PYL1- and PYL8-like ABA Receptors of Nicotiana benthamiana Play a Key Role in ABA Response in Seed and Vegetative Tissue
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Conditions
2.2. Sample Preparation and RNA-seq Analysis
2.3. CRISPR/Cas9 Vector Construction
2.4. In Vitro Culture for Stable Transformation of N. benthamiana
2.5. Analysis of Edited Genomic DNA and Identification of Mutant Alleles
2.6. ABA Sensitivity in Seedling Establishment Assays
2.7. Root and Shoot Growth Assays
2.8. Expression of NbPYL1b in E. coli, Purification of His-Tagged Protein, and Gel Filtration Analysis
2.9. PP2C Activity Assay
2.10. Measurement of Stomatal Conductance (Gs) and Transpiration Rate (E)
2.11. Statistical Analyses
3. Results
3.1. Genome-Wide Analysis of ABA Receptors in Nb
3.2. RNA-seq Analysis and Target Selection for Genome Editing Using CRISPR/Cas9 Technology
3.3. Biochemical Analysis of NbPYL1b
3.4. Genetic Analysis of NbPYLs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bally, J.; Nakasugi, K.; Jia, F.; Jung, H.; Ho, S.Y.; Wong, M.; Paul, C.M.; Naim, F.; Wood, C.C.; Crowhurst, R.N.; et al. The extremophile Nicotiana benthamiana has traded viral defence for early vigour. Nat. Plants 2015, 1, 15165. [Google Scholar] [CrossRef] [Scilit]
- Bally, J.; Jung, H.; Mortimer, C.; Naim, F.; Philips, J.G.; Hellens, R.; Bombarely, A.; Goodin, M.M.; Waterhouse, P.M. The Rise and Rise of Nicotiana benthamiana: A Plant for All Reasons. Annu. Rev. Phytopathol. 2018, 56, 405–426. [Google Scholar] [CrossRef] [Scilit]
- Schiavinato, M.; Marcet-Houben, M.; Dohm, J.C.; Gabaldon, T.; Himmelbauer, H. Parental origin of the allotetraploid tobacco Nicotiana benthamiana. Plant J. 2020, 102, 541–554. [Google Scholar] [CrossRef] [Scilit]
- Marillonnet, S.; Thoeringer, C.; Kandzia, R.; Klimyuk, V.; Gleba, Y. Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants. Nat. Biotechnol. 2005, 23, 718–723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hahn, S.; Giritch, A.; Bartels, D.; Bortesi, L.; Gleba, Y. A novel and fully scalable Agrobacterium spray-based process for manufacturing cellulases and other cost-sensitive proteins in plants. Plant Biotechnol. J. 2015, 13, 708–716. [Google Scholar] [CrossRef] [Scilit]
- Torti, S.; Schlesier, R.; Thümmler, A.; Bartels, D.; Römer, P.; Koch, B.; Werner, S.; Panwar, V.; Kanyuka, K.; Wirén, N.V.; et al. Transient reprogramming of crop plants for agronomic performance. Nat. Plants. 2021, 7, 159–171. [Google Scholar] [CrossRef] [Scilit]
- Bombarely, A.; Rosli, H.G.; Vrebalov, J.; Moffett, P.; Mueller, L.A.; Martin, G.B. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Mol. Plant Microbe Interact. 2012, 25, 1523–1530. [Google Scholar] [CrossRef] [Scilit]
- Schiavinato, M.; Strasser, R.; Mach, L.; Dohm, J.C.; Himmelbauer, H. Genome and transcriptome characterization of the glycoengineered Nicotiana benthamiana line XT/FT. BMC Genom. 2019, 20, 594. [Google Scholar] [CrossRef] [Scilit]
