The Metabolic Changes between Monolayer (2D) and Three-Dimensional (3D) Culture Conditions in Human Mesenchymal Stem/Stromal Cells Derived from Adipose Tissue
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Isolation and Culture
2.2. Mesodermal Lineage Differentiation
2.3. Flow Cytometry
2.4. ASC and DFAT Spheroid Formation
2.5. Life-Dead Staining
2.6. Immunofluorescence Staining and Imaging of Ki67 Expression
2.7. Quantitative RT-PCR Analysis
2.8. Mitochondrial Content
2.9. mtDNA/nDNA Ratio
2.10. Metabolic Phenotype
2.11. Lactate Concentration
2.12. Reactive Oxygen Species Production
2.13. Western Blot Analysis
2.14. ATP Content
2.15. Statistical Analysis
3. Results
3.1. ASCs and DFATs Characteristics
3.1.1. Properties of Mesenchymal Stem Cells
3.1.2. Morphology and Spheroid Diameter
3.1.3. Cell Viability
3.1.4. Proliferation Potential
3.1.5. Stemness-Related Transcriptional Factors (SRTF) Expression
3.2. Mitochondrial Content
3.3. Metabolic Phenotype
3.4. The Reactive Oxygen Species and Lactate Production
3.5. Oxidative Phosphorylation Subunits Protein Levels
3.6. ATP Content
3.7. The Gene Expression of Main Glycolytic Enzymes
3.8. The Protein Levels of Glycolytic Enzymes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| ASCs | Adipose Derived Stem/Stromal Cells |
| DFATs | Dedifferentiated Fat Cells |
| ECAR | Extracellular Acidification Rate |
| FCCP | Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone |
| G6PD | Gene encoding: Glucose-6-Phosphate Dehydrogenase |
| LDHA | Gene encoding: Lactate Dehydrogenase |
| MSCs | Mesenchymal Stem/Stromal Cells |
| NANOG | Homebx Protein |
| OCR | Oxygen Consumption Rate |
| OCT3/4 | Octamer-Binding Transcription factor |
| OXPHOS | Oxidative Phosphorylation |
| PDHA | Gene encoding: Pyruvate dehydrogenase |
| PFK-1 | Phosphofructokinase 1 |
| PFK-2 | Phosphofructokinase 2 |
| PFKFB3 | Gene encoding: fructose-2,6-biphosphatase 3 |
| PFKM | Gene encoding: 6-phosphofructokinase |
| REX1 | Zinc Finger Protein 42 Homolog |
| RT | Room Temperature |
| SRTF | Stemness Related Transcriptional Factors |
References
- Li, J.; Liu, Y.; Zhang, Y.; Yao, B.; Enhejirigala, B.; Li, Z.; Song, W.; Wang, Y.; Duan, X.; Yuan, X.; et al. Biophysical and Biochemical Cues of Biomaterials Guide Mesenchymal Stem Cell Behaviors. Front. Cell Dev. Biol. 2021, 9, 640388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sobacchi, C.; Erreni, M.; Strina, D.; Palagano, E.; Villa, A.; Menale, C. 3D bone biomimetic scaffolds for basic and translational studies with mesenchymal stem cells. Int. J. Mol. Sci. 2018, 19, 3150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Libro, R.; Bramanti, P.; Mazzon, E. The combined strategy of mesenchymal stem cells and tissue-engineered scaffolds for spinal cord injury regeneration (Review). Exp. Ther. Med. 2017, 14, 3355–3368. