CREB Is Critically Implicated in Skin Mast Cell Degranulation Elicited via FcεRI and MRGPRX2
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Treatments
2.2. Accell® Mediated RNA Interference
2.3. Flow Cytometry
2.4. Reverse Transcription-Quantitative PCR (RT-qPCR)
2.5. β-Hexosaminidase Release Assay
2.6. Quantification of Tryptase
2.7. Quantification of Histamine
2.8. CD107a Exteriorization
2.9. Statistics
3. Results
3.1. CREB Is Modestly Implicated in MRGPRX2 and FcεRI Expression in Skin MCs
3.2. CREB Contributes to SCF-Triggered Upregulation of FcεRI
3.3. CREB Maintains the Secretory Competence of Skin MCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Metcalfe, D.D.; Peavy, R.D.; Gilfillan, A.M. Mechanisms of mast cell signaling in anaphylaxis. J. Allergy Clin. Immunol. 2009, 124, 639–646, quiz 647–648. [Google Scholar] [CrossRef] [PubMed]
- Galli, S.J.; Tsai, M. IgE and mast cells in allergic disease. Nat. Med. 2012, 18, 693–704. [Google Scholar] [CrossRef] [PubMed]
- Mehrani, Y.; Morovati, S.; Tajik, T.; Sarmadi, S.; Bitaraf, A.; Sourani, Z.; Shahverdi, M.; Javadi, H.; Kakish, J.E.; Bridle, B.W.; et al. Communication between Mast Cells and Group 2 Innate Lymphoid Cells in the Skin. Cells 2024, 13, 462. [Google Scholar] [CrossRef] [PubMed]
- Dwyer, D.F.; Barrett, N.A.; Austen, K.F. Expression profiling of constitutive mast cells reveals a unique identity within the immune system. Nat. Immunol. 2016, 17, 878–887. [Google Scholar] [CrossRef]
- Woźniak, E.; Owczarczyk-Saczonek, A.; Lange, M.; Czarny, J.; Wygonowska, E.; Placek, W.; Nedoszytko, B. The Role of Mast Cells in the Induction and Maintenance of Inflammation in Selected Skin Diseases. Int. J. Mol. Sci. 2023, 24, 7021. [Google Scholar] [CrossRef]
- Voss, M.; Kotrba, J.; Gaffal, E.; Katsoulis-Dimitriou, K.; Dudeck, A. Mast Cells in the Skin: Defenders of Integrity or Offenders in Inflammation? Int. J. Mol. Sci. 2021, 22, 4589. [Google Scholar] [CrossRef]
- Siiskonen, H.; Harvima, I. Mast Cells and Sensory Nerves Contribute to Neurogenic Inflammation and Pruritus in Chronic Skin Inflammation. Front. Cell. Neurosci. 2019, 13, 422. [Google Scholar] [CrossRef] [PubMed]
- Steinhoff, M.; Neisius, U.; Ikoma, A.; Fartasch, M.; Heyer, G.; Skov, P.S.; Luger, T.A.; Schmelz, M. Proteinase-activated receptor-2 mediates itch: A novel pathway for pruritus in human skin. J. Neurosci. 2003, 23, 6176–6180. [Google Scholar] [CrossRef]
- Tey, H.L.; Yosipovitch, G. Targeted treatment of pruritus: A look into the future. Br. J. Dermatol. 2011, 165, 5–17. [Google Scholar] [CrossRef]
- Aich, A.; Afrin, L.B.; Gupta, K. Mast Cell-Mediated Mechanisms of Nociception. Int. J. Mol. Sci. 2015, 16, 29069–29092. [Google Scholar] [CrossRef]
- Corbière, A.; Loste, A.; Gaudenzio, N. MRGPRX2 sensing of cationic compounds-A bridge between nociception and skin diseases? Exp. Dermatol. 2021, 30, 193–200. [Google Scholar] [CrossRef]
- Zhang, S.; Sumpter, T.L.; Kaplan, D.H. Neuron‒Mast Cell Cross-Talk in the Skin. J. Investig. Dermatol. 2022, 142, 841–848. [Google Scholar] [CrossRef] [PubMed]
- Kühn, H.; Kolkhir, P.; Babina, M.; Düll, M.; Frischbutter, S.; Fok, J.S.; Jiao, Q.; Metz, M.; Scheffel, J.; Wolf, K.; et al. Mas-related G protein-coupled receptor X2 and its activators in dermatologic allergies. J. Allergy Clin. Immunol. 2021, 147, 456–469. [Google Scholar] [CrossRef] [PubMed]
