CircADAMTS16 Inhibits Differentiation and Promotes Proliferation of Bovine Adipocytes by Targeting miR-10167-3p
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethic Statement
2.2. Animal Samples
2.3. Prediction and Screening of miRNA
2.4. Construction of Recombinant Plasmid and Luciferase Activity Assay
2.5. Cell Culture and Oil Red O Staining
2.6. RNA Extraction, cDNA Synthesis, and qPCR
2.7. EdU and CCK-8 Assay
2.8. Flow Cytometry
2.8.1. Cell Cycle Detection
2.8.2. Cell Apoptosis Detection
2.9. Data Analysis
3. Results
3.1. miR-10167-3p May Be a Target miRNA of circADAMTS16
3.2. circADAMTS16 Inhibits the Differentiation of Bovine Preadipocytes by Targeting miR-10167-3p
3.3. circADAMTS16 Promotes the Proliferation of Bovine Adipocytes by Targeting miR-10167-3p
3.4. circADAMTS16 Inhibits Bovine Adipocytes Apoptosis by Targeting miR-10167-3p
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Gene | Primer Sequences (5′→3′) | Product Size | Annealing Temperature |
---|---|---|---|
CDK2 | F: TTTGCTGAGATGGTGACCCG | 115 | 60 |
R: TAACTCCTGGCCAAACCACC | |||
CDK4 | F:GTGACAAGTGGTGGGACAGT | 168 | 60 |
R:GATACAGCCAACGCTCCACA | |||
PCNA | F: AACCTGCAGAGCATGGACTC | 190 | 60 |
R: ACGTGTCCGCGTTATCTTCA | |||
CCND2 | F: GGGCAAGTTGAAATGGAA | 173 | 60 |
R: TCATCGACGGCGGGTAC | |||
Bcl-2 | F: ATGACCGAGTACCTGAAC | 79 | 60 |
R: CATACAGCTCCACAAAGG | |||
Bax | F:GAGATGAATTGGACAGTAACA | 118 | 60 |
R: TTGAAGTTGCCGTCAGAA | |||
Caspase-9 | F: TGGTGGTCATCCTGTCTC | 76 | 60 |
R: CATCCATCTGTGCCATAAAC | |||
Caspase-3 | F: CAGCGTCGTAGCTGAACGTA | 123 | 60 |
R:CCAGAGTCCATTGATTTGCTTCC | |||
FABP4 | F: AAGTCAAGAGCATCGTAA | 111 | 60 |
R: CCAGCACCATCTTATCAT | |||
LPL | F: ACGATTATTGCTCAGCATGG | 130 | 60 |
R: ACTTTGTACAGGCACAACCG | |||
PPARγ | F:AGGATGGGGTCCTCATATCC | 137 | 60 |
R:GTCAGCTCTTGGGAACGGAA | |||
C/EBPα | F:TGGACAAGAACAGCAACGAG | 130 | 60 |
R:TTGTCACTGGTCAGCTCCAG | |||
C/EBPβ | F:TTCCTCTCCGACCTCTTCTC | 79 | 60 |
R:CCAGACTCACGTAGCCGTACT | |||
circADAMTS16 | F: TATGCTCCTGGAAGAACGA | 247 | 60 |
R:GCTCTTCATTCCTATGGGACTTCAG | |||
miR-10167-3p | F:TAATACGGGTGGTCGGGG | 65 | 60 |
R:GTGCAGGGTCCGAGGTATT |
References
- Li, X.; Fu, X.; Yang, G.; Du, M. Review: Enhancing intramuscular fat development via targeting fibro-adipogenic progenitor cells in meat animals. Animal 2020, 14, 312–321. [Google Scholar] [CrossRef][Green Version]
- Li, L.; Ma, L.; Zhao, Z.; Luo, S.; Gong, B.; Li, J.; Feng, J.; Zhang, H.; Qi, W.; Zhou, T.; et al. IL-25–induced shifts in macrophage polarization promote development of beige fat and improve metabolic homeostasis in mice. PLoS Biol. 2021, 19, e3001348. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, J.; Gong, H.; Cui, L.; Zhang, W.; Ma, J.; Chen, C.; Ai, H.; Xiao, S.; Huang, L.; et al. Genetic correlation of fatty acid composition with growth, carcass, fat deposition and meat quality traits based on GWAS data in six pig populations. Meat Sci. 2019, 150, 47–55. [Google Scholar] [CrossRef]