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Ding, Y.; Liu, Z.; Liang, X. Senescence in Mesenchymal Stem Cells: Functional Alterations, Molecular Mechanisms, and Rejuvenation Strategies. Front. Cell Dev. Biol. 2020, 8, 258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kusuma, G.D.; Carthew, J.; Lim, R.; Frith, J.E. Effect of the Microenvironment on Mesenchymal Stem Cell Paracrine Signaling: Opportunities to Engineer the Therapeutic Effect. Stem Cells Dev. 2017, 26, 617–631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dromard, C.; Bourin, P.; André, M.; De Barros, S.; Casteilla, L.; Planat-Benard, V. Human adipose derived stroma/stem cells grow in serum-free medium as floating spheres. Exp. Cell Res. 2011, 317, 770–780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryu, N.E.; Lee, S.H.; Park, H. Spheroid Culture System Methods and Applications for Mesenchymal Stem Cells. Cells 2019, 8, 1620. [Google Scholar] [CrossRef] [Scilit]
- Griffin, K.H.; Fok, S.W.; Kent Leach, J. Strategies to capitalize on cell spheroid therapeutic potential for tissue repair and disease modeling. npj Regen. Med. 2022, 7, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Muñoz, N.; Tsai, A.C.; Logan, T.M.; Ma, T. Metabolic Reconfiguration Supports Reacquisition of Primitive Phenotype in Human Mesenchymal Stem Cell Aggregates. Stem Cells 2017, 35, 398–410. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Chen, H.; Li, H.; Wu, Y. 3D culture increases pluripotent gene expression in mesenchymal stem cells through relaxation of cytoskeleton tension. J. Cell. Mol. Med. 2017, 21, 1073–1084. [Google Scholar] [CrossRef] [Scilit]
- Kaminska, A.; Wedzinska, A.; Kot, M.; Sarnowska, A. Effect of Long-Term 3D Spheroid Culture on WJ-MSC. Cells 2021, 10, 719. [Google Scholar] [CrossRef] [Scilit]
- Cheng, N.-C.; Chen, S.-Y.; Li, J.-R.; Young, T.-H. Short-Term Spheroid Formation Enhances the Regenerative Capacity of Adipose-Derived Stem Cells by Promoting Stemness, Angiogenesis, and Chemotaxis. Stem Cells Transl. Med. 2013, 2, 584–594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Potapova, I.A.; Gaudette, G.R.; Brink, P.R.; Robinson, R.B.; Rosen, M.R.; Cohen, I.S.; Doronin, S.V. Mesenchymal Stem Cells Support Migration, Extracellular Matrix Invasion, Proliferation, and Survival of Endothelial Cells In Vitro. Stem Cells 2007, 25, 1761–1768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamaguchi, Y.; Ohno, J.; Sato, A.; Kido, H.; Fukushima, T. Mesenchymal stem cell spheroids exhibit enhanced in-vitro and in-vivo osteoregenerative potential. BMC Biotechnol. 2014, 14, 105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murphy, K.C.; Whitehead, J.; Falahee, P.C.; Zhou, D.; Simon, S.I.; Leach, J.K. Multifactorial Experimental Design to Optimize the Anti-Inflammatory and Proangiogenic Potential of Mesenchymal Stem Cell Spheroids. Stem Cells 2017, 35, 1493–1504. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.; Yun, H.W.; Park, D.Y.; Choi, B.H.; Min, B.H. Three-Dimensional Spheroid Culture Increases Exosome Secretion from Mesenchymal Stem Cells. Tissue Eng. Regen. Med. 2018, 15, 427–436. [Google Scholar] [CrossRef] [Scilit]
- Cha, J.M.; Shin, E.K.; Sung, J.H.; Moon, G.J.; Kim, E.H.; Cho, Y.H.; Park, H.D.; Bae, H.; Kim, J.; Bang, O.Y. Efficient scalable production of therapeutic microvesicles derived from human mesenchymal stem cells. Sci. Rep. 2018, 8, 1171. [Google Scholar] [CrossRef] [Scilit]