- Tatemoto, K.; Nozaki, Y.; Tsuda, R.; Konno, S.; Tomura, K.; Furuno, M.; Ogasawara, H.; Edamura, K.; Takagi, H.; Iwamura, H.; et al. Immunoglobulin E-independent activation of mast cell is mediated by Mrg receptors. Biochem. Biophys. Res. Commun. 2006, 349, 1322–1328. [Google Scholar] [CrossRef] [PubMed]
- McNeil, B.D.; Pundir, P.; Meeker, S.; Han, L.; Undem, B.J.; Kulka, M.; Dong, X. Identification of a mast-cell-specific receptor crucial for pseudo-allergic drug reactions. Nature 2015, 519, 237–241. [Google Scholar] [CrossRef] [PubMed]
- Porebski, G.; Kwiecien, K.; Pawica, M.; Kwitniewski, M. Mas-Related G Protein-Coupled Receptor-X2 (MRGPRX2) in Drug Hypersensitivity Reactions. Front. Immunol. 2018, 9, 3027. [Google Scholar] [CrossRef]
- Wang, Z.; Babina, M. MRGPRX2 signals its importance in cutaneous mast cell biology: Does MRGPRX2 connect mast cells and atopic dermatitis? Exp. Dermatol. 2020, 29, 1104–1111. [Google Scholar] [CrossRef]
- Quan, P.L.; Sabaté-Brescó, M.; Guo, Y.; Martín, M.; Gastaminza, G. The Multifaceted Mas-Related G Protein-Coupled Receptor Member X2 in Allergic Diseases and Beyond. Int. J. Mol. Sci. 2021, 22, 4421. [Google Scholar] [CrossRef]
- Lyons, D.O.; Pullen, N.A. Beyond IgE: Alternative Mast Cell Activation across Different Disease States. Int. J. Mol. Sci. 2020, 21, 1498. [Google Scholar] [CrossRef]
- Kumar, M.; Duraisamy, K.; Chow, B.K. Unlocking the Non-IgE-Mediated Pseudo-Allergic Reaction Puzzle with Mas-Related G-Protein Coupled Receptor Member X2 (MRGPRX2). Cells 2021, 10, 1033. [Google Scholar] [CrossRef]
- Inclan-Rico, J.M.; Kim, B.S.; Abdus-Saboor, I. Beyond somatosensation: Mrgprs in mucosal tissues. Neurosci. Lett. 2021, 748, 135689. [Google Scholar] [CrossRef] [PubMed]
- Roy, S.; Chompunud Na Ayudhya, C.; Thapaliya, M.; Deepak, V.; Ali, H. Multifaceted MRGPRX2: New insight into the role of mast cells in health and disease. J. Allergy Clin. Immunol. 2021, 148, 293–308. [Google Scholar] [CrossRef] [PubMed]
- Babina, M. The pseudo-allergic/neurogenic route of mast cell activation via MRGPRX2: Discovery, functional programs, regulation, relevance to disease, and relation with allergic stimulation. Itch 2020, 5, e32. [Google Scholar] [CrossRef]
- Metcalfe, D.D. Mast cells and mastocytosis. Blood 2008, 112, 946–956. [Google Scholar] [CrossRef] [PubMed]
- Okayama, Y.; Kawakami, T. Development, migration, and survival of mast cells. Immunol. Res. 2006, 34, 97–115. [Google Scholar] [CrossRef]
- Akin, C.; Metcalfe, D.D. The biology of Kit in disease and the application of pharmacogenetics. J. Allergy Clin. Immunol. 2004, 114, 13–19, quiz 20. [Google Scholar] [CrossRef]
- Lennartsson, J.; Rönnstrand, L. Stem cell factor receptor/c-Kit: From basic science to clinical implications. Physiol. Rev. 2012, 92, 1619–1649. [Google Scholar] [CrossRef]
- Cruse, G.; Metcalfe, D.D.; Olivera, A. Functional deregulation of KIT: Link to mast cell proliferative diseases and other neoplasms. Immunol. Allergy Clin. N. Am. 2014, 34, 219–237. [Google Scholar] [CrossRef]
- Franke, K.; Kirchner, M.; Mertins, P.; Zuberbier, T.; Babina, M. The SCF/KIT axis in human mast cells: Capicua acts as potent KIT repressor and ERK predominates PI3K. Allergy 2022, 77, 3337–3349. [Google Scholar] [CrossRef]