- Kang, Z.; Zhang, S.; Jiang, E.; Wang, X.; Wang, Z.; Chen, H.; Lan, X. circFLT1 and lncCCPG1 Sponges miR-93 to Regulate the Proliferation and Differentiation of Adipocytes by Promoting lncSLC30A9 Expression. Mol. Ther. Nucleic Acids 2020, 22, 484–499. [Google Scholar] [CrossRef]
- Lee, J.-E.; Schmidt, H.; Lai, B.; Ge, K. Transcriptional and Epigenomic Regulation of Adipogenesis. Mol. Cell. Biol. 2019, 39, e00601-18. [Google Scholar] [CrossRef][Green Version]
- Chen, Y.; Gao, L.; Lin, T.; Pei, X.; Gao, Q.; Chen, J.; Zhang, Y.; Wu, X.; Li, Z.; Zhang, Z. C/EBPZ modulates the differentiation and proliferation of preadipocytes. Int. J. Obes. 2022, 46, 523–534. [Google Scholar] [CrossRef]
- Xiao, C.; Jin, H.G.; Zhang, L.C.; Liu, J.Q.; He, M.; Ma, H.H.; Yu, Y.S.; Cao, Y. Effects of SPARCL1 on the proliferation and differentiation of sheep preadipocytes. Adipocyte 2021, 10, 658–669. [Google Scholar] [CrossRef]
- Shao, J.; Pan, T.; Wang, J.; Tang, T.; Li, Y.; Jia, X.; Lai, S. MiR-208b Regulates Rabbit Preadipocyte Proliferation and Differentiation. Genes 2021, 12, 890. [Google Scholar] [CrossRef]
- Sun, Y.; Cai, R.; Wang, Y.; Zhao, R.; Qin, J.; Pang, W. A Newly Identified LncRNA LncIMF4 Controls Adipogenesis of Porcine Intramuscular Preadipocyte through Attenuating Autophagy to Inhibit Lipolysis. Animals 2020, 10, 926. [Google Scholar] [CrossRef]
- Yu, G.; Yang, Z.; Peng, T.; Lv, Y. Circular RNAs: Rising stars in lipid metabolism and lipid disorders. J. Cell. Physiol. 2020, 236, 4797–4806. [Google Scholar] [CrossRef]
- Xu, Q.; Wang, Y.; Li, X.; Du, Y.; Li, Y.; Zhu, J.; Lin, Y. miR-10a-5p Inhibits the Differentiation of Goat Intramuscular Preadipocytes by Targeting KLF8 in Goats. Front. Mol. Biosci. 2021, 8, 700078. [Google Scholar] [CrossRef]
- Xiao, F.; Tang, C.Y.; Tang, H.N.; Wu, H.X.; Hu, N.; Li, L.; Zhou, H.D. Long non-coding RNA 332443 inhibits preadipocyte differentiation by targeting Runx1 and p38-MAPK and ERK1/2-MAPK signaling pathways. Front. Cell. Dev. Biol. 2021, 9, 663959. [Google Scholar] [CrossRef]
- Wang, L.; Liang, W.; Wang, S.; Wang, Z.; Bai, H.; Jiang, Y.; Bi, Y.; Chen, G.; Chang, G. Circular RNA expression profiling reveals that circ-PLXNA1 functions in duck adipocyte differentiation. PLoS ONE 2020, 15, e0236069. [Google Scholar] [CrossRef]
- Shi, N.; Zhang, S.; Guo, Y.; Yu, X.; Zhao, W.; Zhang, M.; Guan, Z.; Duan, M. CircRNA_0050463 promotes influenza A virus replication by sponging miR-33b-5p to regulate EEF1A1. Vet. Microbiol. 2021, 254, 108995. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wang, C.; Sun, H.; Wang, J.; Liang, Y.; Wang, Y.; Wong, G. The bioinformatics toolbox for circRNA discovery and analysis. Briefings Bioinform. 2020, 22, 1706–1728. [Google Scholar] [CrossRef] [PubMed]