- Bhang, S.H.; Lee, S.; Shin, J.Y.; Lee, T.J.; Kim, B.S. Transplantation of cord blood mesenchymal stem cells as spheroids enhances vascularization. Tissue Eng.-Part A 2012, 18, 2138–2147. [Google Scholar] [CrossRef] [Scilit]
- Park, I.S.; Rhie, J.W.; Kim, S.H. A novel three-dimensional adipose-derived stem cell cluster for vascular regeneration in ischemic tissue. Cytotherapy 2014, 16, 508–522. [Google Scholar] [CrossRef] [Scilit]
- Murphy, K.C.; Fang, S.Y.; Leach, J.K. Human mesenchymal stem cell spheroids in fibrin hydrogels exhibit improved cell survival and potential for bone healing. Cell Tissue Res. 2014, 357, 91–99. [Google Scholar] [CrossRef] [Scilit]
- Suenaga, H.; Furukawa, K.S.; Suzuki, Y.; Takato, T.; Ushida, T. Bone regeneration in calvarial defects in a rat model by implantation of human bone marrow-derived mesenchymal stromal cell spheroids. J. Mater. Sci. Mater. Med. 2015, 26, 254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, S.; Muneta, T.; Tsuji, K.; Ichinose, S.; Makino, H.; Umezawa, A.; Sekiya, I. Properties and usefulness of aggregates of synovial mesenchymal stem cells as a source for cartilage regeneration. Arthritis Res. Ther. 2012, 14, R136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, E.M.; Joo, Y.H.; Choe, A.R.; Park, Y.; Tae, C.H.; Hong, J.T.; Moon, C.M.; Kim, S.E.; Jung, H.K.; Shim, K.N.; et al. Three-dimensional culture method enhances the therapeutic efficacies of tonsil-derived mesenchymal stem cells in murine chronic colitis model. Sci. Rep. 2021, 11, 19589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Shi, T.; Xu, A.; Zhang, L. 3D spheroid culture enhances survival and therapeutic capacities of MSCs injected into ischemic kidney. J. Cell. Mol. Med. 2016, 20, 1203–1213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, L.; Ge, J.; Zhou, Y.; Wang, S.; Zhao, R.C.H.; Wu, Y. Three-dimensional spheroid-cultured mesenchymal stem cells devoid of embolism attenuate brain stroke injury after intra-arterial injection. Stem Cells Dev. 2014, 23, 978–989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Dong, Y.; Ran, Y.; Zhang, Y.; Wu, B.; Xie, J.; Cao, Y.; Mo, M.; Li, S.; Deng, H.; et al. Three-dimensional cultured mesenchymal stem cells enhance repair of ischemic stroke through inhibition of microglia. Stem Cell Res. Ther. 2021, 12, 358. [Google Scholar] [CrossRef] [Scilit]
- Mohyeldin, A.; Garzón-Muvdi, T.; Quiñones-Hinojosa, A. Oxygen in stem cell biology: A critical component of the stem cell niche. Cell Stem Cell 2010, 7, 150–161. [Google Scholar] [CrossRef] [Scilit]
- Yan, W.; Diao, S.; Fan, Z. The role and mechanism of mitochondrial functions and energy metabolism in the function regulation of the mesenchymal stem cells. Stem Cell Res. Ther. 2021, 12, 140. [Google Scholar] [CrossRef] [Scilit]
- Wanet, A.; Arnould, T.; Najimi, M.; Renard, P. Connecting Mitochondria, Metabolism, and Stem Cell Fate. Stem Cells Dev. 2015, 24, 1957–1971. [Google Scholar] [CrossRef] [Scilit]
- Samal, J.R.K.; Rangasami, V.K.; Samanta, S.; Varghese, O.P.; Oommen, O.P. Discrepancies on the Role of Oxygen Gradient and Culture Condition on Mesenchymal Stem Cell Fate. Adv. Healthc. Mater. 2021, 10, 2002058. [Google Scholar] [CrossRef] [Scilit]
