CRC Therapy Identifies Indian Hedgehog Signaling in Mouse Endometrial Epithelial Cells and Inhibition of Ihh-KLF9 as a Novel Strategy for Treating IUA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Mouse IUA Model and Cells Transplantation
2.3. Masson’s Trichrome (MT) Staining
2.4. RNA Extraction, qRT-PCR, and RNA Sequencing Analysis
2.5. Generation of Ihh CRISPR/Cas9 and mCherry Lenti-Viral Particles
2.6. Viral Infection and Selection of Ihh−/−CRCs
2.7. Immunohistochemical (IHC) and Immunofluorescent (IF) Analysis
2.8. Cell Transfection
2.9. Western Blotting Assay
2.10. Luciferase Reporter Assay
2.11. IUA Mice Treated with Vismodegib
2.12. Breeding Study with VismodegibTreatment
2.13. Statistical Analysis
3. Results
3.1. CRC Transplantation Promotes the Endometrial Restoration in IUA Mice
3.2. Transcriptome Analysis Reveals Hub Genes and Ihh and KLF9 Axis in the Endometrial Restoration in IUA Mice
3.3. Unexpected and Different Roles of Ihh Signaling in CRC Proliferation In Vitro and IUA Repair in Mice
3.4. Ihh-KLF9-PR Signaling Pathway Mediated Regulation of ER/PR Balance in CRCs, Aberrant Activation in the Restoration of Injured Endometrium
3.5. Vismodegib Restores the Normal Microenvironment, Morphology, and Structure of Endometrium in IUA Mice
3.6. Vismodegib Treatment Improves Pregnancy Rate in IUA Mice
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Turco, M.Y.; Gardner, L.; Hughes, J.; Cindrova-Davies, T.; Gomez, M.J.; Farrell, L.; Hollinshead, M.; Marsh, S.G.E.; Brosens, J.J.; Critchley, H.O.; et al. Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nat. Cell Biol. 2017, 19, 568–577. [Google Scholar] [CrossRef]
- Critchley, H.O.D.; Maybin, J.A.; Armstrong, G.M.; Williams, A.R.W. Physiology of the Endometrium and Regulation of Menstruation. Physiol. Rev. 2020, 100, 1149–1179. [Google Scholar] [CrossRef] [PubMed]
- Oehler, M.K.; Rees, M.C.; Bicknell, R. Steroids and the endometrium. Curr. Med. Chem. 2000, 7, 543–560. [Google Scholar] [CrossRef] [PubMed]
- DeMayo, F.J.; Lydon, J.P. 90 YEARS OF PROGESTERONE: New insights into progesterone receptor signaling in the endometrium required for embryo implantation. J. Mol. Endocrinol. 2020, 65, T1–T14. [Google Scholar] [CrossRef] [PubMed]
- Dreisler, E.; Kjer, J.J. Asherman’s syndrome: Current perspectives on diagnosis and management. Int. J. Womens Health 2019, 11, 191–198. [Google Scholar] [CrossRef] [PubMed]
- Alawadhi, F.; Du, H.; Cakmak, H.; Taylor, H.S. Bone Marrow-Derived Stem Cell (BMDSC) transplantation improves fertility in a murine model of Asherman’s syndrome. PLoS ONE 2014, 9, e96662. [Google Scholar] [CrossRef]
- Yu, D.; Wong, Y.M.; Cheong, Y.; Xia, E.; Li, T.C. Asherman syndrome--one century later. Fertil. Steril. 2008, 89, 759–779. [Google Scholar] [CrossRef]
- Healy, M.W.; Schexnayder, B.; Connell, M.T.; Terry, N.; DeCherney, A.H.; Csokmay, J.M.; Yauger, B.J.; Hill, M.J. Intrauterine adhesion prevention after hysteroscopy: A systematic review and meta-analysis. Am. J. Obstet. Gynecol. 2016, 215, 267–275.e267. [Google Scholar] [CrossRef]
