Improving the Genome Editing Efficiency of CRISPR/Cas9 in Melon and Watermelon
Abstract
1. Introduction
2. Materials and Methods
2.1. Gene Clone and sgRNA Selection
2.2. Construction of pBM-C System CRISPR Vectors
2.3. Agrobacterium-Mediated Transformation of Melon and Watermelon
2.4. On- and Off-Target Efficiency Analysis
2.5. Statistical Analysis
3. Results
3.1. Screening Efficient sgRNA In Vitro
3.2. PDS Mutants Phenotypic and Comparison of pBM-C Vector Editing Efficiency
3.3. Comparison of the Types of Edits Produced by Different pBM-C Vectors
3.4. The Off-Target Effect Analysis in Melon
3.5. The pBM-C06 Vector Achieves Efficient Editing in Watermelon
3.6. Comparison of the Time Appearance of Albino Phenotypes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Food and Agriculture Organization Corporate Statistical Database (FAOSTAT). Crops and Livestock Products. 2022. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 25 September 2024).
- Bhowmick, B.K.; Jha, S. Dynamics of sex expression and chromosome diversity in Cucurbitaceae: A story in the making. J. Genet. 2015, 94, 793–808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.M.; Kubota, C.; Tsao, S.; Bie, Z.; Echevarria, P.H.; Morra, L.; Oda, M. Current status of vegetable grafting: Diffusion, grafting techniques, automation. Sci. Hortic. 2010, 127, 93–105. [Google Scholar] [CrossRef] [Scilit]
- Pech, J.C.; Bouzayen, M.; Latché, A. Climacteric fruit ripening: Ethylene-dependent and independent regulation of ripening pathways in melon fruit. Plant Sci. 2008, 175, 114–120. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Guo, S.; Zhang, J.; Sun, H.; Tian, S.; Wang, J.; Zuo, Y.; Yu, Y.; Gong, G.; Zhang, H.; et al. Sugar transporter VST1 knockout reduced aphid damage in watermelon. Plant Cell Rep. 2021, 41, 277–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, Y.; Sun, H.; Zong, M.; Guo, S.; Ren, Z.; Zhao, J.; Li, M.; Zhang, J.; Tian, S.; Wang, J.; et al. Localization shift of a sugar transporter contributes to phloem unloading in sweet watermelons. New Phytol. 2020, 227, 1858–1871. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Wang, Y.; Zhang, J.; Ren, Y.; Li, M.; Tian, S.; Yu, Y.; Zuo, Y.; Gong, G.; Zhang, H.; et al. The NAC transcription factor ClNAC68 positively regulates sugar content and seed development in watermelon by repressing ClINV and ClGH3.6. Hortic. Res. 2022, 8, 214. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Zhang, R.; Jia, X.; Tang, X.; Guo, Y.; Yang, H.; Zheng, X.; Qian, Q.; Qi, Y.; Zhang, Y. CRISPR-Cas9 mediated OsMIR168a knockout reveals its pleiotropy in rice. Plant Biotechnol. J. 2022, 20, 310–322. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Fu, D.; Zhu, B.; Luo, Y.; Zhu, H. CRISPR/Cas9-mediated mutagenesis of lncRNA1459 alters tomato fruit ripening. Plant J. 2018, 94, 513–524. [Google Scholar] [CrossRef] [Scilit]
- Ren, C.; Liu, Y.; Guo, Y.; Duan, W.; Fan, P.; Li, S.; Liang, Z. Optimizing the CRISPR/Cas9 system for genome editing in grape by using grape promoters. Hortic. Res. 2021, 8, 52. [Google Scholar] [CrossRef] [Scilit]
- Ramadan, M.; Alariqi, M.; Ma, Y.; Li, Y.; Liu, Z.; Zhang, R.; Jin, S.; Min, L.; Zhang, X. Efficient CRISPR/Cas9 mediated pooled-sgRNAs assembly accelerates targeting multiple genes related to male sterility in cotton. Plant Methods 2021, 17, 16. [Google Scholar] [CrossRef] [Scilit]
