Activation of Neuroprotective Microglia and Astrocytes at the Lesion Site and in the Adjacent Segments Is Crucial for Spontaneous Locomotor Recovery after Spinal Cord Injury
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Spinal Cord Compression
2.3. Analysis of Gene Expression Using RT-PCR
2.4. Behavioral Model (BBB Scale)
2.5. Statistical Analysis
3. Results
3.1. Infammatory Response after SCI
3.2. Neuroprotective Environment after SCI
3.3. Microglia and Astrocyte Phenotypic Polarization and Its Impact on Neurotoxic or Neuroprotetive Functions
3.4. Correlation between Neurological Score and Expression of Neuroprotective Microglia and Astroglia Phenotypes
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jha, M.K.; Kim, J.H.; Song, G.J.; Lee, W.H.; Lee, I.K.; Lee, H.W.; An, S.S.A.; Kim, S.; Suk, K. Functional dissection of astrocyte-secreted proteins: Implications in brain health and diseases. Prog. Neurobiol. 2018, 162, 37–69. [Google Scholar] [CrossRef] [PubMed]
- Filous, A.R.; Silver, J. Targeting astrocytes in CNS injury and disease: A translational research approach. Prog. Neurobiol. 2016, 144, 173–187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liddelow, S.A.; Guttenplan, K.A.; Clarke, L.E.; Bennett, F.C.; Bohlen, C.J.; Schirmer, L.; Bennett, M.L.; Münch, A.E.; Chung, W.S.; Peterson, T.C.; et al. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 2017, 541, 481–487. [Google Scholar] [CrossRef]
- Shinozaki, Y.; Shibata, K.; Yoshida, K.; Shigetomi, E.; Gachet, C.; Ikenaka, K.; Tanaka, K.F.; Koizumi, S. Transformation of Astrocytes to a Neuroprotective Phenotype by Microglia via P2Y1 Receptor Downregulation. Cell Rep. 2017, 19, 1151–1164. [Google Scholar] [CrossRef] [Green Version]
- Jha, M.K.; Jo, M.; Kim, J.H.; Suk, K. Microglia-Astrocyte Crosstalk: An Intimate Molecular Conversation. Neuroscientist 2019, 25, 227–240. [Google Scholar] [CrossRef]
- Füchtbauer, L.; Groth-Rasmussen, M.; Holm, T.H.; Løbner, M.; Toft-Hansen, H.; Khorooshi, R.; Owens, T. Angiotensin II Type 1 receptor (AT1) signaling in astrocytes regulates synaptic degeneration-induced leukocyte entry to the central nervous system. Brain Behav. Immun. 2011, 25, 897–904. [Google Scholar] [CrossRef]
- Haj-Yasein, N.N.; Vindedal, G.F.; Eilert-Olsen, M.; Gundersen, G.A.; Skare, Ø.; Laake, P.; Klungland, A.; Thorén, A.E.; Burkhardt, J.M.; Ottersen, O.P.; et al. Glial-conditional deletion of aquaporin-4 (Aqp4) reduces blood-brain water uptake and confers barrier function on perivascular astrocyte endfeet. Proc. Natl. Acad. Sci. USA 2011, 108, 17815–17820. [Google Scholar] [CrossRef] [Green Version]
- Murai, K.K.; Pasquale, E.B. Eph receptors and ephrins in neuron-astrocyte communication at synapses. Glia 2011, 59, 1567–1578. [Google Scholar] [CrossRef]
- Min, R.; Nevian, T. Astrocyte signaling controls spike timing-dependent depression at neocortical synapses. Nat. Neurosci. 2012, 15, 746–753. [Google Scholar] [CrossRef]
- Murphy-Royal, C.; Dupuis, J.P.; Varela, J.A.; Panatier, A.; Pinson, B.; Baufreton, J.; Groc, L.; Oliet, S.H. Surface diffusion of astrocytic glutamate transporters shapes synaptic transmission. Nat. Neurosci. 2015, 18, 219–226. [Google Scholar] [CrossRef] [PubMed]
- Bradford, J.; Shin, J.Y.; Roberts, M.; Wang, C.E.; Li, X.J.; Li, S. Expression of mutant huntingtin in mouse brain astrocytes causes age-dependent neurological symptoms. Proc. Natl. Acad. Sci. USA 2009, 106, 22480–22485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuchibhotla, K.V.; Lattarulo, C.R.; Hyman, B.T.; Bacskai, B.J. Synchronous hyperactivity and intercellular calcium waves in astrocytes in Alzheimer mice. Science 2009, 323, 1211–1215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wanner, I.B.; Anderson, M.A.; Song, B.; Levine, J.; Fernandez, A.; Gray-Thompson, Z.; Ao, Y.; Sofroniew, M.V. Glial scar borders are formed by newly proliferated, elongated astrocytes that interact to corral inflammatory and fibrotic cells via STAT3-dependent mechanisms after spinal cord injury. J. Neurosci. 2013, 33, 12870–12886. [Google Scholar] [CrossRef] [Green Version]
