] [PubMed]
- Harrison, S.J.; Bishton, M.; Bates, S.E.; Grant, S.; Piekarz, R.L.; Johnstone, R.W.; Dai, Y.; Lee, B.; Araujo, M.E.; Prince, H.M. A focus on the preclinical development and clinical status of the histone deacetylase inhibitor, romidepsin (depsipeptide, Istodax(®)). Epigenomics 2012, 4, 571–589. [Google Scholar] [CrossRef]
- Ganesan, A. Romidepsin and the Zinc-Binding Thiol Family of Natural Product HDAC Inhibitors. Success. Drug Discov. 2016, 2, 13–29. [Google Scholar]
- Bottomley, M.J.; Lo Surdo, P.; Di Giovine, P.; Cirillo, A.; Scarpelli, R.; Ferrigno, F.; Jones, P.; Neddermann, P.; De Francesco, R.; Steinkühler, C.; et al. Structural and functional analysis of the human HDAC4 catalytic domain reveals a regulatory structural zinc-binding domain. J. Biol. Chem. 2008, 283, 26694–26704. [Google Scholar] [CrossRef]
- Tang, Q.; Maul Gerd, G. Mouse Cytomegalovirus Immediate-Early Protein 1 Binds with Host Cell Repressors To Relieve Suppressive Effects on Viral Transcription and Replication during Lytic Infection. J. Virol. 2003, 77, 1357–1367. [Google Scholar] [CrossRef]
- Arikkath, J. Molecular mechanisms of dendrite morphogenesis. Front. Cell. Neurosci. 2012, 6, 61. [Google Scholar] [CrossRef]
- Monteiro, A.R.; Barbosa, D.J.; Remião, F.; Silva, R. Alzheimer’s disease: Insights and new prospects in disease pathophysiology, biomarkers and disease-modifying drugs. Biochem. Pharmacol. 2023, 211, 115522. [Google Scholar] [CrossRef]
- Tzioras, M.; McGeachan, R.I.; Durrant, C.S.; Spires-Jones, T.L. Synaptic degeneration in Alzheimer disease. Nat. Rev. Neurol. 2023, 19, 19–38. [Google Scholar] [CrossRef]
- Mijalkov, M.; Volpe, G.; Fernaud-Espinosa, I.; DeFelipe, J.; Pereira, J.B.; Merino-Serrais, P. Dendritic spines are lost in clusters in Alzheimer’s disease. Sci. Rep. 2021, 11, 12350. [Google Scholar] [CrossRef] [PubMed]
- Ahmad Ganai, S.; Ramadoss, M.; Mahadevan, V. Histone Deacetylase (HDAC) Inhibitors-emerging roles in neuronal memory, learning, synaptic plasticity and neural regeneration. Curr. Neuropharmacol. 2016, 14, 55–71. [Google Scholar] [CrossRef] [PubMed]
- Singh, P.; Thakur, M. Histone deacetylase 2 inhibition attenuates downregulation of hippocampal plasticity gene expression during aging. Mol. Neurobiol. 2018, 55, 2432–2442. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.-S.; Zhang, R.; Wang, G.; Zhang, Y.-F. The development prospection of HDAC inhibitors as a potential therapeutic direction in Alzheimer’s disease. Transl. Neurodegener. 2017, 6, 19. [Google Scholar] [CrossRef]
- Yang, W.; Chauhan, A.; Wegiel, J.; Kuchna, I.; Gu, F.; Chauhan, V. Effect of trichostatin A on gelsolin levels, proteolysis of amyloid precursor protein, and amyloid beta-protein load in the brain of transgenic mouse model of Alzheimer’s disease. Curr. Alzheimer Res. 2014, 11, 1002–1011. [Google Scholar] [CrossRef]
- Liu, D.; Tang, H.; Li, X.-Y.; Deng, M.-F.; Wei, N.; Wang, X.; Zhou, Y.-F.; Wang, D.-Q.; Fu, P.; Wang, J.-Z. Targeting the HDAC2/HNF-4A/miR-101b/AMPK pathway rescues tauopathy and dendritic abnormalities in Alzheimer’s disease. Mol. Ther. 2017, 25, 752–764. [Google Scholar] [CrossRef]