- Xin, T.; Tian, H.; Ma, Y.; Wang, S.; Yang, L.; Li, X.; Zhang, M.; Chen, C.; Wang, H.; Li, H.; et al. Targeted creation of new mutants with compact plant architecture using CRISPR/Cas9 genome editing by an optimized genetic transformation procedure in cucurbit plants. Hortic. Res. 2022, 9, uhab086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, W.; Cheng, Z.; Han, Z.; Yang, H.; Zhang, W.; Zhang, H. Efficient genetic transformation and CRISPR/Cas9-mediated genome editing of watermelon assisted by genes encoding developmental regulators. J. Zhejiang Univ. Sci. B. 2022, 23, 339–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Q.; Xiao, L.; He, Y.; Liu, M.; Wang, J.; Tian, S.; Zhang, X.; Yuan, L. Highly efficient, genotype-independent transformation and gene editing in watermelon (Citrullus lanatus) using a chimeric ClGRF4-GIF1 gene. J. Integr. Plant Biol. 2021, 63, 2038–2042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hooghvorst, I.; Lopez-Cristoffanini, C.; Nogues, S. Efficient knockout of phytoene desaturase gene using CRISPR/Cas9 in melon. Sci. Rep. 2019, 9, 17077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B.; Santo Domingo, M.; Mayobre, C.; Martín-Hernández, A.M.; Pujol, M.; Garcia-Mas, J. Knock-out of CmNAC-NOR affects melon climacteric fruit ripening. Front. Plant Sci. 2022, 13, 878037. [Google Scholar] [CrossRef] [Scilit]
- Giordano, A.; Santo Domingo, M.; Quadrana, L.; Pujol, M.; Martín-Hernández, A.M.; Garcia-Mas, J.; Gibon, Y. CRISPR/Cas9 gene editing uncovers the roles of CONSTITUTIVE TRIPLE RESPONSE 1 and REPRESSOR OF SILENCING 1 in melon fruit ripening and epigenetic regulation. J. Exp. Bot. 2022, 73, 4022–4033. [Google Scholar] [CrossRef] [Scilit]
- Tian, S.; Zhang, J.; Zhao, H.; Zong, M.; Li, M.; Gong, G.; Wang, J.; Zhang, J.; Ren, Y.; Zhang, H.; et al. Production of double haploid watermelon via maternal haploid induction. Plant Biotechnol. J. 2023, 21, 1308–1310. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wang, J.; Guo, S.; Tian, S.; Zhang, J.; Ren, Y.; Li, M.; Gong, G.; Zhang, H.; Xu, Y. CRISPR/Cas9-mediated mutagenesis of ClBG1 decreased seed size and promoted seed germination in watermelon. Hortic. Res. 2021, 8, 70. [Google Scholar] [CrossRef] [Scilit]
- Tian, S.; Jiang, L.; Cui, X.; Zhang, J.; Guo, S.; Li, M.; Zhang, H.; Ren, Y.; Gong, G.; Zong, M.; et al. Engineering herbicide-resistant watermelon variety through CRISPR/Cas9-mediated base-editing. Plant Cell Rep. 2018, 37, 1353–1356. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Lin, Y.; Chen, S.; Liu, H.; Chen, Z.; Fan, M.; Hu, T.; Mei, F.; Chen, J.; Chen, L. CRISPR/Cas9-mediated functional recovery of the recessive rc allele to develop red rice. Plant Biotechnol. J. 2019, 17, 2096–2105. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Zhang, J.; Wei, P.; Zhang, B.; Gou, F.; Feng, Z.; Mao, Y.; Yang, L.; Zhang, H.; Xu, N. The CRISPR/C as9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol. J. 2014, 12, 797–807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malzahn, A.A.; Tang, X.; Lee, K.; Ren, Q.; Sretenovic, S.; Zhang, Y.; Chen, H.; Kang, M.; Bao, Y.; Zheng, X. Application of CRISPR-Cas12a temperature sensitivity for improved genome editing in rice, maize, and Arabidopsis. BMC Biol. 2019, 17, 9. [Google Scholar] [CrossRef] [Scilit]
- Macovei, A.; Sevilla, N.R.; Cantos, C.; Jonson, G.B.; Slamet-Loedin, I.; Čermák, T.; Voytas, D.F.; Choi, I.R.; Chadha-Mohanty, P. Novel alleles of rice eIF4G generated by CRISPR/Cas9-targeted mutagenesis confer resistance to rice tungro spherical virus. Plant Biotechnol. J. 2018, 16, 1918–1927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y. A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.-P.; Xing, H.-L.; Dong, L.; Zhang, H.-Y.; Han, C.-Y.; Wang, X.-C.; Chen, Q.-J. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015, 16, 144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Čermák, T.; Curtin, S.J.; Gil-Humanes, J.; Cegan, R.; Kono, T.J.Y.; Konecna, E.; Belanto, J.J.; Starker, C.G.; Mathre, J.W.; Greenstein, R.L.; et al. A multipurpose toolkit to enable advanced genome engineering in plants. Plant Cell 2017, 29, 1196–1217. [Google Scholar] [CrossRef] [Scilit]