- Bosteels, J.; Weyers, S.; D’Hooghe, T.M.; Torrance, H.; Broekmans, F.J.; Chua, S.J.; Mol, B.W.J. Anti-adhesion therapy following operative hysteroscopy for treatment of female subfertility. Cochrane Database Syst. Rev. 2017, 11, Cd011110. [Google Scholar] [CrossRef] [Green Version]
- March, C.M. Management of Asherman’s syndrome. Reprod. Biomed. Online 2011, 23, 63–76. [Google Scholar] [CrossRef]
- Kaitu’u-Lino, T.J.; Ye, L.; Gargett, C.E. Reepithelialization of the uterine surface arises from endometrial glands: Evidence from a functional mouse model of breakdown and repair. Endocrinology 2010, 151, 3386–3395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, T.; Zhao, X.; Sun, H.; Li, X.; Lin, N.; Ding, L.; Dai, J.; Hu, Y. Regeneration of uterine horns in rats using collagen scaffolds loaded with human embryonic stem cell-derived endometrium-like cells. Tissue Eng. Part A 2015, 21, 353–361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Janzen, D.M.; Cheng, D.; Schafenacker, A.M.; Paik, D.Y.; Goldstein, A.S.; Witte, O.N.; Jaroszewicz, A.; Pellegrini, M.; Memarzadeh, S. Estrogen and progesterone together expand murine endometrial epithelial progenitor cells. Stem Cells 2013, 31, 808–822. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xia, S.; Wu, M.; Zhou, X.; Zhang, X.; Ye, L.; Zhang, K.; Kang, Y.; Liu, J.; Zhang, Y.; Wu, W.; et al. Treating intrauterine adhesion using conditionally reprogrammed physiological endometrial epithelial cells. Stem Cell Res. Ther. 2022, 13, 178. [Google Scholar] [CrossRef]
- Abudukeyoumu, A.; Li, M.Q.; Xie, F. Transforming growth factor-beta1 in intrauterine adhesion. Am. J. Reprod. Immunol. 2020, 84, e13262. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Krawczyk, E.; Suprynowicz, F.A.; Palechor-Ceron, N.; Yuan, H.; Dakic, A.; Simic, V.; Zheng, Y.L.; Sripadhan, P.; Chen, C.; et al. Conditional reprogramming and long-term expansion of normal and tumor cells from human biospecimens. Nat. Protoc. 2017, 12, 439–451. [Google Scholar] [CrossRef]
- Mudge, J.M.; Harrow, J. Creating reference gene annotation for the mouse C57BL6/J. genome assembly. Mamm. Genome 2015, 26, 366–378. [Google Scholar] [CrossRef] [Green Version]
- Frankish, A.; Diekhans, M.; Ferreira, A.M.; Johnson, R.; Jungreis, I.; Loveland, J.; Mudge, J.M.; Sisu, C.; Wright, J.; Armstrong, J.; et al. GENCODE reference annotation for the human and mouse genomes. Nucleic Acids Res. 2019, 47, D766–D773. [Google Scholar] [CrossRef] [Green Version]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Zhu, Y.; Yang, Y.; Guo, J.; Dai, Y.; Ye, L.; Qiu, J.; Zeng, Z.; Wu, X.; Xing, Y.; Long, X.; et al. Ex vivo 2D and 3D HSV-2 infection model using human normal vaginal epithelial cells. Oncotarget 2017, 8, 15267–15282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wong, H.; Alicke, B.; West, K.A.; Pacheco, P.; La, H.; Januario, T.; Yauch, R.L.; de Sauvage, F.J.; Gould, S.E. Pharmacokinetic-pharmacodynamic analysis of vismodegib in preclinical models of mutational and ligand-dependent Hedgehog pathway activation. Clin. Cancer Res. 2011, 17, 4682–4692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, M.; Hong, S.; Park, S.; Kim, Y.; Yang, S.; Kim, H.; Noh, S.; Na, S.; Lee, H.; Lim, H.; et al. Perivascular stem cell-derived cyclophilin A improves uterine environment with Asherman’s Syndrome via HIF1a-dependent angiogenesis. Mol. Ther. 2020, 28, 1818. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