- Franke, K.; Bal, G.; Li, Z.; Zuberbier, T.; Babina, M. CREB Is Activated by the SCF/KIT Axis in a Partially ERK-Dependent Manner and Orchestrates Survival and the Induction of Immediate Early Genes in Human Skin Mast Cells. Int. J. Mol. Sci. 2023, 24, 4135. [Google Scholar] [CrossRef]
- Zhang, X.; Odom, D.T.; Koo, S.H.; Conkright, M.D.; Canettieri, G.; Best, J.; Chen, H.; Jenner, R.; Herbolsheimer, E.; Jacobsen, E.; et al. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc. Natl. Acad. Sci. USA 2005, 102, 4459–4464. [Google Scholar] [CrossRef] [PubMed]
- Noguchi, S.; Arakawa, T.; Fukuda, S.; Furuno, M.; Hasegawa, A.; Hori, F.; Ishikawa-Kato, S.; Kaida, K.; Kaiho, A.; Kanamori-Katayama, M.; et al. FANTOM5 CAGE profiles of human and mouse samples. Sci. Data 2017, 4, 170112. [Google Scholar] [CrossRef] [PubMed]
- Forrest, A.R.; Kawaji, H.; Rehli, M.; Baillie, J.K.; de Hoon, M.J.; Haberle, V.; Lassmann, T.; Kulakovskiy, I.V.; Lizio, M.; Itoh, M.; et al. A promoter-level mammalian expression atlas. Nature 2014, 507, 462–470. [Google Scholar] [CrossRef] [PubMed]
- Mora-Garcia, P.; Cheng, J.; Crans-Vargas, H.N.; Countouriotis, A.; Shankar, D.; Sakamoto, K.M. Transcriptional regulators and myelopoiesis: The role of serum response factor and CREB as targets of cytokine signaling. Stem Cells 2003, 21, 123–130. [Google Scholar] [CrossRef]
- Lonze, B.E.; Ginty, D.D. Function and regulation of CREB family transcription factors in the nervous system. Neuron 2002, 35, 605–623. [Google Scholar] [CrossRef]
- Johannessen, M.; Delghandi, M.P.; Moens, U. What turns CREB on? Cell. Signal. 2004, 16, 1211–1227. [Google Scholar] [CrossRef]
- Feng, C.; Mery, A.G.; Beller, E.M.; Favot, C.; Boyce, J.A. Adenine nucleotides inhibit cytokine generation by human mast cells through a Gs-coupled receptor. J. Immunol. 2004, 173, 7539–7547. [Google Scholar] [CrossRef]
- Mortaz, E.; Redegeld, F.A.; Sarir, H.; Karimi, K.; Raats, D.; Nijkamp, F.P.; Folkerts, G. Cigarette smoke stimulates the production of chemokines in mast cells. J. Leukoc. Biol. 2008, 83, 575–580. [Google Scholar] [CrossRef]
- Nam, Y.H.; Min, D.; Kim, H.P.; Song, K.J.; Kim, K.A.; Lee, Y.A.; Kim, S.H.; Shin, M.H. Leukotriene B4 receptor BLT-mediated phosphorylation of NF-κB and CREB is involved in IL-8 production in human mast cells induced by Trichomonas vaginalis-derived secretory products. Microbes Infect. 2011, 13, 1211–1220. [Google Scholar] [CrossRef]
- Wang, Y.; Ma, H.; Tao, X.; Luo, Y.; Wang, H.; He, J.; Fang, Q.; Guo, S.; Song, C. SCF promotes the production of IL-13 via the MEK-ERK-CREB signaling pathway in mast cells. Exp. Ther. Med. 2019, 18, 2491–2496. [Google Scholar] [CrossRef]
- Dragunow, M. CREB and neurodegeneration. Front. Biosci. 2004, 9, 100–103. [Google Scholar] [CrossRef] [PubMed]
- Lamprecht, R. CREB: A message to remember. Cell. Mol. Life Sci. 1999, 55, 554–563. [Google Scholar] [CrossRef] [PubMed]
- Collins, J.W. The neuroscience of learning. J. Neurosci. Nurs. 2007, 39, 305–310. [Google Scholar] [CrossRef] [PubMed]
- Mantamadiotis, T.; Papalexis, N.; Dworkin, S. CREB signalling in neural stem/progenitor cells: Recent developments and the implications for brain tumour biology. Bioessays 2012, 34, 293–300. [Google Scholar] [CrossRef]
- Bal, G.; Schneikert, J.; Li, Z.; Franke, K.; Tripathi, S.R.; Zuberbier, T.; Babina, M. CREB Is Indispensable to KIT Function in Human Skin Mast Cells-A Positive Feedback Loop between CREB and KIT Orchestrates Skin Mast Cell Fate. Cells 2023, 13, 42. [Google Scholar] [CrossRef] [PubMed]