- Guzowski, J.F.; McGaugh, J.L. Antisense oligodeoxynucleotide-mediated disruption of hippocampal cAMP response element binding protein levels impairs consolidation of memory for water maze training. Proc. Natl. Acad. Sci. USA 1997, 94, 2693–2698. [Google Scholar] [CrossRef]
- Impey, S.; Smith, D.M.; Obrietan, K.; Donahue, R.; Wade, C.; Storm, D.R. Stimulation of cAMP response element (CRE)-mediated transcription during contextual learning. Nat. Neurosci. 1998, 1, 595–601. [Google Scholar] [CrossRef]
- Yin, J.C.; Del Vecchio, M.; Zhou, H.; Tully, T. CREB as a memory modulator: Induced expression of a dCREB2 activator isoform enhances long-term memory in Drosophila. Cell 1995, 81, 107–115. [Google Scholar] [CrossRef]
- Mayr, B.; Montminy, M. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2001, 2, 599–609. [Google Scholar] [CrossRef]
- Maiti, P.; Manna, J.; Ilavazhagan, G.; Rossignol, J.; Dunbar, G.L. Molecular regulation of dendritic spine dynamics and their potential impact on synaptic plasticity and neurological diseases. Neurosci. Biobehav. Rev. 2015, 59, 208–237. [Google Scholar] [CrossRef] [PubMed]
- Kulkarni, V.A.; Firestein, B.L. The dendritic tree and brain disorders. Mol. Cell. Neurosci. 2012, 50, 10–20. [Google Scholar] [CrossRef] [PubMed]
- John, A.; Reddy, P.H. Synaptic basis of Alzheimer’s disease: Focus on synaptic amyloid beta, P-tau and mitochondria. Ageing Res. Rev. 2021, 65, 101208. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Whitesides, G.M. Reagents for rapid reduction of disulfide bonds in proteins. In Techniques in Protein Chemistry; Crabb, J.W., Ed.; Academic Press: Cambridge, MA, USA, 1995; pp. 259–266. [Google Scholar]
- Li, X.; Gluth, A.; Zhang, T.; Qian, W.J. Thiol redox proteomics: Characterization of thiol-based post-translational modifications. Proteomics 2023, 23, e2200194. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, P.A.; Ramos, M.J. Theoretical insights into the mechanism for thiol/disulfide exchange. Chemistry 2004, 10, 257–266. [Google Scholar] [CrossRef]
- Ge, C.; Wang, H.; Zhang, B.; Yao, J.; Li, X.; Feng, W.; Zhou, P.; Wang, Y.; Fang, J. A thiol-thiosulfonate reaction providing a novel strategy for turn-on thiol sensing. Chem. Commun. 2015, 51, 14913–14916. [Google Scholar] [CrossRef]
Recombinant Proteins/Antibodies | Catalog # | Vendor | Application |
---|---|---|---|
HDAC1 protein | 50051 | BPS Bioscience, San Diego, CA, USA. | Luminescence/fluorescence binding assay |
HDAC2 protein | 50002 | BPS Bioscience, | Luminescence/fluorescence binding assay |
HDAC3 protein | 50003 | BPS Bioscience | Luminescence/fluorescence binding assay |
HDAC6 protein | 50056 | BPS Bioscience. | Luminescence/fluorescence binding assay |
Anti-HDAC2 ab | MA5-32101 | Invitrogen, Waltham, MA, USA | IB (1:500), IF (1:250) |
Anti-MAP2 ab | 13-1500 | Invitrogen | IB (1:500), IF (1:250) |
Anti-CREB ab | MA1-083 | Invitrogen | IB (1:500), IF (1:250) |
Anti-NR2A ab | 28525-1-AP | Proteintech Group, Rosemont, IL, USA | IB (1:500), IF (1:250) |