- Marioni, J.C.; Mason, C.E.; Mane, S.M.; Stephens, M.; Gilad, Y. RNA-seq: An assessment of technical reproducibility and comparison with gene expression arrays. Genome Res. 2008, 18, 1509–1517. [Google Scholar] [CrossRef] [Green Version]
- Omenetti, A.; Porrello, A.; Jung, Y.; Yang, L.; Popov, Y.; Choi, S.S.; Witek, R.P.; Alpini, G.; Venter, J.; Vandongen, H.M.; et al. Hedgehog signaling regulates epithelial-mesenchymal transition during biliary fibrosis in rodents and humans. J. Clin. Investig. 2008, 118, 3331–3342. [Google Scholar] [CrossRef] [Green Version]
- McConnell, B.B.; Yang, V.W. Mammalian Krüppel-like factors in health and diseases. Physiol. Rev. 2010, 90, 1337–1381. [Google Scholar] [CrossRef] [Green Version]
- Chu, H.W.; Rios, C.; Huang, C.; Wesolowska-Andersen, A.; Burchard, E.G.; O’Connor, B.P.; Fingerlin, T.E.; Nichols, D.; Reynolds, S.D.; Seibold, M.A. CRISPR-Cas9-mediated gene knockout in primary human airway epithelial cells reveals a proinflammatory role for MUC18. Gene Ther. 2015, 22, 822–829. [Google Scholar] [CrossRef] [Green Version]
- Franco, H.L.; Lee, K.Y.; Broaddus, R.R.; White, L.D.; Lanske, B.; Lydon, J.P.; Jeong, J.W.; DeMayo, F.J. Ablation of Indian hedgehog in the murine uterus results in decreased cell cycle progression, aberrant epidermal growth factor signaling, and increased estrogen signaling. Biol. Reprod. 2010, 82, 783–790. [Google Scholar] [CrossRef] [Green Version]
- Lee, K.; Jeong, J.; Kwak, I.; Yu, C.T.; Lanske, B.; Soegiarto, D.W.; Toftgard, R.; Tsai, M.J.; Tsai, S.; Lydon, J.P.; et al. Indian hedgehog is a major mediator of progesterone signaling in the mouse uterus. Nat. Genet. 2006, 38, 1204–1209. [Google Scholar] [CrossRef]
- Sigafoos, A.N.; Paradise, B.D.; Fernandez-Zapico, M.E. Hedgehog/GLI Signaling Pathway: Transduction, Regulation, and Implications for Disease. Cancers 2021, 13, 3410. [Google Scholar] [CrossRef] [PubMed]
- Velarde, M.C.; Zeng, Z.; McQuown, J.R.; Simmen, F.A.; Simmen, R.C. Kruppel-like factor 9 is a negative regulator of ligand-dependent estrogen receptor alpha signaling in Ishikawa endometrial adenocarcinoma cells. Mol. Endocrinol. 2007, 21, 2988–3001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mote, P.A.; Arnett-Mansfield, R.L.; Gava, N.; deFazio, A.; Mulac-Jericevic, B.; Conneely, O.M.; Clarke, C.L. Overlapping and distinct expression of progesterone receptors A and B in mouse uterus and mammary gland during the estrous cycle. Endocrinology 2006, 147, 5503–5512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ace, C.I.; Okulicz, W.C. Differential gene regulation by estrogen and progesterone in the primate endometrium. Mol. Cell Endocrinol. 1995, 115, 95–103. [Google Scholar] [CrossRef]
- Evans-Hoeker, E.A.; Young, S.L. Endometrial receptivity and intrauterine adhesive disease. Semin. Reprod. Med. 2014, 32, 392–401. [Google Scholar] [CrossRef]