- Lorentz, A.; Baumann, A.; Vitte, J.; Blank, U. The SNARE Machinery in Mast Cell Secretion. Front. Immunol. 2012, 3, 143. [Google Scholar] [CrossRef]
- Blank, U.; Madera-Salcedo, I.K.; Danelli, L.; Claver, J.; Tiwari, N.; Sánchez-Miranda, E.; Vázquez-Victorio, G.; Ramírez-Valadez, K.A.; Macias-Silva, M.; González-Espinosa, C. Vesicular trafficking and signaling for cytokine and chemokine secretion in mast cells. Front. Immunol. 2014, 5, 453. [Google Scholar] [CrossRef]
- Franke, K.; Wang, Z.; Zuberbier, T.; Babina, M. Cytokines Stimulated by IL-33 in Human Skin Mast Cells: Involvement of NF-κB and p38 at Distinct Levels and Potent Co-Operation with FcεRI and MRGPRX2. Int. J. Mol. Sci. 2021, 22, 3580. [Google Scholar] [CrossRef]
- Wang, Z.; Guhl, S.; Franke, K.; Artuc, M.; Zuberbier, T.; Babina, M. IL-33 and MRGPRX2-Triggered Activation of Human Skin Mast Cells-Elimination of Receptor Expression on Chronic Exposure, but Reinforced Degranulation on Acute Priming. Cells 2019, 8, 341. [Google Scholar] [CrossRef]
- Babina, M.; Wang, Z.; Franke, K.; Guhl, S.; Artuc, M.; Zuberbier, T. Yin-Yang of IL-33 in Human Skin Mast Cells: Reduced Degranulation, but Augmented Histamine Synthesis through p38 Activation. J. Investig. Dermatol. 2019, 139, 1516–1525.e13. [Google Scholar] [CrossRef]
- Rastogi, S.; Willmes, D.M.; Nassiri, M.; Babina, M.; Worm, M. PGE2 deficiency predisposes to anaphylaxis by causing mast cell hyperresponsiveness. J. Allergy Clin. Immunol. 2020, 146, 1387–1396.13. [Google Scholar] [CrossRef] [PubMed]
- Babina, M.; Wang, Z.; Artuc, M.; Guhl, S.; Zuberbier, T. MRGPRX2 is negatively targeted by SCF and IL-4 to diminish pseudo-allergic stimulation of skin mast cells in culture. Exp. Dermatol. 2018, 27, 1298–1303. [Google Scholar] [CrossRef] [PubMed]
- Guhl, S.; Neou, A.; Artuc, M.; Zuberbier, T.; Babina, M. Skin mast cells develop non-synchronized changes in typical lineage characteristics upon culture. Exp. Dermatol. 2014, 23, 933–935. [Google Scholar] [CrossRef]
- Babina, M.; Artuc, M.; Guhl, S.; Zuberbier, T. Retinoic Acid Negatively Impacts Proliferation and MC(TC) Specific Attributes of Human Skin Derived Mast Cells, but Reinforces Allergic Stimulability. Int. J. Mol. Sci. 2017, 18, 525. [Google Scholar] [CrossRef]
- Guhl, S.; Artuc, M.; Neou, A.; Babina, M.; Zuberbier, T. Long-term cultured human skin mast cells are suitable for pharmacological studies of anti-allergic drugs due to high responsiveness to FcεRI cross-linking. Biosci. Biotechnol. Biochem. 2011, 75, 382–384. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.; Li, B.X.; Kassenbrock, A.; Xue, C.; Wang, X.; Qian, D.Z.; Sears, R.C.; Xiao, X. Identification of a Potent Inhibitor of CREB-Mediated Gene Transcription with Efficacious in Vivo Anticancer Activity. J. Med. Chem. 2015, 58, 5075–5087. [Google Scholar] [CrossRef]
- Li, B.X.; Gardner, R.; Xue, C.; Qian, D.Z.; Xie, F.; Thomas, G.; Kazmierczak, S.C.; Habecker, B.A.; Xiao, X. Systemic Inhibition of CREB is Well-tolerated in vivo. Sci. Rep. 2016, 6, 34513. [Google Scholar] [CrossRef] [PubMed]
- Probst, S.; Scharner, B.; McErlean, R.; Lee, W.K.; Thévenod, F. Inverse Regulation of Lipocalin-2/24p3 Receptor/SLC22A17 and Lipocalin-2 Expression by Tonicity, NFAT5/TonEBP and Arginine Vasopressin in Mouse Cortical Collecting Duct Cells mCCD(cl.1): Implications for Osmotolerance. Int. J. Mol. Sci. 2019, 20, 5398. [Google Scholar] [CrossRef]