- Bahsoun, S.; Coopman, K.; Forsyth, N.R.; Akam, E.C. The Role of Dissolved Oxygen Levels on Human Mesenchymal Stem Cell Culture Success, Regulatory Compliance, and Therapeutic Potential. Stem Cells Dev. 2018, 27, 1303–1321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomecka, E.; Lech, W.; Zychowicz, M.; Sarnowska, A.; Murzyn, M.; Oldak, T.; Domanska-Janik, K.; Buzanska, L.; Rozwadowska, N. Assessment of the neuroprotective and stemness properties of human wharton’s jelly-derived mesenchymal stem cells under variable (5% vs. 21%) aerobic conditions. Cells 2021, 10, 717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Estrada, J.C.; Albo, C.; Benguría, A.; Dopazo, A.; López-Romero, P.; Carrera-Quintanar, L.; Roche, E.; Clemente, E.P.; Enríquez, J.A.; Bernad, A.; et al. Culture of human mesenchymal stem cells at low oxygen tension improves growth and genetic stability by activating glycolysis. Cell Death Differ. 2012, 19, 743–755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vander Heiden, M.G.; DeBerardinis, R.J. Understanding the Intersections between Metabolism and Cancer Biology. Cell 2017, 168, 657–669. [Google Scholar] [CrossRef] [Scilit]
- Ezashi, T.; Das, P.; Roberts, R.M. Low O2 tensions and the prevention of differentiation of hES cells. Proc. Natl. Acad. Sci. 2005, 102, 4783–4788. [Google Scholar] [CrossRef] [Scilit]
- Nit, K.; Tyszka-Czochara, M.; Bobis-Wozowicz, S. Oxygen as a master regulator of human pluripotent stem cell function and metabolism. J. Pers. Med. 2021, 11, 905. [Google Scholar] [CrossRef] [Scilit]
- Lees, J.G.; Cliff, T.S.; Gammilonghi, A.; Ryall, J.G.; Dalton, S.; Gardner, D.K.; Harvey, A.J. Oxygen regulates human pluripotent stem cell metabolic flux. Stem Cells Int. 2019, 2019, 8195614. [Google Scholar] [CrossRef] [Scilit]
- Varum, S.; Rodrigues, A.S.; Moura, M.B.; Momcilovic, O.; Easley IV, C.A.; Ramalho-Santos, J.; van Houten, B.; Schatten, G. Energy metabolism in human pluripotent stem cells and their differentiated counterparts. PLoS ONE 2011, 6, e20914. [Google Scholar] [CrossRef] [Scilit]
- Figiel-dabrowska, A.; Radoszkiewicz, K.; Rybkowska, P.; Krzesniak, N.E.; Sulejczak, D.; Sarnowska, A. Neurogenic and neuroprotective potential of stem/stromal cells derived from adipose tissue. Cells 2021, 10, 1475. [Google Scholar] [CrossRef] [Scilit]
- Watanabe, H.; Goto, S.; Kato, R.; Komiyama, S.; Nagaoka, Y.; Kazama, T.; Yamamoto, C.; Li, Y.; Konuma, N.; Hagikura, K.; et al. The neovascularization effect of dedifferentiated fat cells. Sci. Rep. 2020, 10, 9211. [Google Scholar] [CrossRef] [Scilit]
- Fujimaki, H.; Matsumine, H.; Osaki, H.; Ueta, Y.; Kamei, W.; Shimizu, M.; Hashimoto, K.; Fujii, K.; Kazama, T.; Matsumoto, T.; et al. Dedifferentiated fat cells in polyglycolic acid-collagen nerve conduits promote rat facial nerve regeneration. Regen. Ther. 2019, 11, 240–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adibkia, K.; Ehsani, A.; Jodaei, A.; Fathi, E.; Farahzadi, R.; Barzegar-Jalali, M. Silver nanoparticles induce the cardiomyogenic differentiation of bone marrow derived mesenchymal stem cells via telomere length extension. Beilstein J. Nanotechnol. 2021, 12, 786–797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.; Shaker, M.R.; Lee, E.; Lee, B.; Sun, W. NeuroCore formation during differentiation of neurospheres of mouse embryonic neural stem cells. Stem Cell Res. 2020, 43, 101691. [Google Scholar] [CrossRef] [Scilit]
