Kidney Proximal Tubule GLUT2—More than Meets the Eye
Abstract
:1. Introduction
2. Kidney Proximal Tubule GLUT2 under Physiological Conditions
2.1. Role of KPTC-GLUT2 in Glucose Reabsorption
2.2. KPTCs-GLUT2’s Role in Gluconeogenesis
3. Kidney Proximal Tubule GLUT2 under Pathological Conditions
3.1. Genetic Mutations in the SLC2A2 Gene (GLUT2)
3.2. KPTC-GLUT2 in Diabetic Kidney Disease
3.2.1. Glucose Transport/Reabsorption under Hyperglycemia
3.2.2. KPTC-GLUT2 Translocation under Hyperglycemia
3.2.3. Glucose Formation (Gluconeogenesis) under Hyperglycemia
3.2.4. Glucose Metabolism via Other Pathways under Hyperglycemia
3.2.5. KPTC-GLUT2’s Role in Regulating Pathological Pathways under Hyperglycemia
3.2.6. KPTC-GLUT2’s Role in Glucose Sensing under Hyperglycemia
4. Reinvestigating GLUT2-Associated Pathways in Akita Diabetic Mice
4.1. Kidney Metabolomic Analysis of Diabetic Akita-KPTCGLUT2−/− Mice
4.2. AICAR Activates AMPK and Restores Fat Oxidation in KPTC-GLUT2 Null Akita Diabetic Mice
4.3. Reduced Endocannabinoid ‘Tone’ in KPTC-GLUT2 Null Akita Diabetic Mice
4.4. DHAP Upregulation and mTORC1 Activation in KPTC-GLUT2 Null Akita Diabetic Mice
5. Targeting GLUT2 in the Kidney—Rationale and Limitations
5.1. The GLUT2-SGLT2 Link
5.2. KPTC-GLUT2: Is It Targetable?
6. Gaps and Conclusions
7. Materials and Methods
7.1. Animals
7.2. LC-MS Metabolomics Analysis
7.3. Real-Time PCR
7.4. Western Blotting
7.5. Fluorescence Immunohistochemistry
7.6. Sample Preparation and Endocannabinoid Measurements by LC-MS/MS
7.7. Fatty Acid Amide Hydrolase Activity Assay
7.8. Spatial Transcriptomics Data
7.9. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zierler, K. Whole body glucose metabolism. Am. J. Physiol. 1999, 276, E409–E426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowalski, G.M.; Bruce, C.R. The regulation of glucose metabolism: Implications and considerations for the assessment of glucose homeostasis in rodents. Am. J. Physiol. Endocrinol. Metab. 2014, 307, E859–E871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mather, A.; Pollock, C. Glucose handling by the kidney. Kidney Int. Suppl. 2011, 79, S1–S6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Supabphol, S.; Seubwai, W.; Wongkham, S.; Saengboonmee, C. High glucose: An emerging association between diabetes mellitus and cancer progression. J. Mol. Med. 2021, 99, 1175–1193. [Google Scholar] [CrossRef]
- Barron, C.C.; Bilan, P.J.; Tsakiridis, T.; Tsiani, E. Facilitative glucose transporters: Implications for cancer detection, prognosis and treatment. Metab. Clin. Exp. 2016, 65, 124–139. [Google Scholar] [CrossRef]
- Mueckler, M.; Thorens, B. The SLC2 (GLUT) family of membrane transporters. Mol. Asp. Med. 2013, 34, 121–138. [Google Scholar] [CrossRef] [Green Version]
- Wright, E.M.; Hirayama, B.A.; Loo, D.F. Active sugar transport in health and disease. J. Intern. Med. 2007, 261, 32–43. [Google Scholar] [CrossRef]
- Wright, E.M.; Loo, D.D.; Hirayama, B.A. Biology of human sodium glucose transporters. Physiol. Rev. 2011, 91, 733–794. [Google Scholar] [CrossRef] [Green Version]
- Thorens, B. GLUT2, glucose sensing and glucose homeostasis. Diabetologia 2015, 58, 221–232. [Google Scholar] [CrossRef] [Green Version]
- Vallon, V. Glucose transporters in the kidney in health and disease. Pflug. Arch. Eur. J. Physiol. 2020, 472, 1345–1370. [Google Scholar] [CrossRef]
- Takata, K. Glucose transporters in the transepithelial transport of glucose. J. Electron Microsc. 1996, 45, 275–284. [Google Scholar] [CrossRef] [PubMed]
- Olson, A.L.; Pessin, J.E. Structure, function, and regulation of the mammalian facilitative glucose transporter gene family. Annu. Rev. Nutr. 1996, 16, 235–256. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.K. Glucose transporters: Structure, function and consequences of deficiency. J. Inherit. Metab. Dis. 2000, 23, 237–246. [Google Scholar] [CrossRef] [PubMed]
- Thorens, B. Glucose transporters in the regulation of intestinal, renal, and liver glucose fluxes. Am. J. Physiol. 1996, 270, G541–G553. [Google Scholar] [CrossRef]
- Koepsell, H. Glucose transporters in the small intestine in health and disease. Pflug. Arch. Eur. J. Physiol. 2020, 472, 1207–1248. [Google Scholar] [CrossRef]
- Koepsell, H. Glucose transporters in brain in health and disease. Pflug. Arch. Eur. J. Physiol. 2020, 472, 1299–1343. [Google Scholar] [CrossRef]
- Chadt, A.; Al-Hasani, H. Glucose transporters in adipose tissue, liver, and skeletal muscle in metabolic health and disease. Pflug. Arch. Eur. J. Physiol. 2020, 472, 1273–1298. [Google Scholar] [CrossRef]