- Babina, M.; Wang, Z.; Franke, K.; Zuberbier, T. Thymic Stromal Lymphopoietin Promotes MRGPRX2-Triggered Degranulation of Skin Mast Cells in a STAT5-Dependent Manner with Further Support from JNK. Cells 2021, 10, 102. [Google Scholar] [CrossRef]
- Hazzan, T.; Guhl, S.; Artuc, M.; Franke, K.; Worm, M.; Zuberbier, T.; Babina, M. An efficient method for gene knock-down by RNA interference in human skin mast cells. Exp. Dermatol. 2017, 26, 1136–1139. [Google Scholar] [CrossRef]
- Guhl, S.; Babina, M.; Neou, A.; Zuberbier, T.; Artuc, M. Mast cell lines HMC-1 and LAD2 in comparison with mature human skin mast cells--drastically reduced levels of tryptase and chymase in mast cell lines. Exp. Dermatol. 2010, 19, 845–847. [Google Scholar] [CrossRef] [PubMed]
- Harvima, I.T.; Karkola, K.; Harvima, R.J.; Naukkarinen, A.; Neittaanmäki, H.; Horsmanheimo, M.; Fräki, J.E. Biochemical and histochemical evaluation of tryptase in various human tissues. Arch. Dermatol. Res. 1989, 281, 231–237. [Google Scholar] [CrossRef] [PubMed]
- Babina, M.; Wang, Z.; Roy, S.; Guhl, S.; Franke, K.; Artuc, M.; Ali, H.; Zuberbier, T. MRGPRX2 Is the Codeine Receptor of Human Skin Mast Cells: Desensitization through β-Arrestin and Lack of Correlation with the FcεRI Pathway. J. Investig. Dermatol. 2021, 141, 1286–1296.e4. [Google Scholar] [CrossRef] [PubMed]
- Babina, M.; Guhl, S.; Artuc, M.; Zuberbier, T. Allergic FcεRI- and pseudo-allergic MRGPRX2-triggered mast cell activation routes are independent and inversely regulated by SCF. Allergy 2018, 73, 256–260. [Google Scholar] [CrossRef]
- Akula, S.; Tripathi, S.R.; Franke, K.; Wernersson, S.; Babina, M.; Hellman, L. Cultures of Human Skin Mast Cells, an Attractive In Vitro Model for Studies of Human Mast Cell Biology. Cells 2024, 13, 98. [Google Scholar] [CrossRef]
- Klein, O.; Sagi-Eisenberg, R. Anaphylactic Degranulation of Mast Cells: Focus on Compound Exocytosis. J. Immunol. Res. 2019, 2019, 9542656. [Google Scholar] [CrossRef]
- Guhl, S.; Stefaniak, R.; Strathmann, M.; Babina, M.; Piazena, H.; Henz, B.M.; Zuberbier, T. Bivalent effect of UV light on human skin mast cells-low-level mediator release at baseline but potent suppression upon mast cell triggering. J. Investig. Dermatol. 2005, 124, 453–456. [Google Scholar] [CrossRef]
- Katsoulis-Dimitriou, K.; Kotrba, J.; Voss, M.; Dudeck, J.; Dudeck, A. Mast Cell Functions Linking Innate Sensing to Adaptive Immunity. Cells 2020, 9, 2538. [Google Scholar] [CrossRef]
- Espinosa-Riquer, Z.P.; Segura-Villalobos, D.; Ramírez-Moreno, I.G.; Pérez Rodríguez, M.J.; Lamas, M.; Gonzalez-Espinosa, C. Signal Transduction Pathways Activated by Innate Immunity in Mast Cells: Translating Sensing of Changes into Specific Responses. Cells 2020, 9, 2411. [Google Scholar] [CrossRef]
- Chen, Y.; Griffiths, C.E.M.; Bulfone-Paus, S. Exploring Mast Cell-CD8 T Cell Interactions in Inflammatory Skin Diseases. Int. J. Mol. Sci. 2023, 24, 1564. [Google Scholar] [CrossRef]
- Kawakami, T.; Ando, T.; Kimura, M.; Wilson, B.S.; Kawakami, Y. Mast cells in atopic dermatitis. Curr. Opin. Immunol. 2009, 21, 666–678. [Google Scholar] [CrossRef] [PubMed]