- Myers, M.B.; Mittelstaedt, R.A.; Heflich, R.H. Using ΦX174 DNA as an exogenous reference for measuring mitochondrial DNA copy number. Biotechniques 2009, 47, 867–869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berȩsewicz, M.; Boratyńska-Jasíska, A.; Charzewski, Ł.; Kawalec, M.; Kabzińska, D.; Kochański, A.; Krzyśko, K.A.; Zabłocka, B. The effect of a novel c.820C>T (Arg274Trp) mutation in the mitofusin 2 gene on fibroblast metabolism and clinical manifestation in a patient. PLoS ONE 2017, 12, e0169999. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Wojtyniak, P.; Boratynska-Jasinska, A.; Serwach, K.; Gruszczynska-Biegala, J.; Zablocka, B.; Jaworski, J.; Kawalec, M. Mitofusin 2 Integrates Mitochondrial Network Remodelling, Mitophagy and Renewal of Respiratory Chain Proteins in Neurons after Oxygen and Glucose Deprivation. Mol. Neurobiol. 2022, 59, 6502–6518. [Google Scholar] [CrossRef] [Scilit]
- Kawalec, M.; Boratyńska-Jasińska, A.; Beresewicz, M.; Dymkowska, D.; Zabłocki, K.; Zabłocka, B. Mitofusin 2 deficiency affects energy metabolism and mitochondrial biogenesis in MEF cells. PLoS ONE 2015, 10, e0134162. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Ma, T. Metabolic regulation of mesenchymal stem cell in expansion and therapeutic application. Biotechnol. Prog. 2015, 31, 468–481. [Google Scholar] [CrossRef] [Scilit]
- Yuan, X.; Logan, T.M.; Ma, T. Metabolism in human mesenchymal stromal cells: A missing link between HMSC biomanufacturing and therapy? Front. Immunol. 2019, 10, 977. [Google Scholar] [CrossRef] [Scilit]
- Bartosh, T.J.; Ylöstalo, J.H.; Mohammadipoor, A.; Bazhanov, N.; Coble, K.; Claypool, K.; Lee, R.H.; Choi, H.; Prockop, D.J. Aggregation of human mesenchymal stromal cells (MSCs) into 3D spheroids enhances their antiinflammatory properties. Proc. Natl. Acad. Sci. USA 2010, 107, 13724–13729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baraniak, P.R.; McDevitt, T.C. Scaffold-free culture of mesenchymal stem cell spheroids in suspension preserves multilineage potential. Cell Tissue Res. 2012, 347, 701–711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Son, Y.B.; Bharti, D.; Kim, S.B.; Jo, C.H.; Bok, E.Y.; Lee, S.L.; Kang, Y.H.; Rho, G.J. Comparison of Pluripotency, Differentiation, and Mitochondrial Metabolism Capacity in Three-Dimensional Spheroid Formation of Dental Pulp-Derived Mesenchymal Stem Cells. Biomed Res. Int. 2021, 2021, 5540877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Egger, D.; Oliveira, A.C.; Mallinger, B.; Hemeda, H.; Charwat, V.; Kasper, C. From 3D to 3D: Isolation of mesenchymal stem/stromal cells into a three-dimensional human platelet lysate matrix. Stem Cell Res. Ther. 2019, 10, 248. [Google Scholar] [CrossRef] [Scilit]
- Aldebs, A.I.; Zohora, F.T.; Nosoudi, N.; Singh, S.P.; Ramirez-Vick, J.E. Effect of Pulsed Electromagnetic Fields on Human Mesenchymal Stem Cells Using 3D Magnetic Scaffolds. Bioelectromagnetics 2020, 41, 175–187. [Google Scholar] [CrossRef] [Scilit]