- Mizuguchi, K.; Aoki, H.; Aoyama, M.; Kawaguchi, Y.; Waguri-Nagaya, Y.; Ohte, N.; Asai, K. Three-dimensional spheroid culture induces apical-basal polarity and the original characteristics of immortalized human renal proximal tubule epithelial cells. Exp. Cell Res. 2021, 404, 112630. [Google Scholar] [CrossRef]
- Hotait, Z.S.; Lo Cascio, J.N.; Choos, E.N.D.; Shepard, B.D. The sugar daddy: The role of the renal proximal tubule in glucose homeostasis. Am. J. Physiol. Cell Physiol. 2022, 323, C791–C803. [Google Scholar] [CrossRef]
- Ghezzi, C.; Loo, D.D.F.; Wright, E.M. Physiology of renal glucose handling via SGLT1, SGLT2 and GLUT2. Diabetologia 2018, 61, 2087–2097. [Google Scholar] [CrossRef]
- Watanabe, A.; Choe, S.; Chaptal, V.; Rosenberg, J.M.; Wright, E.M.; Grabe, M.; Abramson, J. The mechanism of sodium and substrate release from the binding pocket of vSGLT. Nature 2010, 468, 988–991. [Google Scholar] [CrossRef] [Green Version]
- Schmidl, S.; Tamayo Rojas, S.A.; Iancu, C.V.; Choe, J.Y.; Oreb, M. Functional Expression of the Human Glucose Transporters GLUT2 and GLUT3 in Yeast Offers Novel Screening Systems for GLUT-Targeting Drugs. Front. Mol. Biosci. 2020, 7, 598419. [Google Scholar] [CrossRef] [PubMed]
- Barfuss, D.W.; Schafer, J.A. Differences in active and passive glucose transport along the proximal nephron. Am. J. Physiol. 1981, 241, F322–F332. [Google Scholar] [CrossRef] [PubMed]
- Thorens, B. Molecular and cellular physiology of GLUT-2, a high-Km facilitated diffusion glucose transporter. Int. Rev. Cytol. 1992, 137, 209–238. [Google Scholar] [CrossRef] [PubMed]
- Leturque, A.; Brot-Laroche, E.; Le Gall, M.; Stolarczyk, E.; Tobin, V. The role of GLUT2 in dietary sugar handling. J. Physiol. Biochem. 2005, 61, 529–537. [Google Scholar] [CrossRef]
- Santer, R.; Groth, S.; Kinner, M.; Dombrowski, A.; Berry, G.T.; Brodehl, J.; Leonard, J.V.; Moses, S.; Norgren, S.; Skovby, F.; et al. The mutation spectrum of the facilitative glucose transporter gene SLC2A2 (GLUT2) in patients with Fanconi-Bickel syndrome. Hum. Genet. 2002, 110, 21–29. [Google Scholar] [CrossRef]
- Guillam, M.T.; Hummler, E.; Schaerer, E.; Yeh, J.I.; Birnbaum, M.J.; Beermann, F.; Schmidt, A.; Deriaz, N.; Thorens, B. Early diabetes and abnormal postnatal pancreatic islet development in mice lacking Glut-2. Hum. Genet. 1997, 17, 327–330. [Google Scholar] [CrossRef]
- Sala-Rabanal, M.; Hirayama, B.A.; Ghezzi, C.; Liu, J.; Huang, S.C.; Kepe, V.; Koepsell, H.; Yu, A.; Powell, D.R.; Thorens, B.; et al. Revisiting the physiological roles of SGLTs and GLUTs using positron emission tomography in mice. J. Physiol. 2016, 594, 4425–4438. [Google Scholar] [CrossRef]
- Meyer, C.; Dostou, J.M.; Welle, S.L.; Gerich, J.E. Role of human liver, kidney, and skeletal muscle in postprandial glucose homeostasis. Am. J. Physiol. Endocrinol. Metab. 2002, 282, E419–E427. [Google Scholar] [CrossRef] [Green Version]
- Sasaki, M.; Sasako, T.; Kubota, N.; Sakurai, Y.; Takamoto, I.; Kubota, T.; Inagi, R.; Seki, G.; Goto, M.; Ueki, K.; et al. Dual Regulation of Gluconeogenesis by Insulin and Glucose in the Proximal Tubules of the Kidney. Diabetes 2017, 66, 2339–2350. [Google Scholar] [CrossRef]
- Schaub, J.A.; Venkatachalam, M.A.; Weinberg, J.M. Proximal Tubular Oxidative Metabolism in Acute Kidney Injury and the Transition to CKD. Kidney360 2021, 2, 355–364. [Google Scholar] [CrossRef] [PubMed]
- Hinden, L.; Kogot-Levin, A.; Tam, J.; Leibowitz, G. Pathogenesis of diabesity-induced kidney disease: Role of kidney nutrient sensing. FEBS J. 2021, 289, 901–921. [Google Scholar] [CrossRef] [PubMed]
- Santer, R.; Schneppenheim, R.; Suter, D.; Schaub, J.; Steinmann, B. Fanconi-Bickel syndrome--the original patient and his natural history, historical steps leading to the primary defect, and a review of the literature. Eur. J. Pediatr. 1998, 157, 783–797. [Google Scholar] [CrossRef]
- Khandelwal, P.; Sinha, A.; Jain, V.; Houghton, J.; Hari, P.; Bagga, A. Fanconi syndrome and neonatal diabetes: Phenotypic heterogeneity in patients with GLUT2 defects. CEN Case Rep. 2018, 7, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Sharari, S.; Abou-Alloul, M.; Hussain, K.; Ahmad Khan, F. Fanconi-Bickel Syndrome: A Review of the Mechanisms That Lead to Dysglycaemia. Int. J. Mol. Sci. 2020, 21, 6286. [Google Scholar] [CrossRef]