- Schiavinato, M.; Bodrug-Schepers, A.; Dohm, J.C.; Himmelbauer, H. Subgenome evolution in allotetraploid plants. Plant J. 2021, 106, 672–688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Szostkiewicz, I.; Korte, A.; Moes, D.; Yang, Y.; Christmann, A.; Grill, E. Regulators of PP2C Phosphatase Activity Function as Abscisic Acid Sensors. Science 2009, 324, 1064–1068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, S.Y.; Fung, P.; Nishimura, N.; Jensen, D.R.; Fujii, H.; Zhao, Y.; Lumba, S.; Santiago, J.; Rodrigues, A.; Chow, T.F.F.; et al. Abscisic Acid Inhibits Type 2C Protein Phosphatases via the PYR/PYL Family of START Proteins. Science 2009, 324, 1068–1071. [Google Scholar] [CrossRef] [Scilit]
- Santiago, J.; Dupeux, F.; Round, A.; Antoni, R.; Park, S.Y.; Jamin, M.; Cutler, S.R.; Rodriguez, P.L.; Marquez, J.A. The abscisic acid receptor PYR1 in complex with abscisic acid. Nature 2009, 462, 665–668. [Google Scholar] [CrossRef] [Scilit]
- Nishimura, N.; Sarkeshik, A.; Nito, K.; Park, S.Y.; Wang, A.; Carvalho, P.C.; Lee, S.; Caddell, D.F.; Cutler, S.R.; Chory, J.; et al. PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. Plant J. 2010, 61, 290–299. [Google Scholar] [CrossRef] [Scilit]
- Bai, G.; Xie, H.; Yao, H.; Li, F.; Chen, X.; Zhang, Y.; Xiao, B.; Yang, J.; Li, Y.; Yang, D.H. Genome-wide identification and characterization of ABA receptor PYL/RCAR gene family reveals evolution and roles in drought stress in Nicotiana tabacum. BMC. Genom. 2019, 20, 575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miao, C.; Xiao, L.; Hua, K.; Zou, C.; Zhao, Y.; Bressan, R.A.; Zhu, J.K. Mutations in a subfamily of abscisic acid receptor genes promote rice growth and productivity. Proc. Natl. Acad. Sci. USA 2018, 115, 6058–6063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vazquez-Vilar, M.; Bernabe-Orts, J.M.; Fernandez-Del-Carmen, A.; Ziarsolo, P.; Blanca, J.; Granell, A.; Orzaez, D. A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Plant Methods 2016, 12, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarrion-Perdigones, A.; Vazquez-Vilar, M.; Palací, J.; Castelijns, B.; Forment, J.; Ziarsolo, P.; Blanca, J.; Granell, A.; Orzaez, D. GoldenBraid 2.0: A comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol. 2013, 162, 1618–1631. [Google Scholar] [CrossRef] [Scilit]
- Lloyd, A.M.; Barnason, A.R.; Rogers, S.G.; Byrne, M.C.; Fraley, R.T.; Horsch, R.B. Transformation of Arabidopsis thaliana with Agrobacterium tumefaciens. Science 1986, 234, 464–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vazquez-Vilar, M.; Garcia-Carpintero, V.; Selma, S.; Bernabé-Orts, J.M.; Sanchez-Vicente, J.; Salazar-Sarasua, B.; Ressa, A.; de Paola, C.; Ajenjo, M.; Quintela, J.C.; et al. The GB4.0 Platform, an All-In-One Tool for CRISPR/Cas-Based Multiplex Genome Engineering in Plants. Front. Plant Sci. 2021, 12, 689937. [Google Scholar] [CrossRef] [Scilit]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef] [Scilit]
- Vaidya, A.S.; Peterson, F.C.; Yarmolinsky, D.; Merilo, E.; Verstraeten, I.; Park, S.Y.; Elzinga, D.; Kaundal, A.; Helander, J.; Lozano-Juste, J.; et al. A Rationally Designed Agonist Defines Subfamily IIIA Abscisic Acid Receptors As Critical Targets for Manipulating Transpiration. ACS Chem. Biol. 2017, 12, 2842–2848. [Google Scholar] [CrossRef] [Scilit]