- Wernersson, S.; Pejler, G. Mast cell secretory granules: Armed for battle. Nat. Rev. Immunol. 2014, 14, 478–494. [Google Scholar] [CrossRef]
- Finkelman, F.D.; Khodoun, M.V.; Strait, R. Human IgE-independent systemic anaphylaxis. J. Allergy Clin. Immunol. 2016, 137, 1674–1680. [Google Scholar] [CrossRef] [PubMed]
- Lazki-Hagenbach, P.; Kleeblatt, E.; Fukuda, M.; Ali, H.; Sagi-Eisenberg, R. The Underlying Rab Network of MRGPRX2-Stimulated Secretion Unveils the Impact of Receptor Trafficking on Secretory Granule Biogenesis and Secretion. Cells 2024, 13, 93. [Google Scholar] [CrossRef] [PubMed]
- Babina, M.; Guhl, S.; Artuc, M.; Trivedi, N.N.; Zuberbier, T. Phenotypic variability in human skin mast cells. Exp. Dermatol. 2016, 25, 434–439. [Google Scholar] [CrossRef]
- Mayr, B.; Montminy, M. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2001, 2, 599–609. [Google Scholar] [CrossRef]
- Babina, M.; Franke, K.; Bal, G. How “Neuronal” Are Human Skin Mast Cells? Int. J. Mol. Sci. 2022, 23, 10871. [Google Scholar] [CrossRef]
- Babina, M.; Guhl, S.; Artuc, M.; Zuberbier, T. Skin mast cell phenotypes between two highly divergent cohorts—More pronounced variability within than between groups. Exp. Dermatol. 2017, 26, 446–449. [Google Scholar] [CrossRef]
- Koga, Y.; Tsurumaki, H.; Aoki-Saito, H.; Sato, M.; Yatomi, M.; Takehara, K.; Hisada, T. Roles of Cyclic AMP Response Element Binding Activation in the ERK1/2 and p38 MAPK Signalling Pathway in Central Nervous System, Cardiovascular System, Osteoclast Differentiation and Mucin and Cytokine Production. Int. J. Mol. Sci. 2019, 20, 1346. [Google Scholar] [CrossRef]
- Bahrami, S.; Drabløs, F. Gene regulation in the immediate-early response process. Adv. Biol. Regul. 2016, 62, 37–49. [Google Scholar] [CrossRef]
- Fowler, T.; Sen, R.; Roy, A.L. Regulation of primary response genes. Mol. Cell 2011, 44, 348–360. [Google Scholar] [CrossRef] [PubMed]
- Motakis, E.; Guhl, S.; Ishizu, Y.; Itoh, M.; Kawaji, H.; de Hoon, M.; Lassmann, T.; Carninci, P.; Hayashizaki, Y.; Zuberbier, T.; et al. Redefinition of the human mast cell transcriptome by deep-CAGE sequencing. Blood 2014, 123, e58–e67. [Google Scholar] [CrossRef] [PubMed]
- Yukawa, M.; Jagannathan, S.; Vallabh, S.; Kartashov, A.V.; Chen, X.; Weirauch, M.T.; Barski, A. AP-1 activity induced by co-stimulation is required for chromatin opening during T cell activation. J. Exp. Med. 2020, 217, e20182009. [Google Scholar] [CrossRef] [PubMed]
- Lyu, P.; Jiang, H. Chromatin profiling reveals TFAP4 as a critical transcriptional regulator of bovine satellite cell differentiation. BMC Genom. 2024, 25, 272. [Google Scholar] [CrossRef]
- Nguyen, H.T.; Najih, M.; Martin, L.J. The AP-1 family of transcription factors are important regulators of gene expression within Leydig cells. Endocrine 2021, 74, 498–507. [Google Scholar] [CrossRef]
- Evseeva, M.N.; Balashova, M.S.; Kulebyakin, K.Y.; Rubtsov, Y.P. Adipocyte Biology from the Perspective of In Vivo Research: Review of Key Transcription Factors. Int. J. Mol. Sci. 2021, 23, 322. [Google Scholar] [CrossRef]
- Kim, H.Y.; Huang, B.X.; Spector, A.A. Molecular and Signaling Mechanisms for Docosahexaenoic Acid-Derived Neurodevelopment and Neuroprotection. Int. J. Mol. Sci. 2022, 23, 4635. [Google Scholar] [CrossRef]