- Yang, E.; Liu, N.; Tang, Y.; Hu, Y.; Zhang, P.; Pan, C.; Dong, S.; Zhang, Y.; Tang, Z. Generation of neurospheres from human adipose-derived stem cells. Biomed Res. Int. 2015, 2015, 743714. [Google Scholar] [CrossRef] [Scilit]
- Murphy, K.C.; Hung, B.P.; Browne-Bourne, S.; Zhou, D.; Yeung, J.; Genetos, D.C.; Leach, J.K. Measurement of oxygen tension within mesenchymal stem cell spheroids. J. R. Soc. Interface 2017, 14, 20160851. [Google Scholar] [CrossRef] [Scilit]
- Pennock, R.; Bray, E.; Pryor, P.; James, S.; McKeegan, P.; Sturmey, R.; Genever, P. Human cell dedifferentiation in mesenchymal condensates through controlled autophagy. Sci. Rep. 2015, 5, 13113. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Nguyen, A.L.; Shi, S.; Hill, C.; Wilder-Smith, P.; Krasieva, T.B.; Le, A.D. Three-dimensional spheroid culture of human gingiva-derived mesenchymal stem cells enhances mitigation of chemotherapy-induced oral mucositis. Stem Cells Dev. 2012, 21, 937–947. [Google Scholar] [CrossRef] [Scilit]
- Valente, S.; Ciavarella, C.; Hernández-Aguilera, A.; Salvador, F.A.; Buzzi, M.; Joven, J.; Pasquinelli, G. Phenotypic, morphological, and metabolic characterization of vascular-spheres from human vascular mesenchymal stem cells. Microsc. Res. Tech. 2022, 85, 447–459. [Google Scholar] [CrossRef] [Scilit]
- Foo, J.B.; Looi, Q.H.; Chong, P.P.; Hassan, N.H.; Yeo, G.E.C.; Ng, C.Y.; Koh, B.; How, C.W.; Lee, S.H.; Law, J.X. Comparing the Therapeutic Potential of Stem Cells and their Secretory Products in Regenerative Medicine. Stem Cells Int. 2021, 2021, 2616807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, C.-H.; Wang, R.; Wang, Y.; Kung, C.-P.; Weber, J.D.; Patti, G.J. Mitochondrial fusion supports increased oxidative phosphorylation during cell proliferation. Elife 2019, 8, e41351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paliwal, S.; Chaudhuri, R.; Agrawal, A.; Mohanty, S. Regenerative abilities of mesenchymal stem cells through mitochondrial transfer. J. Biomed. Sci. 2018, 25, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shum, L.C.; White, N.S.; Mills, B.N.; De Mesy Bentley, K.L.; Eliseev, R.A. Energy Metabolism in Mesenchymal Stem Cells during Osteogenic Differentiation. Stem Cells Dev. 2016, 25, 114–122. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Marsboom, G.; Toth, P.T.; Rehman, J. Mitochondrial Respiration Regulates Adipogenic Differentiation of Human Mesenchymal Stem Cells. PLoS ONE 2013, 8, e77077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pattappa, G.; Heywood, H.K.; de Bruijn, J.D.; Lee, D.A. The metabolism of human mesenchymal stem cells during proliferation and differentiation. J. Cell. Physiol. 2011, 226, 2562–2570. [Google Scholar] [CrossRef] [Scilit]
- Tsai, A.C.; Liu, Y.; Yuan, X.; Ma, T. Compaction, fusion, and functional activation of three-dimensional human mesenchymal stem cell aggregate. Tissue Eng.-Part A 2015, 21, 1705–1719. [Google Scholar] [CrossRef] [Scilit]
- Zu, X.L.; Guppy, M. Cancer metabolism: Facts, fantasy, and fiction. Biochem. Biophys. Res. Commun. 2004, 313, 459–465. [Google Scholar] [CrossRef] [Scilit]