- Wang, Y.; Han, C.; Lu, L.; Magliato, S.; Wu, T. Hedgehog signaling pathway regulates autophagy in human hepatocellular carcinoma cells. Hepatology 2013, 58, 995–1010. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Peng, Y.; Xia, Q.; Yan, D.; Zhang, H.; Zhang, L.; Chen, Y.; Zhao, X.; Li, J. Decreased Indian hedgehog signaling activates autophagy in endometriosis and adenomyosis. Reproduction 2021, 161, 99–109. [Google Scholar] [CrossRef]
- Takamoto, N.; Zhao, B.; Tsai, S.Y.; DeMayo, F.J. Identification of Indian hedgehog as a progesterone-responsive gene in the murine uterus. Mol. Endocrinol. 2002, 16, 2338–2348. [Google Scholar] [CrossRef] [Green Version]
- Matsumoto, H.; Zhao, X.; Das, S.K.; Hogan, B.L.; Dey, S.K. Indian hedgehog as a progesterone-responsive factor mediating epithelial-mesenchymal interactions in the mouse uterus. Dev. Biol. 2002, 245, 280–290. [Google Scholar] [CrossRef]
- Lin, S.C.; Li, Y.H.; Wu, M.H.; Chang, Y.F.; Lee, D.K.; Tsai, S.Y.; Tsai, M.J.; Tsai, S.J. Suppression of COUP-TFII by proinflammatory cytokines contributes to the pathogenesis of endometriosis. J. Clin. Endocrinol. Metab. 2014, 99, E427–E437. [Google Scholar] [CrossRef]
- Simmen, R.C.; Heard, M.E.; Simmen, A.M.; Montales, M.T.; Marji, M.; Scanlon, S.; Pabona, J.M. The Kruppel-like factors in female reproductive system pathologies. J. Mol. Endocrinol. 2015, 54, R89–R101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Simmen, R.C.; Eason, R.R.; McQuown, J.R.; Linz, A.L.; Kang, T.J.; Chatman, L., Jr.; Till, S.R.; Fujii-Kuriyama, Y.; Simmen, F.A.; Oh, S.P. Subfertility, uterine hypoplasia, and partial progesterone resistance in mice lacking the Kruppel-like factor 9/basic transcription element-binding protein-1 (Bteb1) gene. J. Biol. Chem. 2004, 279, 29286–29294. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, D.; Zhang, X.L.; Michel, F.J.; Blum, J.L.; Simmen, F.A.; Simmen, R.C. Direct interaction of the Kruppel-like family (KLF) member, BTEB1, and PR mediates progesterone-responsive gene expression in endometrial epithelial cells. Endocrinology 2002, 143, 62–73. [Google Scholar] [CrossRef] [PubMed]
- Chang, A.L.; Solomon, J.A.; Hainsworth, J.D.; Goldberg, L.; McKenna, E.; Day, B.M.; Chen, D.M.; Weiss, G.J. Expanded access study of patients with advanced basal cell carcinoma treated with the Hedgehog pathway inhibitor, vismodegib. J. Am.Acad. Dermatol. 2014, 70, 60–69. [Google Scholar] [CrossRef] [Green Version]
- LoRusso, P.M.; Rudin, C.M.; Reddy, J.C.; Tibes, R.; Weiss, G.J.; Borad, M.J.; Hann, C.L.; Brahmer, J.R.; Chang, I.; Darbonne, W.C.; et al. Phase I trial of hedgehog pathway inhibitor vismodegib (GDC-0449) in patients with refractory, locally advanced or metastatic solid tumors. Clin. Cancer Res. 2011, 17, 2502–2511. [Google Scholar] [CrossRef]
Gene | Sequences (5′-3′) | Amplicon Size (bp) | |
---|---|---|---|
ERα | forward | CCCGCCTTCTACAGGTCTAAT | 76 |
reverse | CTTTCTCGTTACTGCTGGACAG | ||
PR | forward | CTCCGGGACCGAACAGAGT | 128 |
reverse | GCGGGGACAACAACCCTTT | ||
β-actin | forward | GTGACGTTGACATCCGTAAAGA | 245 |
reverse | GCCGGACTCATCGTACTCC | ||
Tgfb-1 | forward | CTTCAATACGTCAGACATTCGGG | 142 |
reverse | GTAACGCCAGGAATTGTTGCTA | ||
Col1a1 | forward | GCTCCTCTTAGGGGCCACT | 91 |
reverse | CCACGTCTCACCATTGGGG | ||
Vimentin | forward | CGGCTGCGAGAGAAATTGC | 124 |
reverse | CCACTTTCCGTTCAAGGTCAAG | ||