- Xie, K.; Minkenberg, B.; Yang, Y. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc. Natl. Acad. Sci. USA 2015, 112, 3570–3575. [Google Scholar] [CrossRef] [Scilit]
- Grützner, R.; Martin, P.; Horn, C.; Mortensen, S.; Cram, E.J.; Lee-Parsons, C.W.; Stuttmann, J.; Marillonnet, S. High-efficiency genome editing in plants mediated by a Cas9 gene containing multiple introns. Plant Commun. 2021, 2, 100135. [Google Scholar] [CrossRef] [Scilit]
- Wolabu, T.W.; Park, J.-J.; Chen, M.; Cong, L.; Ge, Y.; Jiang, Q.; Debnath, S.; Li, G.; Wen, J.; Wang, Z. Improving the genome editing efficiency of CRISPR/Cas9 in Arabidopsis and Medicago truncatula. Planta 2020, 252, 15. [Google Scholar] [CrossRef] [Scilit]
- Zeng, Y.; Wen, J.; Zhao, W.; Wang, Q.; Huang, W. Rational improvement of rice yield and cold tolerance by editing the three genes OsPIN5b, GS3, and OsMYB30 with the CRISPR–Cas9 system. Front. Plant Sci. 2020, 10, 1663. [Google Scholar] [CrossRef] [Scilit]
- Zhang, F.; LeBlanc, C.; Irish, V.F.; Jacob, Y. Rapid and efficient CRISPR/Cas9 gene editing in Citrus using the YAO promoter. Plant Cell Rep. 2017, 36, 1883–1887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xing, H.L.; Dong, L.; Wang, Z.P.; Zhang, H.Y.; Han, C.Y.; Liu, B.; Wang, X.C.; Chen, Q.J. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014, 14, 327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.; Zhao, Y. Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J. Integr. Plant Biol. 2014, 56, 343–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, W.; Zhou, H.; Bi, H.; Fromm, M.; Yang, B.; Weeks, D.P. Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res. 2013, 41, e188. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Hu, Z.; Chen, R.; Jiang, Q.; Song, G.; Zhang, H.; Xi, Y. Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci. Rep. 2015, 5, 10342. [Google Scholar] [CrossRef] [Scilit]
- Minkenberg, B.; Xie, K.; Yang, Y. Discovery of rice essential genes by characterizing a CRISPR-edited mutation of closely related rice MAP kinase genes. Plant J. 2017, 89, 636–648. [Google Scholar] [CrossRef] [Scilit]
- Sagawa, C.H.D.; Thomson, G.; Mermaz, B.; Vernon, C.; Liu, S.; Jacob, Y.; Irish, V.F. An efficient multiplex approach to CRISPR/Cas9 gene editing in citrus. Plant Methods 2024, 20, 148. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Wang, Y.; Wang, N. Highly efficient generation of canker-resistant sweet orange enabled by an improved CRISPR/Cas9 system. Front. Plant Sci. 2022, 12, 769907. [Google Scholar] [CrossRef] [Scilit]
- Wolabu, T.W.; Cong, L.; Park, J.-J.; Bao, Q.; Chen, M.; Sun, J.; Xu, B.; Ge, Y.; Chai, M.; Liu, Z. Development of a highly efficient multiplex genome editing system in outcrossing tetraploid alfalfa (Medicago sativa). Front. Plant Sci. 2020, 11, 1063. [Google Scholar] [CrossRef] [Scilit]
- Hsieh, T.F. Whole-genome DNA methylation profiling with nucleotide resolution. In Plant Functional Genomics. Methods in Molecular Biology; Alonso, J., Stepanova, A., Eds.; Humana Press: New York, NY, USA, 2015; Volume 1284, pp. 27–40. [Google Scholar]