- Hinden, L.; Udi, S.; Drori, A.; Gammal, A.; Nemirovski, A.; Hadar, R.; Baraghithy, S.; Permyakova, A.; Geron, M.; Cohen, M.; et al. Modulation of Renal GLUT2 by the Cannabinoid-1 Receptor: Implications for the Treatment of Diabetic Nephropathy. J. Am. Soc. Nephrol. JASN 2018, 29, 434–448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hinden, L.; Ahmad, M.; Hamad, S.; Nemirovski, A.; Szanda, G.; Glasmacher, S.; Kogot-Levin, A.; Abramovitch, R.; Thorens, B.; Gertsch, J.; et al. Opposite physiological and pathological mTORC1-mediated roles of the CB1 receptor in regulating renal tubular function. Nat. Commun. 2022, 13, 1783. [Google Scholar] [CrossRef]
- de Souza Cordeiro, L.M.; Bainbridge, L.; Devisetty, N.; McDougal, D.H.; Peters, D.J.M.; Chhabra, K.H. Loss of function of renal Glut2 reverses hyperglycaemia and normalises body weight in mouse models of diabetes and obesity. Diabetologia 2022, 65, 1032–1047. [Google Scholar] [CrossRef]
- Gerich, J.E. Role of the kidney in normal glucose homeostasis and in the hyperglycaemia of diabetes mellitus: Therapeutic implications. Diabet. Med. J. Br. Diabet. Assoc. 2010, 27, 136–142. [Google Scholar] [CrossRef] [Green Version]
- Freitas, H.S.; Schaan, B.D.; David-Silva, A.; Sabino-Silva, R.; Okamoto, M.M.; Alves-Wagner, A.B.; Mori, R.C.; Machado, U.F. SLC2A2 gene expression in kidney of diabetic rats is regulated by HNF-1alpha and HNF-3beta. Mol. Cell. Endocrinol. 2009, 305, 63–70. [Google Scholar] [CrossRef]
- David-Silva, A.; Freitas, H.S.; Okamoto, M.M.; Sabino-Silva, R.; Schaan, B.D.; Machado, U.F. Hepatocyte nuclear factors 1alpha/4alpha and forkhead box A2 regulate the solute carrier 2A2 (Slc2a2) gene expression in the liver and kidney of diabetic rats. Life Sci. 2013, 93, 805–813. [Google Scholar] [CrossRef] [PubMed]
- Chin, E.; Zamah, A.M.; Landau, D.; Gronbcek, H.; Flyvbjerg, A.; LeRoith, D.; Bondy, C.A. Changes in facilitative glucose transporter messenger ribonucleic acid levels in the diabetic rat kidney. Endocrinology 1997, 138, 1267–1275. [Google Scholar] [CrossRef] [PubMed]
- Dominguez, J.H.; Camp, K.; Maianu, L.; Feister, H.; Garvey, W.T. Molecular adaptations of GLUT1 and GLUT2 in renal proximal tubules of diabetic rats. Am. J. Physiol. 1994, 266, F283–F290. [Google Scholar] [CrossRef] [PubMed]
- Freitas, H.S.; Schaan, B.D.; Seraphim, P.M.; Nunes, M.T.; Machado, U.F. Acute and short-term insulin-induced molecular adaptations of GLUT2 gene expression in the renal cortex of diabetic rats. Mol. Cell. Endocrinol. 2005, 237, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Vestri, S.; Okamoto, M.M.; de Freitas, H.S.; Aparecida Dos Santos, R.; Nunes, M.T.; Morimatsu, M.; Heimann, J.C.; Machado, U.F. Changes in sodium or glucose filtration rate modulate expression of glucose transporters in renal proximal tubular cells of rat. J. Membr. Biol. 2001, 182, 105–112. [Google Scholar] [CrossRef]
- Kamran, M.; Peterson, R.G.; Dominguez, J.H. Overexpression of GLUT2 gene in renal proximal tubules of diabetic Zucker rats. J. Am. Soc. Nephrol. JASN 1997, 8, 943–948. [Google Scholar] [CrossRef]
- Adachi, T.; Yasuda, K.; Okamoto, Y.; Shihara, N.; Oku, A.; Ueta, K.; Kitamura, K.; Saito, A.; Iwakura, I.; Yamada, Y.; et al. T-1095, a renal Na+-glucose transporter inhibitor, improves hyperglycemia in streptozotocin-induced diabetic rats. Metab. Clin. Exp. 2000, 49, 990–995. [Google Scholar] [CrossRef]
- Rahmoune, H.; Thompson, P.W.; Ward, J.M.; Smith, C.D.; Hong, G.; Brown, J. Glucose transporters in human renal proximal tubular cells isolated from the urine of patients with non-insulin-dependent diabetes. Diabetes 2005, 54, 3427–3434. [Google Scholar] [CrossRef] [Green Version]
- Marks, J.; Carvou, N.J.; Debnam, E.S.; Srai, S.K.; Unwin, R.J. Diabetes increases facilitative glucose uptake and GLUT2 expression at the rat proximal tubule brush border membrane. J. Physiol. 2003, 553, 137–145. [Google Scholar] [CrossRef]
- Goestemeyer, A.K.; Marks, J.; Srai, S.K.; Debnam, E.S.; Unwin, R.J. GLUT2 protein at the rat proximal tubule brush border membrane correlates with protein kinase C (PKC)-betal and plasma glucose concentration. Diabetologia 2007, 50, 2209–2217. [Google Scholar] [CrossRef]
- Chichger, H.; Cleasby, M.E.; Srai, S.K.; Unwin, R.J.; Debnam, E.S.; Marks, J. Experimental type II diabetes and related models of impaired glucose metabolism differentially regulate glucose transporters at the proximal tubule brush border membrane. Exp. Physiol. 2016, 101, 731–742. [Google Scholar] [CrossRef]