Fibronectin | forward | ATGTGGACCCCTCCTGATAGT | 124 |
reverse | GCCCAGTGATTTCAGCAAAGG | ||
Klf9 | forward | GCCGCCTACATGGACTTCG | 139 |
reverse | GGTCACCGTGTTCCTTGGT | ||
Ihh | forward | GACGAGGAGAACACGGGTG | 171 |
reverse | GCGGCCCTCATAGTGTAAAGA | ||
Ptch1 | forward | AAAGAACTGCGGCAAGTTTTTG | 164 |
reverse | CTTCTCCTATCTTCTGACGGGT | ||
Gli1 | forward | CCAAGCCAACTTTATGTCAGGG | 130 |
reverse | AGCCCGCTTCTTTGTTAATTTGA | ||
MUC1 | forward | GGCATTCGGGCTCCTTTCTT | 132 |
reverse | TGGAGTGGTAGTCGATGCTAAG | ||
Ki67 | forward | ATCATTGACCGCTCCTTTAGGT | 104 |
reverse | GCTCGCCTTGATGGTTCCT | ||
Ccnd1 | forward | GCGTACCCTGACACCAATCTC | 183 |
reverse | CTCCTCTTCGCACTTCTGCTC | ||
Itgb3 | forward | GGCGTTGTTGTTGGAGAGTC | 138 |
reverse | CTTCAGGTTACATCGGGGTGA | ||
LIF | forward | ATTGTGCCCTTACTGCTGCTG | 140 |
reverse | GCCAGTTGATTCTTGATCTGGT | ||
PRB | forward | GGTCCCCCTTGCTTGCA | 121 |
reverse | CAGGACCGAGGAAAAAGCAG |
Antibodies | Dilution | Application | Source | Catalog No. |
---|---|---|---|---|
Rabbit anti-Ihh | 1:3000 | Western blotting | abcam | ab39634 |
Rabbit anti-Ihh | 1:100 | Immunofluorescence | abcam | ab52919 |
Mouse anti-GAPDH | 1:5000 | Western blotting | Santa Cruz | sc-365062 |
Mouse anti-β-actin | 1:5000 | Western blotting | Santa Cruz | sc-47778 |
Mouse anti-ERα | 1:200 | Western blotting | Santa Cruz | sc-71064 |
Mouse anti-PR | 1:200 | Western blotting | Santa Cruz | sc-398898 |
Rabbit anti-KLF9 | 1:100 | Immunofluorescence, | abcam | ab227920 |
1:1000 | Western blotting | |||
Rabbit anti-MUC1 | 1:100 | Immunofluorescence | abcam | ab45167 |
Rabbit anti-Ki67 | 1:100 | Immunofluorescence | abcam | ab16667 |
Rabbit anti-ERα | 1:100 | Immunohistochemistry | Proteintech | 21244-1-AP |
Rabbit anti-PR | 1:100 | Immunohistochemistry | CST | #8757 |
Mouse anti-HA | 1:1000 | Western blotting | Santa Cruz | sc-7392 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, X.; Kang, Y.; Chang, Y.; Xia, S.; Wu, M.; Liu, J.; Dong, D.; Zhang, W.; Chen, H.; Li, H. CRC Therapy Identifies Indian Hedgehog Signaling in Mouse Endometrial Epithelial Cells and Inhibition of Ihh-KLF9 as a Novel Strategy for Treating IUA. Cells 2022, 11, 4053. https://doi.org/10.3390/cells11244053
Zhou X, Kang Y, Chang Y, Xia S, Wu M, Liu J, Dong D, Zhang W, Chen H, Li H. CRC Therapy Identifies Indian Hedgehog Signaling in Mouse Endometrial Epithelial Cells and Inhibition of Ihh-KLF9 as a Novel Strategy for Treating IUA. Cells. 2022; 11(24):4053. https://doi.org/10.3390/cells11244053
Chicago/Turabian StyleZhou, Xinhao, Yiyi Kang, Yuntzu Chang, Siyu Xia, Ming Wu, Jun Liu, Dirong Dong, Wei Zhang, Hong Chen, and Hui Li. 2022. "CRC Therapy Identifies Indian Hedgehog Signaling in Mouse Endometrial Epithelial Cells and Inhibition of Ihh-KLF9 as a Novel Strategy for Treating IUA" Cells 11, no. 24: 4053. https://doi.org/10.3390/cells11244053
APA StyleZhou, X., Kang, Y., Chang, Y., Xia, S., Wu, M., Liu, J., Dong, D., Zhang, W., Chen, H., & Li, H. (2022). CRC Therapy Identifies Indian Hedgehog Signaling in Mouse Endometrial Epithelial Cells and Inhibition of Ihh-KLF9 as a Novel Strategy for Treating IUA. Cells, 11(24), 4053. https://doi.org/10.3390/cells11244053