- Nebauer, S.G.; Sanchez, M.; Martinez, L.; Lluch, Y.; Renau-Morata, B.; Molina, R.V. Differences in photosynthetic performance and its correlation with growth among tomato cultivars in response to different salts. Plant Physiol. Biochem. 2013, 63, 61–69. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Guzman, M.; Rodriguez, L.; Lorenzo-Orts, L.; Pons, C.; Sarrion-Perdigones, A.; Fernandez, M.A.; Peirats-Llobet, M.; Forment, J.; Moreno-Alvero, M.; Cutler, S.R.; et al. Tomato PYR/PYL/RCAR abscisic acid receptors show high expression in root, differential sensitivity to the abscisic acid agonist quinabactin, and the capability to enhance plant drought resistance. J. Exp. Bot. 2014, 65, 4451–4464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruiz-Partida, R.; Rosario, S.M.; Lozano-Juste, J. An Update on Crop ABA Receptors. Plants 2021, 10, 1087. [Google Scholar] [CrossRef] [Scilit]
- Melcher, K.; Ng, L.M.; Zhou, X.E.; Soon, F.F.; Xu, Y.; Suino-Powell, K.M.; Park, S.Y.; Weiner, J.J.; Fujii, H.; Chinnusamy, V.; et al. A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors. Nature 2009, 462, 602–608. [Google Scholar] [CrossRef] [Scilit]
- Miyazono, K.; Miyakawa, T.; Sawano, Y.; Kubota, K.; Kang, H.J.; Asano, A.; Miyauchi, Y.; Takahashi, M.; Zhi, Y.; Fujita, Y.; et al. Structural basis of abscisic acid signalling. Nature 2009, 462, 609–614. [Google Scholar] [CrossRef] [Scilit]
- Nishimura, N.; Hitomi, K.; Arvai, A.S.; Rambo, R.P.; Hitomi, C.; Cutler, S.R.; Schroeder, J.I.; Getzoff, E.D. Structural mechanism of abscisic acid binding and signaling by dimeric PYR1. Science 2009, 326, 1373–1379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, P.; Fan, H.; Hao, Q.; Yuan, X.; Wu, D.; Pang, Y.; Yan, C.; Li, W.; Wang, J.; Yan, N. Structural insights into the mechanism of abscisic acid signaling by PYL proteins. Nat. Struct. Mol. Biol. 2009, 16, 1230–1236. [Google Scholar] [CrossRef] [Scilit]
- Santiago, J.; Dupeux, F.; Betz, K.; Antoni, R.; Gonzalez-Guzman, M.; Rodriguez, L.; Marquez, J.A.; Rodriguez, P.L. Structural insights into PYR/PYL/RCAR ABA receptors and PP2Cs. Plant Sci. 2012, 182, 3–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antoni, R.; Gonzalez-Guzman, M.; Rodriguez, L.; Peirats-Llobet, M.; Pizzio, G.A.; Fernandez, M.A.; De Winne, N.; De Jaeger, G.; Dietrich, D.; Bennett, M.J.; et al. PYRABACTIN RESISTANCE1-LIKE8 plays an important role for the regulation of abscisic acid signaling in root. Plant Physiol. 2013, 161, 931–941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Y.; Xing, L.; Wang, X.; Hou, Y.J.; Gao, J.; Wang, P.; Duan, C.G.; Zhu, X.; Zhu, J.K. The ABA receptor PYL8 promotes lateral root growth by enhancing MYB77-dependent transcription of auxin-responsive genes. Sci. Signal. 2014, 7, ra53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Y.; Chan, Z.; Gao, J.; Xing, L.; Cao, M.; Yu, C.; Hu, Y.; You, J.; Shi, H.; Zhu, Y.; et al. ABA receptor PYL9 promotes drought resistance and leaf senescence. Proc. Natl. Acad. Sci. USA 2016, 113, 1949–1954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belda-Palazon, B.; Gonzalez-Garcia, M.P.; Lozano-Juste, J.; Coego, A.; Antoni, R.; Julian, J.; Peirats-Llobet, M.; Rodriguez, L.; Berbel, A.; Dietrich, D.; et al. PYL8 mediates ABA perception in the root through non-cell-autonomous and ligand-stabilization-based mechanisms. Proc. Natl. Acad. Sci. USA 2018, 115, E11857–E11863. [Google Scholar] [CrossRef] [Scilit]