- Kristensen, L.S.; Jakobsen, T.; Hager, H.; Kjems, J. The emerging roles of circRNAs in cancer and oncology. Nat. Rev. Clin. Oncol. 2021, 19, 188–206. [Google Scholar] [CrossRef] [PubMed]
- Kristensen, L.S.; Andersen, M.S.; Stagsted, L.V.W.; Ebbesen, K.K.; Hansen, T.B.; Kjems, J. The biogenesis, biology and characterization of circular RNAs. Nat. Rev. Genet. 2019, 20, 675–691. [Google Scholar] [CrossRef]
- Liu, J.; Xue, N.; Guo, Y.; Niu, K.; Gao, L.; Zhang, S.; Gu, H.; Wang, X.; Zhao, D.; Fan, R. CircRNA_100367 regulated the radiation sensitivity of esophageal squamous cell carcinomas through miR-217/Wnt3 pathway. Aging 2019, 11, 12412–12427. [Google Scholar] [CrossRef] [PubMed]
- Abe, N.; Hiroshima, M.; Maruyama, H.; Nakashima, Y.; Nakano, Y.; Matsuda, A.; Sako, Y.; Ito, Y.; Abe, H. Rolling Circle Amplification in a Prokaryotic Translation System Using Small Circular RNA. Angew. Chem. Int. Ed. 2013, 52, 7004–7008. [Google Scholar] [CrossRef]
- Liu, K.; Liu, X.; Deng, Y.; Li, Z.; Tang, A. CircRNA-mediated regulation of brown adipose tissue adipogenesis. Front. Nutr. 2022, 9, 926024. [Google Scholar] [CrossRef]
- Yu, L.; Liu, Y. circRNA_0016624 could sponge miR-98 to regulate BMP2 expression in postmenopausal osteoporosis. Biochem. Biophys. Res. Commun. 2019, 516, 546–550. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Liu, H.; Li, Y.; Mao, R.; Yang, H.; Zhang, Y.; Zhang, Y.; Guo, P.; Zhan, D.; Zhang, T. Circular RNA SAMD4A controls adipogenesis in obesity through the miR-138-5p/EZH2 axis. Theranostics 2020, 10, 4705–4719. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Bai, Y.; Cui, R.; He, S.; Zhao, X.; Wu, K.; Fang, M. Sus_circPAPPA2 regulates fat deposition in castrated pigs through the miR-2366/GK pathway. Biomolecules 2022, 12, 946447. [Google Scholar] [CrossRef]
- Feng, X.; Zhao, J.; Li, F.; Aloufi, B.H.; Alshammari, A.M.; Ma, Y. Weighted Gene Co-expression Network Analysis Revealed That CircMARK3 Is a Potential CircRNA Affects Fat Deposition in Buffalo. Front. Vet. Sci. 2022, 9, 946447. [Google Scholar] [CrossRef]
- Pluda, S.; Mazzocato, Y.; Angelini, A. Peptide-Based Inhibitors of ADAM and ADAMTS Metalloproteinases. Front. Mol. Biosci. 2021, 8, 703715. [Google Scholar] [CrossRef] [PubMed]
- Binder, M.J.; McCoombe, S.; Williams, E.D.; McCulloch, D.R.; Ward, A.C. ADAMTS-15 Has a Tumor Suppressor Role in Prostate Cancer. Biomolecules 2020, 10, 682. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Chen, S.; Zhao, J.Q.; Xiang, B.L.; Gu, X.; Zou, F.; Zhang, Z.H. ADAMTS-1 inhibits angiogenesis via the PI3K/Akt-eNOS-VEGF pathway in lung cancer cells. Transl. Cancer Res. 2019, 8, 2725–2735. [Google Scholar] [CrossRef] [PubMed]