- Wang, X.X.; Levi, J.; Luo, Y.; Myakala, K.; Herman-Edelstein, M.; Qiu, L.; Wang, D.; Peng, Y.; Grenz, A.; Lucia, S.; et al. SGLT2 Protein Expression Is Increased in Human Diabetic Nephropathy: SGLT2 protein inhibition decreases renal lipid accumulation, inflammation, and the development of nephropathy in diabetic mice. J. Biol. Chem. 2017, 292, 5335–5348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Solini, A.; Rossi, C.; Mazzanti, C.M.; Proietti, A.; Koepsell, H.; Ferrannini, E. Sodium-glucose co-transporter (SGLT)2 and SGLT1 renal expression in patients with type 2 diabetes. Diabetes Obes. Metab. 2017, 19, 1289–1294. [Google Scholar] [CrossRef] [PubMed]
- Helliwell, P.A.; Richardson, M.; Affleck, J.; Kellett, G.L. Stimulation of fructose transport across the intestinal brush-border membrane by PMA is mediated by GLUT2 and dynamically regulated by protein kinase C. Biochem. J. 2000, 350 Pt 1, 149–154. [Google Scholar] [CrossRef] [PubMed]
- Helliwell, P.A.; Rumsby, M.G.; Kellett, G.L. Intestinal sugar absorption is regulated by phosphorylation and turnover of protein kinase C betaII mediated by phosphatidylinositol 3-kinase- and mammalian target of rapamycin-dependent pathways. J. Biol. Chem. 2003, 278, 28644–28650. [Google Scholar] [CrossRef] [Green Version]
- Kellett, G.L.; Helliwell, P.A. The diffusive component of intestinal glucose absorption is mediated by the glucose-induced recruitment of GLUT2 to the brush-border membrane. Biochem. J. 2000, 350 Pt 1, 155–162. [Google Scholar] [CrossRef] [PubMed]
- Cohen, M.; Kitsberg, D.; Tsytkin, S.; Shulman, M.; Aroeti, B.; Nahmias, Y. Live imaging of GLUT2 glucose-dependent trafficking and its inhibition in polarized epithelial cysts. Open Biol. 2014, 4. [Google Scholar] [CrossRef] [Green Version]
- Umino, H.; Hasegawa, K.; Minakuchi, H.; Muraoka, H.; Kawaguchi, T.; Kanda, T.; Tokuyama, H.; Wakino, S.; Itoh, H. High Basolateral Glucose Increases Sodium-Glucose Cotransporter 2 and Reduces Sirtuin-1 in Renal Tubules through Glucose Transporter-2 Detection. Sci. Rep. 2018, 8, 6791. [Google Scholar] [CrossRef] [Green Version]
- Meyer, C.; Stumvoll, M.; Nadkarni, V.; Dostou, J.; Mitrakou, A.; Gerich, J. Abnormal renal and hepatic glucose metabolism in type 2 diabetes mellitus. J. Clin. Investig. 1998, 102, 619–624. [Google Scholar] [CrossRef]
- Chang, A.Y.; Schneider, D.I. Rate of gluconeogenesis and levels of gluconeogenic enzymes in liver and kidney of diabetic and normal Chinese hamsters. Biochim. Biophys. Acta 1970, 222, 587–592. [Google Scholar] [CrossRef]
- Triscari, J.; Stern, J.S.; Johnson, P.R.; Sullivan, A.C. Carbohydrate metabolism in lean and obese Zucker rats. Metab. Clin. Exp. 1979, 28, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Derlacz, R.A.; Hyc, K.; Usarek, M.; Jagielski, A.K.; Drozak, J.; Jarzyna, R. PPAR-gamma-independent inhibitory effect of rosiglitazone on glucose synthesis in primary cultured rabbit kidney-cortex tubules. Biochem. Cell Biol. = Biochim. Biol. Cell. 2008, 86, 396–404. [Google Scholar] [CrossRef] [PubMed]
- Meyer, C.; Woerle, H.J.; Dostou, J.M.; Welle, S.L.; Gerich, J.E. Abnormal renal, hepatic, and muscle glucose metabolism following glucose ingestion in type 2 diabetes. Am. J. Physiology. Endocrinol. Metab. 2004, 287, E1049–E1056. [Google Scholar] [CrossRef] [PubMed]
- Seyer, P.; Vallois, D.; Poitry-Yamate, C.; Schutz, F.; Metref, S.; Tarussio, D.; Maechler, P.; Staels, B.; Lanz, B.; Grueter, R.; et al. Hepatic glucose sensing is required to preserve beta cell glucose competence. J. Clin. Investig. 2013, 123, 1662–1676. [Google Scholar] [CrossRef] [Green Version]
- Burcelin, R.; del Carmen Munoz, M.; Guillam, M.T.; Thorens, B. Liver hyperplasia and paradoxical regulation of glycogen metabolism and glucose-sensitive gene expression in GLUT2-null hepatocytes. Further evidence for the existence of a membrane-based glucose release pathway. J. Biol. Chem. 2000, 275, 10930–10936. [Google Scholar] [CrossRef] [Green Version]
- Sullivan, M.A.; Forbes, J.M. Glucose and glycogen in the diabetic kidney: Heroes or villains? EBioMedicine 2019, 47, 590–597. [Google Scholar] [CrossRef] [Green Version]
- Guillemain, G.; Loizeau, M.; Pincon-Raymond, M.; Girard, J.; Leturque, A. The large intracytoplasmic loop of the glucose transporter GLUT2 is involved in glucose signaling in hepatic cells. J. Cell Sci. 2000, 113 Pt 5, 841–847. [Google Scholar] [CrossRef] [PubMed]
- Guillemain, G.; Munoz-Alonso, M.J.; Cassany, A.; Loizeau, M.; Faussat, A.M.; Burnol, A.F.; Leturque, A. Karyopherin alpha2: A control step of glucose-sensitive gene expression in hepatic cells. Biochem. J. 2002, 364, 201–209. [Google Scholar] [CrossRef]