- Dittrich, M.; Mueller, H.M.; Bauer, H.; Peirats-Llobet, M.; Rodriguez, P.L.; Geilfus, C.M.; Carpentier, S.C.; Al Rasheid, K.A.S.; Kollist, H.; Merilo, E.; et al. The role of Arabidopsis ABA receptors from the PYR/PYL/RCAR family in stomatal acclimation and closure signal integration. Nat. Plants 2019, 5, 1002–1011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Andrade, J.; Gonzlez, B.; Gonzalez-Guzman, M.; Rodriguez, P.L.; Vera, P. The Role of ABA in Plant Immunity is Mediated through the PYR1 Receptor. Int. J. Mol. Sci. 2020, 21, 5852. [Google Scholar] [CrossRef] [Scilit]
- Pri-Tal, O.; Shaar-Moshe, L.; Wiseglass, G.; Peleg, Z.; Mosquna, A. Non-redundant functions of the dimeric ABA receptor BdPYL1 in the grass Brachypodium. Plant J. 2017, 92, 774–786. [Google Scholar] [CrossRef] [Scilit]
- Bai, G.; Yang, D.H.; Zhao, Y.; Ha, S.; Yang, F.; Ma, J.; Gao, X.S.; Wang, Z.M.; Zhu, J.K. Interactions between soybean ABA receptors and type 2C protein phosphatases. Plant Mol. Biol. 2013, 83, 651–664. [Google Scholar] [CrossRef] [Scilit]
- Orman-Ligeza, B.; Morris, E.C.; Parizot, B.; Lavigne, T.; Babe, A.; Ligeza, A.; Klein, S.; Sturrock, C.; Xuan, W.; Novak, O.; et al. The Xerobranching Response Represses Lateral Root Formation When Roots Are Not in Contact with Water. Curr. Biol. 2018, 28, 3165–3173. [Google Scholar] [CrossRef] [Scilit]
- Mustilli, A.C.; Merlot, S.; Vavasseur, A.; Fenzi, F.; Giraudat, J. Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 2002, 14, 3089–3099. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Guzman, M.; Pizzio, G.A.; Antoni, R.; Vera-Sirera, F.; Merilo, E.; Bassel, G.W.; Fernandez, M.A.; Holdsworth, M.J.; Perez-Amador, M.A.; Kollist, H.; et al. Arabidopsis PYR/PYL/RCAR Receptors Play a Major Role in Quantitative Regulation of Stomatal Aperture and Transcriptional Response to Abscisic Acid. Plant Cell 2012, 24, 2483–2496. [Google Scholar] [CrossRef] [Scilit]
- Pouryahya, F.; Sankoff, D. Peripheral structures in unlabelled trees and the accumulation of subgenomes in the evolution of polyploids. J. Theor. Biol. 2022, 532, 110924. [Google Scholar] [CrossRef] [Scilit]
- Mandazoka, T.; Lysak, M.A. Post-polyploid diploidization and diversification through dysploid changes. Curr. Opin. Plant Biol. 2018, 42, 55–65. [Google Scholar]
- Kiedrzynski, M.; Zielińska, K.M.; Jedrzejczyk, I.; Kiedrzyńska, E.; Tomczyk, P.P.; Rewicz, A.; Rewers, M.; Indreica, A.; Bednarska, I.; Stupar, V.; et al. Tetraploids expanded beyond the mountain niche of their diploid ancestors in the mixed-ploidy grass Festuca amethystina L. Sci. Rep. 2021, 11, 18735. [Google Scholar] [CrossRef] [Scilit]
- Sivager, G.; Calvez, L.; Bruyere, S.; Boisne-Noc, R.; Brat, P.; Gros, O.; Ollitrault, P.; Morillon, R. Specific Physiological and Anatomical Traits Associated with Polyploidy and Better Detoxification Processes Contribute to Improved Huanglongbing Tolerance of the Persian Lime Compared with the Mexican Lime. Front. Plant Sci. 2021, 12, 685679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barcelo-Anguiano, M.; Holbrook, N.M.; Hormaza, J.I.; Losada, J.M. Changes in ploidy affect vascular allometry and hydraulic function in Mangifera indica trees. Plant J. 2021, 108, 541–554. [Google Scholar] [CrossRef] [Scilit]