- Sakamoto, N.; Oue, N.; Noguchi, T.; Sentani, K.; Anami, K.; Sanada, Y.; Yoshida, K.; Yasui, W. Serial analysis of gene expression of esophageal squamous cell carcinoma: ADAMTS16 is upregulated in esophageal squamous cell carcinoma. Cancer Sci. 2009, 101, 1038–1044. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.; Lei, Z.; Wang, S.; Sheng, H.; Gao, Y.; Ma, Y.; Ma, Y. Expression profile analysis of circADAMTS16 and its effect on differentiation of bovine adipocytes. J. Northwest Agric. 2023, prepublish. [Google Scholar]
- Pan, C.; Lei, Z.; Wang, S.; Wang, X.; Wei, D.; Cai, X.; Luoreng, Z.; Wang, L.; Ma, Y. Genome-wide identification of cyclin-dependent kinase (CDK) genes affecting adipocyte differentiation in cattle. BMC Genom. 2021, 22, 532. [Google Scholar] [CrossRef]
- Cleal, L.; Aldea, T.; Chau, Y.-Y. Fifty shades of white: Understanding heterogeneity in white adipose stem cells. Adipocyte 2017, 6, 205–216. [Google Scholar] [CrossRef][Green Version]
- Salami, S.A.; O’Grady, M.N.; Luciano, G.; Priolo, A.; McGee, M.; Moloney, A.P.; Kerry, J.P. Fatty acid composition, shelf-life and eating quality of beef from steers fed corn or wheat dried distillers’ grains with solubles in a concentrate supplement to grass silage. Meat Sci. 2021, 173, 108381. [Google Scholar] [CrossRef] [PubMed]
- Ning, S.; Li, X. Non-coding RNA Resources. Adv. Exp. Med. Biol. 2018, 1094, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Zang, J.; Lu, D.; Xu, A. The interaction of circRNAs and RNA binding proteins: An important part of circRNA maintenance and function. J. Neurosci. Res. 2018, 98, 87–97. [Google Scholar] [CrossRef][Green Version]
- Qiu, J.; Wang, W.; Hu, S.; Wang, Y.; Sun, W.; Hu, J.; Gan, X.; Wang, J. Molecular cloning, characterization and expression analysis of C/EBP alpha, beta and delta in adipose-related tissues and adipocyte of duck (Anas platyrhynchos). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2018, 221–222, 29–43. [Google Scholar] [CrossRef] [PubMed]
- Leem, Y.E.; Bae, J.H.; Jeong, H.J.; Kang, J.S. PRMT7 deficiency enhances adipogenesis through modulation of C/EBP-beta. Biochem. Biophys. Res. Commun. 2019, 517, 484–490. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Weijun, P.; Ning, W.; Yu, W.; Wenkai, R.; Gongshe, Y. Knockdown of both FoxO1 and C/EBPβ promotes adipogenesis in porcine preadipocytes through feedback regulation. Cell Biol. Int. 2013, 37, 905–916. [Google Scholar] [CrossRef]
- Lin, W.; Wen, X.; Li, X.; Chen, L.; Wei, W.; Zhang, L.; Chen, J. MiR-144 regulates adipogenesis by mediating formation of C/EBPalpha-FOXO1 protein complex. Biochem. Biophys. Res. Commun. 2022, 612, 126–133. [Google Scholar] [CrossRef]
- Gu, H.; Zhou, Y.; Yang, J.; Li, J.; Peng, Y.; Zhang, X.; Miao, Y.; Jiang, W.; Bu, G.; Hou, L.; et al. Targeted overexpression of PPARgamma in skeletal muscle by random insertion and CRISPR/Cas9 transgenic pig cloning enhances oxidative fiber formation and intramuscular fat deposition. FASEB J. 2021, 35, e21308. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, Y.; Wang, H.; Ma, X.; Zan, L. MicroRNA-224 impairs adipogenic differentiation of bovine preadipocytes by targeting LPL. Mol. Cell. Probes 2019, 44, 29–36. [Google Scholar] [CrossRef]