- Cassany, A.; Guillemain, G.; Klein, C.; Dalet, V.; Brot-Laroche, E.; Leturque, A. A karyopherin alpha2 nuclear transport pathway is regulated by glucose in hepatic and pancreatic cells. Traffic 2004, 5, 10–19. [Google Scholar] [CrossRef]
- Kohler, M.; Buchwalow, I.B.; Alexander, G.; Christiansen, M.; Shagdarsuren, E.; Samoilova, V.; Hartmann, E.; Mervaala, E.M.; Haller, H. Increased importin alpha protein expression in diabetic nephropathy. Kidney Int. 2001, 60, 2263–2273. [Google Scholar] [CrossRef]
- Daignan-Fornier, B.; Pinson, B. 5-Aminoimidazole-4-carboxamide-1-beta-D-ribofuranosyl 5’-Monophosphate (AICAR), a Highly Conserved Purine Intermediate with Multiple Effects. Metabolites 2012, 2, 292–302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Habib, S.L.; Yadav, A.; Kidane, D.; Weiss, R.H.; Liang, S. Novel protective mechanism of reducing renal cell damage in diabetes: Activation AMPK by AICAR increased NRF2/OGG1 proteins and reduced oxidative DNA damage. Cell Cycle 2016, 15, 3048–3059. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, T.; Ke, Q.; Fang, Y.; Wen, P.; Chen, H.; Yuan, Q.; Luo, J.; Zhang, Y.; Sun, Q.; Lv, Y.; et al. Sodium-glucose cotransporter 2 inhibition suppresses HIF-1alpha-mediated metabolic switch from lipid oxidation to glycolysis in kidney tubule cells of diabetic mice. Cell Death Dis. 2020, 11, 390. [Google Scholar] [CrossRef] [PubMed]
- Lan, R.; Geng, H.; Singha, P.K.; Saikumar, P.; Bottinger, E.P.; Weinberg, J.M.; Venkatachalam, M.A. Mitochondrial Pathology and Glycolytic Shift during Proximal Tubule Atrophy after Ischemic AKI. J. Am. Soc. Nephrol. JASN 2016, 27, 3356–3367. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Liu, H.; Takagi, S.; Nitta, K.; Kitada, M.; Srivastava, S.P.; Takagaki, Y.; Kanasaki, K.; Koya, D. Renal protective effects of empagliflozin via inhibition of EMT and aberrant glycolysis in proximal tubules. JCI Insight 2020, 5, e129034. [Google Scholar] [CrossRef] [Green Version]
- Grgic, I.; Campanholle, G.; Bijol, V.; Wang, C.; Sabbisetti, V.S.; Ichimura, T.; Humphreys, B.D.; Bonventre, J.V. Targeted proximal tubule injury triggers interstitial fibrosis and glomerulosclerosis. Kidney Int. 2012, 82, 172–183. [Google Scholar] [CrossRef] [Green Version]
- Han, Y.; Xiong, S.; Zhao, H.; Yang, S.; Yang, M.; Zhu, X.; Jiang, N.; Xiong, X.; Gao, P.; Wei, L.; et al. Lipophagy deficiency exacerbates ectopic lipid accumulation and tubular cells injury in diabetic nephropathy. Cell Death Dis. 2021, 12, 1031. [Google Scholar] [CrossRef]
- Jeong, H.Y.; Kang, J.M.; Jun, H.H.; Kim, D.J.; Park, S.H.; Sung, M.J.; Heo, J.H.; Yang, D.H.; Lee, S.H.; Lee, S.Y. Chloroquine and amodiaquine enhance AMPK phosphorylation and improve mitochondrial fragmentation in diabetic tubulopathy. Sci. Rep. 2018, 8, 8774. [Google Scholar] [CrossRef]
- Muratsubaki, S.; Kuno, A.; Tanno, M.; Miki, T.; Yano, T.; Sugawara, H.; Shibata, S.; Abe, K.; Ishikawa, S.; Ohno, K.; et al. Suppressed autophagic response underlies augmentation of renal ischemia/reperfusion injury by type 2 diabetes. Sci. Rep. 2017, 7, 5311. [Google Scholar] [CrossRef] [Green Version]
- Sohn, M.; Kim, K.; Uddin, M.J.; Lee, G.; Hwang, I.; Kang, H.; Kim, H.; Lee, J.H.; Ha, H. Delayed treatment with fenofibrate protects against high-fat diet-induced kidney injury in mice: The possible role of AMPK autophagy. Am. J. Physiology. Ren. Physiol. 2017, 312, F323–F334. [Google Scholar] [CrossRef]
- Udi, S.; Hinden, L.; Earley, B.; Drori, A.; Reuveni, N.; Hadar, R.; Cinar, R.; Nemirovski, A.; Tam, J. Proximal Tubular Cannabinoid-1 Receptor Regulates Obesity-Induced CKD. J. Am. Soc. Nephrol. JASN 2017, 28, 3518–3532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jang, H.S.; Noh, M.R.; Kim, J.; Padanilam, B.J. Defective Mitochondrial Fatty Acid Oxidation and Lipotoxicity in Kidney Diseases. Front. Med. 2020, 7, 65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huss, J.M.; Levy, F.H.; Kelly, D.P. Hypoxia inhibits the peroxisome proliferator-activated receptor alpha/retinoid X receptor gene regulatory pathway in cardiac myocytes: A mechanism for O2-dependent modulation of mitochondrial fatty acid oxidation. J. Biol. Chem. 2001, 276, 27605–27612. [Google Scholar] [CrossRef] [Green Version]
- Belanger, A.J.; Luo, Z.; Vincent, K.A.; Akita, G.Y.; Cheng, S.H.; Gregory, R.J.; Jiang, C. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor alpha/retinoid X receptor. Biochem. Biophys. Res. Commun. 2007, 364, 567–572. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Ma, Z.; Zhao, C.; Wang, Y.; Wu, G.; Xiao, J.; McClain, C.J.; Li, X.; Feng, W. HIF-1alpha and HIF-2alpha are critically involved in hypoxia-induced lipid accumulation in hepatocytes through reducing PGC-1alpha-mediated fatty acid beta-oxidation. Toxicol. Lett. 2014, 226, 117–123. [Google Scholar] [CrossRef] [PubMed]