- Van der Peer, Y.; Ashman, T.L.; Soltis, P.S.; Soltis, D.E. Polyploidy: An evolutionary and ecological force in stressful times. Plant Cell 2021, 33, 11–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stuttmann, J.; Barthel, K.; Martin, P.; Ordon, J.; Erickson, J.L.; Herr, R.; Ferik, F.; Kretschmer, C.; Berner, T.; Keilwagen, J.; et al. Highly efficient multiplex editing: One-shot generation of 8× Nicotiana benthamiana and 12× Arabidopsis mutants. Plant J. 2021, 106, 8–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Allele | Mutation | Location in CDS |
|---|---|---|
| pyl1a-1 | (+1) C | 165/678 |
| pyl1a-2 | (Δ24) CACTGAGTTCCACACCTACCGAGT | 150/678 |
| pyl1b-1 | (+1) C | 165/678 |
| pyl1b-2 | (Δ1) C | 165/678 |
| pyl8a-1 | (+1) T | 46/528 |
| pyl8a-2 | (Δ2) GA | 46/528 |
| pyl8b-1 | (+1) T | 46/528 |
| pyl8c-1 | (+1) G | 69/558 |
| pyl8c-2 | (Δ4) GGAG | 69/558 |
| PYL1a | PYL1b | PYL8a | PYL8b | PYL8c | |||||
|---|---|---|---|---|---|---|---|---|---|
| High-Order Mutant | pyl1a-1 | pyl1a-2 | pyl1b-1 | pyl1b-2 | pyl8a-1 | pyl8a-2 | pyl8b-1 | pyl8c-1 | pyl8c-2 |
| pyl1b pyl8a pyl8b pyl8c | BA | BA | HOM | HOM | BA | BA | |||
| pyl1b pyl8a pyl8b | BA | BA | HOM | HOM | |||||
| pyl1a pyl8a pyl8b | HOM | HOM | HOM | ||||||
| pyl1a pyl1b pyl8a pyl8b | HOM | HOM | HOM | HOM | |||||
| gs | E | T Leaf | |||||
|---|---|---|---|---|---|---|---|
| Mock | WT | 0.100 | 2.1 | 25.9 | |||
| 1a 8a 8b | 0.110 | 2.3 | 25.7 | ||||
| 1b 8a 8b | 0.106 | 2.2 | 25.8 | ||||
| 1b 8a 8b 8c | 0.103 | 2.0 | 25.9 | ||||
| NS | NS | NS | |||||
| ABA | WT | 0.057 | * | 1.3 | * | 26.2 | * |
| 1a 8a 8b | 0.054 | * | 1.2 | * | 26.3 | * | |
| 1b 8a 8b | 0.053 | * | 1.2 | * | 26.3 | * | |
| 1b 8a 8b 8c | 0.061 | * | 1.4 | * | 26.2 | * | |
| NS | NS | NS |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pizzio, G.A.; Mayordomo, C.; Lozano-Juste, J.; Garcia-Carpintero, V.; Vazquez-Vilar, M.; Nebauer, S.G.; Kaminski, K.P.; Ivanov, N.V.; Estevez, J.C.; Rivera-Moreno, M.; et al. PYL1- and PYL8-like ABA Receptors of Nicotiana benthamiana Play a Key Role in ABA Response in Seed and Vegetative Tissue. Cells 2022, 11, 795. https://doi.org/10.3390/cells11050795
Pizzio GA, Mayordomo C, Lozano-Juste J, Garcia-Carpintero V, Vazquez-Vilar M, Nebauer SG, Kaminski KP, Ivanov NV, Estevez JC, Rivera-Moreno M, et al. PYL1- and PYL8-like ABA Receptors of Nicotiana benthamiana Play a Key Role in ABA Response in Seed and Vegetative Tissue. Cells. 2022; 11(5):795. https://doi.org/10.3390/cells11050795
Chicago/Turabian StylePizzio, Gaston A., Cristian Mayordomo, Jorge Lozano-Juste, Victor Garcia-Carpintero, Marta Vazquez-Vilar, Sergio G. Nebauer, Kacper P. Kaminski, Nikolai V. Ivanov, Juan C. Estevez, Maria Rivera-Moreno, and et al. 2022. "PYL1- and PYL8-like ABA Receptors of Nicotiana benthamiana Play a Key Role in ABA Response in Seed and Vegetative Tissue" Cells 11, no. 5: 795. https://doi.org/10.3390/cells11050795
APA StylePizzio, G. A., Mayordomo, C., Lozano-Juste, J., Garcia-Carpintero, V., Vazquez-Vilar, M., Nebauer, S. G., Kaminski, K. P., Ivanov, N. V., Estevez, J. C., Rivera-Moreno, M., Albert, A., Orzaez, D., & Rodriguez, P. L. (2022). PYL1- and PYL8-like ABA Receptors of Nicotiana benthamiana Play a Key Role in ABA Response in Seed and Vegetative Tissue. Cells, 11(5), 795. https://doi.org/10.3390/cells11050795