- Ahmed, M.B.; Alghamdi, A.A.A.; Islam, S.U.; Lee, J.S.; Lee, Y.S. cAMP Signaling in Cancer: A PKA-CREB and EPAC-Centric Approach. Cells 2022, 11, 2020. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, M.A.R.; An, J.; Jeong, S. The Pleiotropic Face of CREB Family Transcription Factors. Mol. Cells 2023, 46, 399–413. [Google Scholar] [CrossRef]
- Lee, J.; Jung, E.; Lee, J.; Huh, S.; Boo, Y.C.; Hyun, C.G.; Kim, Y.S.; Park, D. Mechanisms of melanogenesis inhibition by 2,5-dimethyl-4-hydroxy-3(2H)-furanone. Br. J. Dermatol. 2007, 157, 242–248. [Google Scholar] [CrossRef]
- Saha, B.; Singh, S.K.; Sarkar, C.; Bera, R.; Ratha, J.; Tobin, D.J.; Bhadra, R. Activation of the Mitf promoter by lipid-stimulated activation of p38-stress signalling to CREB. Pigment Cell Res. 2006, 19, 595–605. [Google Scholar] [CrossRef] [PubMed]
- Yun, C.Y.; You, S.T.; Kim, J.H.; Chung, J.H.; Han, S.B.; Shin, E.Y.; Kim, E.G. p21-activated kinase 4 critically regulates melanogenesis via activation of the CREB/MITF and β-catenin/MITF pathways. J. Investig. Dermatol. 2015, 135, 1385–1394. [Google Scholar] [CrossRef]
- Kim, S.H.; Lee, J.; Jung, J.; Kim, G.H.; Yun, C.Y.; Jung, S.H.; Hwang, B.Y.; Hong, J.T.; Han, S.B.; Jung, J.K.; et al. Interruption of p38(MAPK)-MSK1-CREB-MITF-M pathway to prevent hyperpigmentation in the skin. Int. J. Biol. Sci. 2024, 20, 1688–1704. [Google Scholar] [CrossRef]
- Ouyang, J.; Hu, N.; Wang, H. Petanin Potentiated JNK Phosphorylation to Negatively Regulate the ERK/CREB/MITF Signaling Pathway for Anti-Melanogenesis in Zebrafish. Int. J. Mol. Sci. 2024, 25, 5939. [Google Scholar] [CrossRef] [PubMed]
- Niwano, T.; Terazawa, S.; Sato, Y.; Kato, T.; Nakajima, H.; Imokawa, G. Glucosamine abrogates the stem cell factor + endothelin-1-induced stimulation of melanogenesis via a deficiency in MITF expression due to the proteolytic degradation of CREB in human melanocytes. Arch. Dermatol. Res. 2018, 310, 625–637. [Google Scholar] [CrossRef]
- Niwano, T.; Terazawa, S.; Nakajima, H.; Imokawa, G. The stem cell factor-stimulated melanogenesis in human melanocytes can be abrogated by interrupting the phosphorylation of MSK1: Evidence for involvement of the p38/MSK1/CREB/MITF axis. Arch. Dermatol. Res. 2018, 310, 187–196. [Google Scholar] [CrossRef]
- Nechushtan, H.; Razin, E. The function of MITF and associated proteins in mast cells. Mol. Immunol. 2002, 38, 1177–1180. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Proaño-Pérez, E.; Muñoz-Cano, R.; Martin, M. Anaphylaxis: Focus on Transcription Factor Activity. Int. J. Mol. Sci. 2021, 22, 4935. [Google Scholar] [CrossRef]
- Schwanhäusser, B.; Busse, D.; Li, N.; Dittmar, G.; Schuchhardt, J.; Wolf, J.; Chen, W.; Selbach, M. Global quantification of mammalian gene expression control. Nature 2011, 473, 337–342. [Google Scholar] [CrossRef]
- Babina, M.; Rex, C.; Guhl, S.; Thienemann, F.; Artuc, M.; Henz, B.M.; Zuberbier, T. Baseline and stimulated turnover of cell surface c-Kit expression in different types of human mast cells. Exp. Dermatol. 2006, 15, 530–537. [Google Scholar] [CrossRef]
- Kraft, S.; Rana, S.; Jouvin, M.H.; Kinet, J.P. The role of the FcepsilonRI beta-chain in allergic diseases. Int. Arch. Allergy Immunol. 2004, 135, 62–72. [Google Scholar] [CrossRef] [PubMed]
- Potaczek, D.P.; Kabesch, M. Current concepts of IgE regulation and impact of genetic determinants. Clin. Exp. Allergy 2012, 42, 852–871. [Google Scholar] [CrossRef] [PubMed]