- Plaza, A.; Merino, B.; Cano, V.; Domínguez, G.; Pérez-Castells, J.; Fernández-Alfonso, M.S.; Sengenès, C.; Chowen, J.A.; Ruiz-Gayo, M. Cholecystokinin is involved in triglyceride fatty acid uptake by rat adipose tissue. J. Endocrinol. 2018, 236, 137–150. [Google Scholar] [CrossRef][Green Version]
- Yan, W.; Zhou, H.; Hu, J.; Luo, Y.; Hickford, J.G. Variation in the FABP4 gene affects carcass and growth traits in sheep. Meat Sci. 2018, 145, 334–339. [Google Scholar] [CrossRef]
- Kordowski, F.; Kolarova, J.; Schafmayer, C.; Buch, S.; Goldmann, T.; Marwitz, S.; Kugler, C.; Scheufele, S.; Gaßling, V.; Németh, C.G.; et al. Aberrant DNA methylation of ADAMTS16 in colorectal and other epithelial cancers. BMC Cancer 2018, 18, 796. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Guarnerio, J.; Zhang, Y.; Cheloni, G.; Panella, R.; Katon, J.M.; Simpson, M.; Matsumoto, A.; Papa, A.; Loretelli, C.; Petri, A.; et al. Intragenic antagonistic roles of protein and circRNA in tumorigenesis. Cell Res. 2019, 29, 628–640. [Google Scholar] [CrossRef]
- Wood, D.J.; Endicott, J.A. Structural insights into the functional diversity of the CDK–cyclin family. Open Biol. 2018, 8, 180112. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Goel, B.; Tripathi, N.; Bhardwaj, N.; Jain, S.K. Small Molecule CDK Inhibitors for the Therapeutic Management of Cancer. Curr. Top. Med. Chem. 2020, 20, 1535–1563. [Google Scholar] [CrossRef]
- Schafer, K.A. The Cell Cycle: A Review. Vet. Pathol. 1998, 35, 461–478. [Google Scholar] [CrossRef] [PubMed]
- Romar, G.A.; Kupper, T.S.; Divito, S.J. Research Techniques Made Simple: Techniques to Assess Cell Proliferation. J. Investig. Dermatol. 2016, 136, e1–e7. [Google Scholar] [CrossRef][Green Version]
- Lin, W.; Chen, L.; Meng, W.; Yang, K.; Wei, S.; Wei, W.; Chen, J.; Zhang, L. C/EBPalpha promotes porcine pre-adipocyte proliferation and differentiation via mediating MSTRG.12568.2/FOXO3 trans-activation for STYX. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2022, 1867, 159206. [Google Scholar] [CrossRef]
- Chang, C.-C.; Sia, K.-C.; Chang, J.-F.; Lin, C.-M.; Yang, C.-M.; Huang, K.-Y.; Lin, W.-N. Lipopolysaccharide promoted proliferation and adipogenesis of preadipocytes through JAK/STAT and AMPK-regulated cPLA2 expression. Int. J. Med. Sci. 2019, 16, 167–179. [Google Scholar] [CrossRef][Green Version]
- Sorisky, A.; Magun, R.; Gagnon, A.M. Adipose cell apoptosis: Death in the energy depot. Int. J. Obes. Relat. Metab. Disord. 2000, 24 (Suppl. 4), S3–S7. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Prins, J.; O’Rahilly, S. Regulation of Adipose Cell Number in Man. Clin. Sci. 1997, 92, 3–11. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Jiang, M.; Xu, S.; Bai, M.; Zhang, A. The emerging role of MEIS1 in cell proliferation and differentiation. Am. J. Physiol. Cell. Physiol. 2021, 320, C264–C269. [Google Scholar] [CrossRef]