Anti-GluR1 ab | MA5-32344 | Invitrogen | IB (1:500), IF (1:250) |
Gene | Forward Primer | Reverse Primer | Product Length |
---|---|---|---|
creb | ATTGCCACATTAGCCCAGGT | GTGTAGGAAGTGCTGAAGTCTC | 400 |
atf-1 | GCCCCCAAATAAAAAGACGAGG | TGCTGGGCACAAGTATCTGC | 355 |
crem | GTGAGCTGAGATCAGGCACCAG | TTCAAGCACAGCCACACGAT | 806 |
Antibody | Vendor | Catalog# | Host | Application | Dilution |
---|---|---|---|---|---|
NR2A/GRIN2A Polyclonal antibody | Proteintech | 28525-1-AP | Rabbit | WB, IF | 1:1000 (WB) 1:250 (IF) |
GluR1 Monoclonal Antibody | Invitrogen | MA5-32344 | Rabbit | WB, IF | 1:500 (WB) 1:250 (IF) |
MAP2 Monoclonal Antibody | Invitrogen | 13-1500 | Mouse | WB, IF | 1:500 (WB) 1:250 (IF) |
CREB Monoclonal Antibody | Invitrogen | MA1-083 | Mouse | WB, IF | 1:500 (WB) 1:250 (IF) |
Synptotagmin mo | Invitrogen | MA1-25568 | Mouse | IF | 1:250 (IF) |
beta Actin Monoclonal Antibody | Invitrogen | MA5-15739 | Mouse | WB | 1:1000 (WB) |
IRDye® 680 anti-Mouse 2° Antibody | Li-Cor | 926-68072 | Donkey | WB | 1:500 (WB) |
IRDye® 680 anti-Rabbit 2° Antibody | Li-Cor | 926-68073 | Donkey | WB | 1:500 (WB) |
IRDye® 800 anti-Rabbit 2° Antibody | Li-Cor | 926-32213 | Donkey | WB | 1:500 (WB) |
IRDye® 800 anti-Mouse 2° Antibody | Li-Cor | 926-32212 | Donkey | WB | 1:500 (WB) |
Goat anti-Rabbit 2° Antibody, TRITC | Invitrogen | T-2769 | Goat | IF | 1:200 |
Goat anti-Mouse, Alexa Fluor™ 488 2° Antibody | Invitrogen | A-21121 | Goat | IF | 1:200 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rahman, A.F.M.T.; Bulbule, S.; Belayet, J.B.; Benko, A.; Gottschalk, C.G.; Frick, D.N.; Arnold, L.A.; Hossain, M.M.; Roy, A. JRM-28, a Novel HDAC2 Inhibitor, Upregulates Plasticity-Associated Proteins in Hippocampal Neurons and Enhances Morphological Plasticity via Activation of CREB: Implications for Alzheimer’s Disease. Cells 2024, 13, 1964. https://doi.org/10.3390/cells13231964
Rahman AFMT, Bulbule S, Belayet JB, Benko A, Gottschalk CG, Frick DN, Arnold LA, Hossain MM, Roy A. JRM-28, a Novel HDAC2 Inhibitor, Upregulates Plasticity-Associated Proteins in Hippocampal Neurons and Enhances Morphological Plasticity via Activation of CREB: Implications for Alzheimer’s Disease. Cells. 2024; 13(23):1964. https://doi.org/10.3390/cells13231964
Chicago/Turabian StyleRahman, A. F. M. Towheedur, Sarojini Bulbule, Jawad Bin Belayet, Anna Benko, Carl Gunnar Gottschalk, David N. Frick, Leggy A. Arnold, M. Mahmun Hossain, and Avik Roy. 2024. "JRM-28, a Novel HDAC2 Inhibitor, Upregulates Plasticity-Associated Proteins in Hippocampal Neurons and Enhances Morphological Plasticity via Activation of CREB: Implications for Alzheimer’s Disease" Cells 13, no. 23: 1964. https://doi.org/10.3390/cells13231964
APA StyleRahman, A. F. M. T., Bulbule, S., Belayet, J. B., Benko, A., Gottschalk, C. G., Frick, D. N., Arnold, L. A., Hossain, M. M., & Roy, A. (2024). JRM-28, a Novel HDAC2 Inhibitor, Upregulates Plasticity-Associated Proteins in Hippocampal Neurons and Enhances Morphological Plasticity via Activation of CREB: Implications for Alzheimer’s Disease. Cells, 13(23), 1964. https://doi.org/10.3390/cells13231964