- Lunt, S.Y.; Vander Heiden, M.G. Aerobic glycolysis: Meeting the metabolic requirements of cell proliferation. Annu. Rev. Cell Dev. Biol. 2011, 27, 441–464. [Google Scholar] [CrossRef] [Scilit]
- Hu, C.; Zhao, L.; Peng, C.; Li, L. Regulation of the mitochondrial reactive oxygen species: Strategies to control mesenchymal stem cell fates ex vivo and in vivo. J. Cell. Mol. Med. 2018, 22, 5196–5207. [Google Scholar] [CrossRef] [Scilit]
- Ki, S.K.; Hae, W.C.; Hee, E.Y.; Ick, Y.K. Reactive oxygen species generated by NADPH oxidase 2 and 4 are required for chondrogenic differentiation. J. Biol. Chem. 2010, 285, 40294–40302. [Google Scholar] [CrossRef] [Scilit]
- Atashi, F.; Modarressi, A.; Pepper, M.S. The role of reactive oxygen species in mesenchymal stem cell adipogenic and osteogenic differentiation: A review. Stem Cells Dev. 2015, 24, 1150–1163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lyublinskaya, O.G.; Borisov, Y.G.; Pugovkina, N.A.; Smirnova, I.S.; Obidina, J.V.; Ivanova, J.S.; Zenin, V.V.; Shatrova, A.N.; Borodkina, A.V.; Aksenov, N.D.; et al. Reactive oxygen species are required for human mesenchymal stem cells to initiate proliferation after the quiescence exit. Oxid. Med. Cell. Longev. 2015, 2015, 502105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Regmi, S.; Raut, P.K.; Pathak, S.; Shrestha, P.; Park, P.H.; Jeong, J.H. Enhanced viability and function of mesenchymal stromal cell spheroids is mediated via autophagy induction. Autophagy 2021, 17, 2991–3010. [Google Scholar] [CrossRef] [Scilit]
- Ng, S.-C.; Ng, H.-H. The metabolic programming of stem cells. Genes Dev. 2017, 31, 336–346. [Google Scholar] [CrossRef]
- Lavrentieva, A.; Majore, I.; Kasper, C.; Hass, R. Effects of hypoxic culture conditions on umbilical cord-derived human mesenchymal stem cells. Cell Commun. Signal. 2010, 8, 18. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, T.; Takano, N.; Ishiwata, K.; Ohmura, M.; Nagahata, Y.; Matsuura, T.; Kamata, A.; Sakamoto, K.; Nakanishi, T.; Kubo, A.; et al. Reduced methylation of PFKFB3 in cancer cells shunts glucose towards the pentose phosphate pathway. Nat. Commun. 2014, 5, 3480. [Google Scholar] [CrossRef] [Scilit]
- Coyle, R.; Yao, J.; Richards, D.; Mei, Y. The Effects of Metabolic Substrate Availability on Human Adipose-Derived Stem Cell Spheroid Survival. Tissue Eng.-Part A 2019, 25, 620–631. [Google Scholar] [CrossRef] [Scilit]
- Jauković, A.; Abadjieva, D.; Trivanović, D.; Stoyanova, E.; Kostadinova, M.; Pashova, S.; Kestendjieva, S.; Kukolj, T.; Jeseta, M.; Kistanova, E.; et al. Specificity of 3D MSC Spheroids Microenvironment: Impact on MSC Behavior and Properties. Stem Cell Rev. Rep. 2020, 16, 853–875. [Google Scholar] [CrossRef] [Scilit]
- Cui, X.; Hartanto, Y.; Zhang, H. Advances in multicellular spheroids formation. J. R. Soc. Interface 2017, 14, 20160877. [Google Scholar] [CrossRef] [Scilit]
- Panopoulos, A.D.; Yanes, O.; Ruiz, S.; Kida, Y.S.; Diep, D.; Tautenhahn, R.; Herrerías, A.; Batchelder, E.M.; Plongthongkum, N.; Lutz, M.; et al. The metabolome of induced pluripotent stem cells reveals metabolic changes occurring in somatic cell reprogramming. Cell Res. 2012, 22, 168–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsogtbaatar, E.; Landin, C.; Minter-Dykhouse, K.; Folmes, C.D.L. Energy Metabolism Regulates Stem Cell Pluripotency. Front. Cell Dev. Biol. 2020, 8, 87. [Google Scholar] [CrossRef] [Scilit] [PubMed]