- Alenzi, F.Q. Links between apoptosis, proliferation and the cell cycle. Br. J. Biomed. Sci. 2004, 61, 99–102. [Google Scholar] [CrossRef]
- Wang, X.; Lu, X.; Zhu, R.; Zhang, K.; Li, S.; Chen, Z.; Li, L. Betulinic Acid Induces Apoptosis in Differentiated PC12 Cells Via ROS-Mediated Mitochondrial Pathway. Neurochem. Res. 2017, 42, 1130–1140. [Google Scholar] [CrossRef]
- Brentnall, M.; Rodriguez-Menocal, L.; De Guevara, R.L.; Cepero, E.; Boise, L.H. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 2013, 14, 32. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yang, F.; Pei, R.; Zhang, Z.; Liao, J.; Yu, W.; Qiao, N.; Han, Q.; Li, Y.; Hu, L.; Guo, J.; et al. Copper induces oxidative stress and apoptosis through mitochondria-mediated pathway in chicken hepatocytes. Toxicol. In Vitro 2018, 54, 310–316. [Google Scholar] [CrossRef]
- Nagel, S.A.; Keuper, M.; Zagotta, I.; Enlund, E.; Ruperez, A.I.; Debatin, K.-M.; Wabitsch, M.; Fischer-Posovszky, P. Up-regulation of Bcl-2 during adipogenesis mediates apoptosis resistance in human adipocytes. Mol. Cell. Endocrinol. 2014, 382, 368–376. [Google Scholar] [CrossRef]
- Gogvadze, V.; Orrenius, S. Mitochondrial regulation of apoptotic cell death. Chem. Biol. Interact. 2006, 163, 4–14. [Google Scholar] [CrossRef]
- Dietrich, J.B. Apoptose et gènes anti-apoptotiques de la famille Bcl-2. Arch. Physiol. Biochem. 1997, 105, 125–135. [Google Scholar] [CrossRef]
- Rana, N.K.; Singh, P.; Koch, B. CoCl2 simulated hypoxia induce cell proliferation and alter the expression pattern of hypoxia associated genes involved in angiogenesis and apoptosis. Biol. Res. 2019, 52, 12. [Google Scholar] [CrossRef] [PubMed][Green Version]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, C.; Feng, X.; Ma, Y.; Wei, D.; Zhang, L.; Wang, S.; Ma, Y. CircADAMTS16 Inhibits Differentiation and Promotes Proliferation of Bovine Adipocytes by Targeting miR-10167-3p. Cells 2023, 12, 1175. https://doi.org/10.3390/cells12081175
Hu C, Feng X, Ma Y, Wei D, Zhang L, Wang S, Ma Y. CircADAMTS16 Inhibits Differentiation and Promotes Proliferation of Bovine Adipocytes by Targeting miR-10167-3p. Cells. 2023; 12(8):1175. https://doi.org/10.3390/cells12081175
Chicago/Turabian StyleHu, Chunli, Xue Feng, Yanfen Ma, Dawei Wei, Lingkai Zhang, Shuzhe Wang, and Yun Ma. 2023. "CircADAMTS16 Inhibits Differentiation and Promotes Proliferation of Bovine Adipocytes by Targeting miR-10167-3p" Cells 12, no. 8: 1175. https://doi.org/10.3390/cells12081175
APA StyleHu, C., Feng, X., Ma, Y., Wei, D., Zhang, L., Wang, S., & Ma, Y. (2023). CircADAMTS16 Inhibits Differentiation and Promotes Proliferation of Bovine Adipocytes by Targeting miR-10167-3p. Cells, 12(8), 1175. https://doi.org/10.3390/cells12081175