- Lardeux, B.R.; Heydrick, S.J.; Mortimore, G.E. RNA degradation in perfused rat liver as determined from the release of [14C]cytidine. J. Biol. Chem. 1987, 262, 14507–14513. [Google Scholar] [CrossRef]
- Ahuja, S.; Cahill, J.; Hartfield, K.; Whorton, M.R. Inhibition of CMP-sialic acid transport by endogenous 5-methyl CMP. PLoS ONE 2021, 16, e0249905. [Google Scholar] [CrossRef]
- Thakur, K.; Tomar, S.K.; Singh, A.K.; Mandal, S.; Arora, S. Riboflavin and health: A review of recent human research. Crit. Rev. Food Sci. Nutr. 2017, 57, 3650–3660. [Google Scholar] [CrossRef]
- Orozco, J.M.; Krawczyk, P.A.; Scaria, S.M.; Cangelosi, A.L.; Chan, S.H.; Kunchok, T.; Lewis, C.A.; Sabatini, D.M. Dihydroxyacetone phosphate signals glucose availability to mTORC1. Nat. Metab. 2020, 2, 893–901. [Google Scholar] [CrossRef]
- Hoxhaj, G.; Locasale, J.W.; Ben-Sahra, I. A spoonful of DHAP keeps mTORC1 running on sugars. Nat. Metab. 2020, 2, 801–802. [Google Scholar] [CrossRef]
- Inoki, K.; Zhu, T.; Guan, K.L. TSC2 mediates cellular energy response to control cell growth and survival. Cell 2003, 115, 577–590. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gwinn, D.M.; Shackelford, D.B.; Egan, D.F.; Mihaylova, M.M.; Mery, A.; Vasquez, D.S.; Turk, B.E.; Shaw, R.J. AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol. Cell 2008, 30, 214–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takashima, M.; Ogawa, W.; Emi, A.; Kasuga, M. Regulation of SREBP1c expression by mTOR signaling in hepatocytes. Kobe J. Med. Sci. 2009, 55, E45–E52. [Google Scholar] [PubMed]
- Yecies, J.L.; Zhang, H.H.; Menon, S.; Liu, S.; Yecies, D.; Lipovsky, A.I.; Gorgun, C.; Kwiatkowski, D.J.; Hotamisligil, G.S.; Lee, C.H.; et al. Akt stimulates hepatic SREBP1c and lipogenesis through parallel mTORC1-dependent and independent pathways. Cell Metab. 2011, 14, 21–32. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Ogawa, W.; Emi, A.; Hayashi, K.; Senga, Y.; Nomura, K.; Hara, K.; Yu, D.; Kasuga, M. Role of S6K1 in regulation of SREBP1c expression in the liver. Biochem. Biophys. Res. Commun. 2011, 412, 197–202. [Google Scholar] [CrossRef]
- Foufelle, F.; Ferre, P. New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: A role for the transcription factor sterol regulatory element binding protein-1c. Biochem. J. 2002, 366, 377–391. [Google Scholar] [CrossRef] [Green Version]
- Guillet-Deniau, I.; Pichard, A.L.; Kone, A.; Esnous, C.; Nieruchalski, M.; Girard, J.; Prip-Buus, C. Glucose induces de novo lipogenesis in rat muscle satellite cells through a sterol-regulatory-element-binding-protein-1c-dependent pathway. J. Cell Sci. 2004, 117, 1937–1944. [Google Scholar] [CrossRef] [Green Version]
- Horton, J.D.; Shah, N.A.; Warrington, J.A.; Anderson, N.N.; Park, S.W.; Brown, M.S.; Goldstein, J.L. Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc. Natl. Acad. Sci. USA 2003, 100, 12027–12032. [Google Scholar] [CrossRef] [Green Version]
- Castillo, J.J.; Jelinek, D.; Wei, H.; Gannon, N.P.; Vaughan, R.A.; Horwood, L.J.; Meaney, F.J.; Garcia-Smith, R.; Trujillo, K.A.; Heidenreich, R.A.; et al. The Niemann-Pick C1 gene interacts with a high-fat diet to promote weight gain through differential regulation of central energy metabolism pathways. Am. J. Physiol. Endocrinol. Metab. 2017, 313, E183–E194. [Google Scholar] [CrossRef] [Green Version]
- Duvel, K.; Yecies, J.L.; Menon, S.; Raman, P.; Lipovsky, A.I.; Souza, A.L.; Triantafellow, E.; Ma, Q.; Gorski, R.; Cleaver, S.; et al. Activation of a metabolic gene regulatory network downstream of mTOR complex 1. Mol. Cell 2010, 39, 171–183. [Google Scholar] [CrossRef]
- Im, S.S.; Kang, S.Y.; Kim, S.Y.; Kim, H.I.; Kim, J.W.; Kim, K.S.; Ahn, Y.H. Glucose-stimulated upregulation of GLUT2 gene is mediated by sterol response element-binding protein-1c in the hepatocytes. Diabetes 2005, 54, 1684–1691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Czerska, M.; Mikolajewska, K.; Zielinski, M.; Gromadzinska, J.; Wasowicz, W. Today’s oxidative stress markers. Med. Pr. 2015, 66, 393–405. [Google Scholar] [CrossRef] [PubMed]
- Gus’kov, E.P.; Kletskii, M.E.; Kornienko, I.V.; Olekhnovich, L.P.; Chistyakov, V.A.; Shkurat, T.P.; Prokof’ev, V.N.; Zhdanov, Y. Allantoin as a free-radical scavenger. Doklady. Biochem. Biophys. 2002, 383, 105–107. [Google Scholar] [CrossRef] [PubMed]