- Wan, L.; Wang, Z.; Zhang, X.; Zeng, H.; Ren, J.; Zhang, N.; Sun, Y.; Mi, T. Optimised Agrobacterium-mediated transformation and application of developmental regulators improve regeneration efficiency in melons. Genes 2023, 14, 1432. [Google Scholar] [CrossRef] [Scilit]
- Sun, T.; Liu, Q.; Chen, X.; Hu, F.; Wang, K. Hi-TOM 2.0: An improved platform for high-throughput mutation detection. Sci. China Life Sci. 2024, 67, 1532–1534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panda, D.; Karmakar, S.; Dash, M.; Tripathy, S.K.; Das, P.; Banerjee, S.; Qi, Y.; Samantaray, S.; Mohapatra, P.K.; Baig, M.J.; et al. Optimized protoplast isolation and transfection with a breakpoint: Accelerating Cas9/sgRNA cleavage efficiency validation in monocot and dicot. Abiotech 2024, 5, 151–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, S.; Jiang, L.; Gao, Q.; Zhang, J.; Zong, M.; Zhang, H.; Ren, Y.; Guo, S.; Gong, G.; Liu, F. Efficient CRISPR/Cas9-based gene knockout in watermelon. Plant Cell Rep. 2017, 36, 399–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Y.; Zhu, H.; Lu, X.; Anees, M.; He, N.; Yang, D.; Chen, Z.; Hong, Z.; Zhang, J.; Liu, W. Streamlined Agrobacterium rhizogenes-mediated hairy root transformation for efficient CRISPR/Cas9-based gene editing evaluation in diverse citrullus varieties. Hortic. Plant J. 2024. [Google Scholar] [CrossRef] [Scilit]
- Ming, M.; Long, H.; Ye, Z.; Pan, C.; Chen, J.; Tian, R.; Sun, C.; Xue, Y.; Zhang, Y.; Li, J.; et al. Highly efficient CRISPR systems for loss-of-function and gain-of-function research in pear calli. Hortic Res. 2022, 9, uhac148. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Guo, S.; Ji, G.; Zhao, H.; Sun, H.; Ren, Y.; Tian, S.; Li, M.; Gong, G.; Zhang, H.; et al. A unique chromosome translocation disrupting ClWIP1 leads to gynoecy in watermelon. Plant J. 2019, 101, 265–277. [Google Scholar] [CrossRef] [Scilit]
- Ma, H.; Wu, Y.; Dang, Y.; Choi, J.-G.; Zhang, J.; Wu, H. Pol III promoters to express small RNAs: Delineation of transcription initiation. Mol. Ther. Nucleic Acids. 2014, 3, e161. [Google Scholar] [CrossRef] [Scilit]
- Feng, Z.; Mao, Y.; Xu, N.; Zhang, B.; Wei, P.; Yang, D.-L.; Wang, Z.; Zhang, Z.; Zheng, R.; Yang, L. Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc. Natl. Acad. Sci. USA 2014, 111, 4632–4637. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Gao, Y.; Gao, Y.; Zhang, Q. Targeted deletion of floral development genes in Arabidopsis with CRISPR/Cas9 using the RNA endoribonuclease Csy4 processing system. Hortic. Res. 2019, 6, 99. [Google Scholar] [CrossRef] [Scilit]
- Cho, S.; Yu, S.-i.; Park, J.; Mao, Y.; Zhu, J.-K.; Yun, D.-J.; Lee, B.-h. Accession-dependent CBF gene deletion by CRISPR/Cas system in Arabidopsis. Front. Plant Sci. 2017, 8, 1910. [Google Scholar] [CrossRef] [Scilit]
- Ordon, J.; Gantner, J.; Kemna, J.; Schwalgun, L.; Reschke, M.; Streubel, J.; Boch, J.; Stuttmann, J. Generation of chromosomal deletions in dicotyledonous plants employing a user-friendly genome editing toolkit. Plant J. 2017, 89, 155–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, H.; Liu, B.; Weeks, D.P.; Spalding, M.H.; Yang, B. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Res. 2014, 42, 10903–10914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Li, Z.; Chen, X.; Gu, Y.; Zhang, L.; Qiu, L. An efficient soybean transformation protocol for use with elite lines. Plant Cell Tiss. Organ Cult. 2022, 151, 457–466. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Kawato, N.; Sato, H.; Kawaharada, Y.; Henmi, M.; Shinoda, A.; Hasunuma, T.; Nishitani, C.; Osakabe, Y.; Osakabe, K.; et al. Release of chimeras and efficient selection of editing mutants by CRISPR/Cas9-mediated gene editing in apple. Sci. Hortic. 2023, 316, 112011. [Google Scholar] [CrossRef] [Scilit]