| Antigen | Source | Isotype | Dilution | Manufacturer | Catalog Number |
|---|---|---|---|---|---|
| Fibronectin | Rabbit polyclonal | IgG | 1:400 | Sigma-Aldrich | F3648 |
| Vimentin | Mouse monoclonal | IgG1 | 1:200 | Dako | M0725 |
| Mitochondrial surface | Mouse monoclonal | IgG | 1:1000 | Merck | MAB1273 |
| Ki67 | Rabbit polyclonal | IgG | 1:200 | Abcam | AB15580 |
| Antigen | Fluorochrome | Isotype | Dilution | Manufacturer | Catalog Number |
|---|---|---|---|---|---|
| Alexa Fluor Goat (anti-rabbit) | Alexa 488 | IgG | 1:1000 | Life Technologies | A11034 |
| Alexa Fluor Goat (anti-mouse) | Alexa 546 | IgG1 | 1:1000 | Life Technologies | A21123 |
| Gene | NCBI Reference Sequence | Product Size | Primer Sequence (5′ -> 3′) |
|---|---|---|---|
| ACTB | NM_001101.5 | 250 bp | F: CATGTACGTTGCTATCCAGGC R: CTCCTTAATGTCACGCACGAT |
| NANOG | NM_024865.4 | 103 bp | F: GAACCTCAGCTACAAACAGG R: CGTCACACCATTGCTATTCT |
| SOX2 | NM_003106.4 | 93 bp | F: GTGGAAACTTTTGTCGGAGA R: TTATAATCCGGGTGCTCCTT |
| OCT3/4 | NM_001285986.2 | 331 bp | F: CCTGAAGCAGAAGAGGATCACC R: AAAGCGGCAGATGGTCGTTTGG |
| REX1 | NM_001304358.2 | 107 bp | F: GCTCCCTTGAATGTTCTTTG R: GCCTGTCATGTACTCAGAAT |
| PFKFB3 | NM_001145443.3 | 124 bp | F: GCTTATGGCTGCCGTGTGGA R: GCGGGGTGACACTATTGCGT |
| G6PDH | NM_001282587.2 | 115 bp | F: GCCACAGAACTCGGGACCTT R: AAGCCTTGCGGTTCTGGTCT |
| LDHA | NM_001135239.2 | 117 bp | F: CTGGATTCAGCCCGATTCCG R: TCCACTCCATACAGGCACACT |
| PDHA | NM_000284.4 | 111 bp | F: CGTCTGTTGAGAGAGCGGCA R: ACCTTGTTGCCTCTCGGACG |
| PFKM | NM_000289.6 | 101 bp | F: ACTCTGCCCTGCATCGGATC R: ACAGTGGCGGCCCATTACTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rybkowska, P.; Radoszkiewicz, K.; Kawalec, M.; Dymkowska, D.; Zabłocka, B.; Zabłocki, K.; Sarnowska, A. The Metabolic Changes between Monolayer (2D) and Three-Dimensional (3D) Culture Conditions in Human Mesenchymal Stem/Stromal Cells Derived from Adipose Tissue. Cells 2023, 12, 178. https://doi.org/10.3390/cells12010178
Rybkowska P, Radoszkiewicz K, Kawalec M, Dymkowska D, Zabłocka B, Zabłocki K, Sarnowska A. The Metabolic Changes between Monolayer (2D) and Three-Dimensional (3D) Culture Conditions in Human Mesenchymal Stem/Stromal Cells Derived from Adipose Tissue. Cells. 2023; 12(1):178. https://doi.org/10.3390/cells12010178
Chicago/Turabian StyleRybkowska, Paulina, Klaudia Radoszkiewicz, Maria Kawalec, Dorota Dymkowska, Barbara Zabłocka, Krzysztof Zabłocki, and Anna Sarnowska. 2023. "The Metabolic Changes between Monolayer (2D) and Three-Dimensional (3D) Culture Conditions in Human Mesenchymal Stem/Stromal Cells Derived from Adipose Tissue" Cells 12, no. 1: 178. https://doi.org/10.3390/cells12010178
APA StyleRybkowska, P., Radoszkiewicz, K., Kawalec, M., Dymkowska, D., Zabłocka, B., Zabłocki, K., & Sarnowska, A. (2023). The Metabolic Changes between Monolayer (2D) and Three-Dimensional (3D) Culture Conditions in Human Mesenchymal Stem/Stromal Cells Derived from Adipose Tissue. Cells, 12(1), 178. https://doi.org/10.3390/cells12010178