- Su, Z.; Ling, X.; Ji, K.; Huang, H.; Liu, X.; Yin, C.; Zhu, H.; Guo, Y.; Mo, Y.; Lu, Y.; et al. 1H NMR-based urinary metabonomic study of the antidiabetic effects of Rubus Suavissimus S. Lee in STZ-induced T1DM rats. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2020, 1158, 122347. [Google Scholar] [CrossRef] [PubMed]
- Moya-Olano, L.; Milne, H.M.; Robinson, J.M.; Hill, J.V.; Frampton, C.M.; Abbott, H.F.; Turner, R.; Kettle, A.J.; Endre, Z.H. Trientine and renin-angiotensin system blockade ameliorate progression of glomerular morphology in hypertensive experimental diabetic nephropathy. Pathol. Int. 2011, 61, 652–661. [Google Scholar] [CrossRef]
- Liu, J.; Wang, C.; Liu, F.; Lu, Y.; Cheng, J. Metabonomics revealed xanthine oxidase-induced oxidative stress and inflammation in the pathogenesis of diabetic nephropathy. Anal. Bioanal. Chem. 2015, 407, 2569–2579. [Google Scholar] [CrossRef]
- Hopp, K.; Kleczko, E.K.; Gitomer, B.Y.; Chonchol, M.; Klawitter, J.; Christians, U.; Klawitter, J. Metabolic reprogramming in a slowly developing orthologous model of polycystic kidney disease. Am. J. Physiol. Ren. Physiol. 2022, 322, F258–F267. [Google Scholar] [CrossRef]
- Yan, L.J. NADH/NAD+ Redox Imbalance and Diabetic Kidney Disease. Biomolecules 2021, 11, 730. [Google Scholar] [CrossRef]
- Su, K.H.; Dai, C. mTORC1 senses stresses: Coupling stress to proteostasis. BioEssays News Rev. Mol. Cell. Dev. Biol. 2017, 39, 1600268. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Yang, X.; Zhang, J. Bridges between mitochondrial oxidative stress, ER stress and mTOR signaling in pancreatic beta cells. Cell. Signal. 2016, 28, 1099–1104. [Google Scholar] [CrossRef]
- Koyanagi, M.; Asahara, S.; Matsuda, T.; Hashimoto, N.; Shigeyama, Y.; Shibutani, Y.; Kanno, A.; Fuchita, M.; Mikami, T.; Hosooka, T.; et al. Ablation of TSC2 enhances insulin secretion by increasing the number of mitochondria through activation of mTORC1. PLoS ONE 2011, 6, e23238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yasuda-Yamahara, M.; Kume, S.; Maegawa, H. Roles of mTOR in Diabetic Kidney Disease. Antioxidants 2021, 10, 321. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Nakano, D.; Guan, Y.; Hitomi, H.; Uemura, A.; Masaki, T.; Kobara, H.; Sugaya, T.; Nishiyama, A. A sodium-glucose cotransporter 2 inhibitor attenuates renal capillary injury and fibrosis by a vascular endothelial growth factor-dependent pathway after renal injury in mice. Kidney Int. 2018, 94, 524–535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Joost, H.G.; Thorens, B. The extended GLUT-family of sugar/polyol transport facilitators: Nomenclature, sequence characteristics, and potential function of its novel members (review). Mol. Membr. Biol. 2001, 18, 247–256. [Google Scholar] [CrossRef]
- Zhang, A.; Nakano, D.; Kittikulsuth, W.; Yamashita, Y.; Nishiyama, A. Luseogliflozin, a SGLT2 Inhibitor, Does Not Affect Glucose Uptake Kinetics in Renal Proximal Tubules of Live Mice. Int. J. Mol. Sci. 2021, 22, 8169. [Google Scholar] [CrossRef]
- Schmidl, S.; Ursu, O.; Iancu, C.V.; Oreb, M.; Oprea, T.I.; Choe, J.Y. Identification of new GLUT2-selective inhibitors through in silico ligand screening and validation in eukaryotic expression systems. Sci. Rep. 2021, 11, 13751. [Google Scholar] [CrossRef]
- Pliszka, M.; Szablewski, L. Glucose Transporters as a Target for Anticancer Therapy. Cancers 2021, 13, 4184. [Google Scholar] [CrossRef]
- Morrice, N.; van Aalten, L.; McNeilly, A.; McCrimmon, R.J.; Pearson, E.R.; Langston, R.; Sutherland, C. Reducing Glut2 throughout the body does not result in cognitive behaviour differences in aged male mice. BMC Res. Notes 2020, 13, 438. [Google Scholar] [CrossRef]
- Huang, X.; Ma, Y.; Li, Y.; Han, F.; Lin, W. Targeted Drug Delivery Systems for Kidney Diseases. Front. Bioeng. Biotechnol. 2021, 9, 683247. [Google Scholar] [CrossRef]
- Choi, H.S.; Ipe, B.I.; Misra, P.; Lee, J.H.; Bawendi, M.G.; Frangioni, J.V. Tissue- and organ-selective biodistribution of NIR fluorescent quantum dots. Nano Lett. 2009, 9, 2354–2359. [Google Scholar] [CrossRef]
- Sun, X.; Yan, X.; Jacobson, O.; Sun, W.; Wang, Z.; Tong, X.; Xia, Y.; Ling, D.; Chen, X. Improved Tumor Uptake by Optimizing Liposome Based RES Blockade Strategy. Theranostics 2017, 7, 319–328. [Google Scholar] [CrossRef]
- Kilkenny, C.; Browne, W.; Cuthill, I.C.; Emerson, M.; Altman, D.G.; Group, N.C.R.R.G.W. Animal research: Reporting in vivo experiments: The ARRIVE guidelines. Br. J. Pharmacol. 2010, 160, 1577–1579. [Google Scholar] [CrossRef]