- Gilfillan, A.M.; Beaven, M.A. Regulation of mast cell responses in health and disease. Crit. Rev. Immunol. 2011, 31, 475–529. [Google Scholar] [CrossRef] [PubMed]
- O’Neil, J.; Benita, Y.; Feldman, I.; Chenard, M.; Roberts, B.; Liu, Y.; Li, J.; Kral, A.; Lejnine, S.; Loboda, A.; et al. An Unbiased Oncology Compound Screen to Identify Novel Combination Strategies. Mol. Cancer Ther. 2016, 15, 1155–1162. [Google Scholar] [CrossRef]
- Menden, M.P.; Wang, D.; Mason, M.J.; Szalai, B.; Bulusu, K.C.; Guan, Y.; Yu, T.; Kang, J.; Jeon, M.; Wolfinger, R.; et al. Community assessment to advance computational prediction of cancer drug combinations in a pharmacogenomic screen. Nat. Commun. 2019, 10, 2674. [Google Scholar] [CrossRef]
- Wang, Y.; Wu, Z.; Yan, G.; Li, S.; Zhang, Y.; Li, G.; Wu, C. The CREB1 inhibitor 666-15 maintains cartilage homeostasis and mitigates osteoarthritis progression. Bone Jt. Res. 2024, 13, 4–18. [Google Scholar] [CrossRef]
- Masic, D.; Fee, K.; Bell, H.; Case, M.; Witherington, G.; Lansbury, S.; Ojeda-Garcia, J.; McDonald, D.; Schwab, C.; Van Delft, F.W.; et al. Hyperactive CREB subpopulations increase during therapy in pediatric B-lineage acute lymphoblastic leukemia. Haematologica 2023, 108, 981–992. [Google Scholar] [CrossRef]
- Zheng, W.; Guo, J.; Lu, X.; Qiao, Y.; Liu, D.; Pan, S.; Liang, L.; Liu, C.; Zhu, H.; Liu, Z.; et al. cAMP-response element binding protein mediates podocyte injury in diabetic nephropathy by targeting lncRNA DLX6-AS1. Metabolism 2022, 129, 155155. [Google Scholar] [CrossRef]
- Sapio, L.; Salzillo, A.; Ragone, A.; Illiano, M.; Spina, A.; Naviglio, S. Targeting CREB in Cancer Therapy: A Key Candidate or One of Many? An Update. Cancers 2020, 12, 3166. [Google Scholar] [CrossRef]
- Carlezon, W.A., Jr.; Duman, R.S.; Nestler, E.J. The many faces of CREB. Trends Neurosci. 2005, 28, 436–445. [Google Scholar] [CrossRef]





| Gene | Forward 5′-3′ | Reverse 5′-3′ |
|---|---|---|
| CREB1 | GAGAAGCGGAGTGTTGGTGA | TCCGTCACTGCTTTCGTTCA |
| KIT | ACTGTGGCCGTTATCTGGAA | GAAGTGCCCCTGAAGTACCT |
| FCERIA | ACCTGCTGCTGAGTTGAGAT | AAGTGTGGCAGCTGGACTAT |
| MRGPRX2 | CGGCCTGGGGAACAGAAAGT | GGATCAGGAAGACCGGGATCA |
| HPRT | GCCTCCCATCTCCTTCATCA | CCTGGCGTCGTGATTAGTGA |
| PPIB * | AAGATGTCCCTGTGCCCTAC | ATGGCAAGCATGTGGTGTTT |
| GAPDH | ATCTCGCTCCTGGAAGATGG | AGGTCGGAGTCAACGGATTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Schneikert, J.; Tripathi, S.R.; Jin, M.; Bal, G.; Zuberbier, T.; Babina, M. CREB Is Critically Implicated in Skin Mast Cell Degranulation Elicited via FcεRI and MRGPRX2. Cells 2024, 13, 1681. https://doi.org/10.3390/cells13201681
Li Z, Schneikert J, Tripathi SR, Jin M, Bal G, Zuberbier T, Babina M. CREB Is Critically Implicated in Skin Mast Cell Degranulation Elicited via FcεRI and MRGPRX2. Cells. 2024; 13(20):1681. https://doi.org/10.3390/cells13201681
Chicago/Turabian StyleLi, Zhuoran, Jean Schneikert, Shiva Raj Tripathi, Manqiu Jin, Gürkan Bal, Torsten Zuberbier, and Magda Babina. 2024. "CREB Is Critically Implicated in Skin Mast Cell Degranulation Elicited via FcεRI and MRGPRX2" Cells 13, no. 20: 1681. https://doi.org/10.3390/cells13201681
APA StyleLi, Z., Schneikert, J., Tripathi, S. R., Jin, M., Bal, G., Zuberbier, T., & Babina, M. (2024). CREB Is Critically Implicated in Skin Mast Cell Degranulation Elicited via FcεRI and MRGPRX2. Cells, 13(20), 1681. https://doi.org/10.3390/cells13201681