- Hahn, F.; Korolev, A.; Sanjurjo Loures, L.; Nekrasov, V. A modular cloning toolkit for genome editing in plants. BMC Plant Biol. 2020, 20, 179. [Google Scholar] [CrossRef] [Scilit]
- Ni, P.; Zhao, Y.; Zhou, X.; Liu, Z.; Huang, Z.; Ni, Z.; Sun, Q.; Zong, Y. Efficient and versatile multiplex prime editing in hexaploid wheat. Genome Biol. 2023, 24, 156. [Google Scholar] [CrossRef] [Scilit]





| Vector | No. of Explants 1 | No. of Bar Positive Seedlings 2 | Transformation Efficiency (%) 3 | No. of Edit T0 Plants | Editing Rate 4 (%) |
|---|---|---|---|---|---|
| pBM-C02 (Control) | 108 | 35 | 32.46 ± 0.04 | 0 | 0 |
| pBM-C04 | 129 | 46 | 35.49 ± 0.01 | 4 | 8.62 ± 0.01 d |
| pBM-C05 | 122 | 51 | 42.30 ± 0.03 | 8 | 15.77 ± 0.01 be |
| pBM-C06 | 144 | 44 | 30.58 ± 0.04 | 19 | 42.82 ± 0.04 ac |
| pBM-C07 | 132 | 43 | 33.46 ± 0.08 | 10 | 25.20 ± 0.05 ab |
| Vector | No. of Editing T0 Plants | No. of sgRNA1 | No. of sgRNA3 | No. of Both sgRNAs | No. of LD | LD Rate (%) 1 |
|---|---|---|---|---|---|---|
| pBM-C04 | 4 | 1 | 4 | 1 | 1 | 25.00 |
| pBM-C05 | 8 | 2 | 8 | 2 | 1 | 12.50 |
| pBM-C06 | 19 | 19 | 17 | 16 | 15 | 78.95 |
| pBM-C07 | 10 | 10 | 4 | 4 | 2 | 20.00 |
| The Sequence of sgRNA | No. of Off-Target Sites | The Sequence of Offtarget | Off-Score | Locus | Gene ID | Region | |
|---|---|---|---|---|---|---|---|
| sgRNA1 | TAATGGAGAACAGCATCTCG AGG | 10 | AAACGGATAAAAGCATCTCGCGG | 0.303 | chr2:23796553..23796531 | Intergenic | |
| TGAGGGTGAACAGCATCACGTGG | 0.146 | chr1:450775..450797 | MELO3C018462 | CDS | |||
| TAATCCAGGACAGCATCTCCAAG | 0.04 | chr2:15161470..15161492 | MELO3C010254 | CDS | |||
| AAATGGAGAACAGAATCTAGGAG | 0.039 | chr5:1316321..1316299 | MELO3C014566 | CDS | |||
| TCATGGAGACAAGCCTCTCGAAG | 0.014 | chr6:16140751..16140729 | Intergenic | ||||
| sgRNA3 | TATCATCTATCTGTGGTCTA GGG | 9 | TAACATCTGTATGTGATCTAGGG | 0.357 | chr11:1450252..1450230 | MELO3C023325 | CDS |
| TATGAACTATCAGTGGTATATGG | 0.187 | chr5:27838535..27838557 | Intergenic | ||||
| TATCATCGATATGTTGCCTATGG | 0.055 | chr10:21682722..21682744 | Intergenic | ||||
| TATCATCTATCTTTGATAAATGG | 0.046 | chr1:20418410..20418432 | Intergenic | ||||
| TATCATCTATCAGTTATCAAAGG | 0.033 | chr9:6825019..6825041 | MELO3C002879 | CDS |
| Vector Number | Agrobacterium | Receptor | Time from Germination to the First Appearance of Albino Buds (D) |
|---|---|---|---|
| pBM-C04 | EHA105 | VED | 59 ± 2 a |
| pBM-C05 | EHA105 | VED | 34 ± 1 b |
| pBM-C06 | EHA105 | VED | 35 ± 1 b |
| pBM-C07 | EHA105 | VED | 35 ± 2.5 b |
| pBM-C06 | EHA105 | D66 | 32 ± 1.5 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Wan, L.; Ren, J.; Zhang, N.; Zeng, H.; Wei, J.; Tang, M. Improving the Genome Editing Efficiency of CRISPR/Cas9 in Melon and Watermelon. Cells 2024, 13, 1782. https://doi.org/10.3390/cells13211782
Wang Z, Wan L, Ren J, Zhang N, Zeng H, Wei J, Tang M. Improving the Genome Editing Efficiency of CRISPR/Cas9 in Melon and Watermelon. Cells. 2024; 13(21):1782. https://doi.org/10.3390/cells13211782
Chicago/Turabian StyleWang, Zhuanrong, Lili Wan, Jian Ren, Na Zhang, Hongxia Zeng, Jiaqi Wei, and Mi Tang. 2024. "Improving the Genome Editing Efficiency of CRISPR/Cas9 in Melon and Watermelon" Cells 13, no. 21: 1782. https://doi.org/10.3390/cells13211782
APA StyleWang, Z., Wan, L., Ren, J., Zhang, N., Zeng, H., Wei, J., & Tang, M. (2024). Improving the Genome Editing Efficiency of CRISPR/Cas9 in Melon and Watermelon. Cells, 13(21), 1782. https://doi.org/10.3390/cells13211782