- Rubera, I.; Poujeol, C.; Bertin, G.; Hasseine, L.; Counillon, L.; Poujeol, P.; Tauc, M. Specific Cre/Lox recombination in the mouse proximal tubule. J. Am. Soc. Nephrol. JASN 2004, 15, 2050–2056. [Google Scholar] [CrossRef] [Green Version]
- Mackay, G.M.; Zheng, L.; van den Broek, N.J.; Gottlieb, E. Analysis of Cell Metabolism Using LC-MS and Isotope Tracers. Methods Enzym. 2015, 561, 171–196. [Google Scholar] [CrossRef]
- Pietzke, M.; Vazquez, A. Metabolite AutoPlotter—An application to process and visualise metabolite data in the web browser. Cancer Metab. 2020, 8, 15. [Google Scholar] [CrossRef]
Model | Animal | Protein Levels | mRNA Levels | Used Method for Evaluation | Reference |
---|---|---|---|---|---|
Acute STZ-induced Diabetes | Rat | N/A | Slightly increased | qISH | [42] |
Chronic STZ-induced Diabetes | Rat | N/A | 5-fold increase | qISH | [42] |
2/3/4 weeks uncontrolled STZ-induced Diabetes | Rat (isolated PTs) | increased | increased | NB, WB | [43] |
Alloxan-induced Diabetes | Rat | N/A | Two-fold increase | NB | [40] |
Alloxan-induced Diabetes (10/20 days) | Rat | increased | increased | NB, WB | [44] |
Alloxan-induced Diabetes (with glucosuria) | Rat | ~100% increase | ~100% increase | NB, WB | [45] |
Zucker Diabetic rats | Rat (isolated PTs) | increased | increased | WB, Slot-blot | [46] |
STZ-induced DM | Rat | increased | increased | Immuno-blot, NB | [47] |
HEPTECs isolated from type-2-Diabetic patients | Human | increased | increased | qPCR, WB | [48] |
STZ-induced Diabetes | Rat | increased | N/A | WB, IHC | [49] |
STZ-induced Diabetes | Rat | increased | N/A | WB | [50] |
STZ-induced Diabetes | Mouse | increased | N/A | IHC | [36] |
Diabetic human KPTCs | Human | increased | N/A | IHC | [36] |
Akita Diabetic mice | Mouse | increased | increased | IHC, WB, RT-PCR | [36] |
Goto-Kakizaki (GK)T2D rats | Rat (purified renal BBM) | increased | N/A | WB | [51] |
STZ-induced T1D rats | Rat (purified renal BBM) | increased | N/A | WB | [51] |
HFD/JFD-induced insulin resistance | Rat (purified renal BBM) | increased | N/A | WB | [51] |
db/db mice (T2D) | Mouse | N/A | increased | RT-PCR | [52] |
Renal tissue of T2D patients with preserved kidney function, (unilateral nephrectomy for renal carcinoma) | Human | N/A | Slightly reduced | RT-PCR | [53] |
KPTCs treated with HG | Human | increased | N/A | WB, IF | [37] |
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
Acaa2 | CAGAGGTGGAAAGCTGCTAA | GCATGGTCTGTTTGCCTTTC |
Acadm | CAGCCAATGATGTGTGCTTAC | CATACTCGTCACCCTTCTTCTC |
Cnr1 | AAGTCGATCTTAGACGGCCTT | TCCTAATTTGGATGCCATGTCTC |
Cnr2 | CTGCAGCTCTTGGGACCTAC | TGTCCCAGAAGACTGGGTGT |
Cpt1a | CCGTGAGGAACTCAAACCTATT | CAGGGATGCGGGAAGTATTG |
Dagla | GTCCTGCCAGCTATCTTCCTC | CGTGTGGGTTATAGACCAAGC |
Daglb | AGCGACGACTTGGTGTTCC | GCTGAGCAAGACTCCACCG |
Echs1 | GGACTGTTACTCCAGCAAGTTC | CCCACCAAGAGCATAACCATT |
Faah | GTATCGCCAGTCCGTCATTG | GCCTATACCCTTTTTCATGCCC |
Hadh | CCAAGAAGGGAATTGAGGAGAG | ACAAACTCATCTCCAGCCTTAG |
Hif1a | TTGCTTTGATGTGGATAGCGATA | CATACTTGGAGGGCTTGGAGAAT |
Mgll | ACCATGCTGTGATGCTCTCTG | CAAACGCCTCGGGGATAACC |
Napepld | ACGTCCTCCTCTAGTCTGTAATC | AGCGCCAAGCTATCAGTATCC |
Ubc | GCCCAGTGTTACCACCAAGA | CCCATCACACCCAAGAACA |
Analyte | Molecular Ion [M + H]+ [m/z] | Fragment [m/z] | DP [Volts] | CE [Volts] | CXP [Volts] |
---|---|---|---|---|---|
2-AG | 379.2 | 287.1 (quantifier) | 70 | 19 | 14 |
91 (qualifier) | 70 | 67 | 10 | ||
AEA | 348.2 | 287.1 (quantifier) | 26 | 13 | 16 |
62 (qualifier) | 26 | 13 | 8 | ||
d4-AEA | 352.3 | 287.1 (quantifier) | 66 | 15 | 20 |
66 (qualifier) | 66 | 21 | 8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmad, M.; Abramovich, I.; Agranovich, B.; Nemirovski, A.; Gottlieb, E.; Hinden, L.; Tam, J. Kidney Proximal Tubule GLUT2—More than Meets the Eye. Cells 2023, 12, 94. https://doi.org/10.3390/cells12010094
Ahmad M, Abramovich I, Agranovich B, Nemirovski A, Gottlieb E, Hinden L, Tam J. Kidney Proximal Tubule GLUT2—More than Meets the Eye. Cells. 2023; 12(1):94. https://doi.org/10.3390/cells12010094
Chicago/Turabian StyleAhmad, Majdoleen, Ifat Abramovich, Bella Agranovich, Alina Nemirovski, Eyal Gottlieb, Liad Hinden, and Joseph Tam. 2023. "Kidney Proximal Tubule GLUT2—More than Meets the Eye" Cells 12, no. 1: 94. https://doi.org/10.3390/cells12010094
APA StyleAhmad, M., Abramovich, I., Agranovich, B., Nemirovski, A., Gottlieb, E., Hinden, L., & Tam, J. (2023). Kidney Proximal Tubule GLUT2—More than Meets the Eye. Cells, 12(1), 94. https://doi.org/10.3390/cells12010094