- Khakh, B.S.; Sofroniew, M.V. Diversity of astrocyte functions and phenotypes in neural circuits. Nat. Neurosci. 2015, 18, 942–952. [Google Scholar] [CrossRef]
- Malik, A.R.; Lips, J.; Gorniak-Walas, M.; Broekaart, D.W.M.; Asaro, A.; Kuffner, M.T.C.; Hoffmann, C.J.; Kikhia, M.; Dopatka, M.; Boehm-Sturm, P.; et al. SorCS2 facilitates release of endostatin from astrocytes and controls post-stroke angiogenesis. Glia 2020, 68, 1304–1316. [Google Scholar] [CrossRef] [Green Version]
- Yang, T.; Dai, Y.; Chen, G.; Cui, S. Dissecting the Dual Role of the Glial Scar and Scar-Forming Astrocytes in Spinal Cord Injury. Front. Cell Neurosci. 2020, 14, 78. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, M.A.; Burda, J.E.; Ren, Y.; Ao, Y.; O’Shea, T.M.; Kawaguchi, R.; Coppola, G.; Khakh, B.S.; Deming, T.J.; Sofroniew, M.V. Astrocyte scar formation aids central nervous system axon regeneration. Nature 2016, 532, 195–200. [Google Scholar] [CrossRef] [Green Version]
- Gu, Y.; Cheng, X.; Huang, X.; Yuan, Y.; Qin, S.; Tan, Z.; Wang, D.; Hu, X.; He, C.; Su, Z. Conditional ablation of reactive astrocytes to dissect their roles in spinal cord injury and repair. Brain Behav. Immun. 2019, 80, 394–405. [Google Scholar] [CrossRef]
- Kigerl, K.A.; Gensel, J.C.; Ankeny, D.P.; Alexander, J.K.; Donnelly, D.J.; Popovich, P.G. Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J. Neurosci. 2009, 29, 13435–13444. [Google Scholar] [CrossRef] [Green Version]
- Gris, D.; Marsh, D.R.; Oatway, M.A.; Chen, Y.; Hamilton, E.F.; Dekaban, G.A.; Weaver, L.C. Transient blockade of the CD11d/CD18 integrin reduces secondary damage after spinal cord injury, improving sensory, autonomic, and motor function. J. Neurosci. 2004, 24, 4043–4051. [Google Scholar] [CrossRef] [Green Version]
- Bimbova, K.; Bacova, M.; Kisucka, A.; Pavel, J.; Galik, J.; Zavacky, P.; Marsala, M.; Stropkovska, A.; Fedorova, J.; Papcunova, S.; et al. A Single Dose of Atorvastatsin Applied Acutely after Spinal Cord Injury Suppresses Inflammation, Apoptosis, and Promotes Axon Outgrowth, Which Might Be Essential for Favorable Functional Outcome. Int. J. Mol. Sci. 2018, 19, 1106. [Google Scholar] [CrossRef] [Green Version]
- Basso, D.M.; Beattie, M.S.; Bresnahan, J.C. A sensitive and reliable locomotor rating scale for open field testing in rats. J. Neurotrauma 1995, 12, 1–21. [Google Scholar] [CrossRef]
- David, S.; Kroner, A. Repertoire of microglial and macrophage responses after spinal cord injury. Nat. Rev. Neurosci. 2011, 12, 388–399. [Google Scholar] [CrossRef]
- Orihuela, R.; McPherson, C.A.; Harry, G.J. Microglial M1/M2 polarization and metabolic states. Br. J. Pharmacol. 2016, 173, 649–665. [Google Scholar] [CrossRef]
- Okada, S.; Hara, M.; Kobayakawa, K.; Matsumoto, Y.; Nakashima, Y. Astrocyte reactivity and astrogliosis after spinal cord injury. Neurosci. Res. 2018, 126, 39–43. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.J.; Jiang, B.C.; Gao, Y.J. Chemokines in neuron-glial cell interaction and pathogenesis of neuropathic pain. Cell Mol. Life Sci. 2017, 74, 3275–3291. [Google Scholar] [CrossRef] [PubMed]
- Takamiya, A.; Takeda, M.; Yoshida, A.; Kiyama, H. Inflammation induces serine protease inhibitor 3 expression in the rat pineal gland. Neuroscience 2002, 113, 387–394. [Google Scholar] [CrossRef]
- Wang, G.; Shi, Y.; Jiang, X.; Leak, R.K.; Hu, X.; Wu, Y.; Pu, H.; Li, W.W.; Tang, B.; Wang, Y.; et al. HDAC inhibition prevents white matter injury by modulating microglia/macrophage polarization through the GSK3β/PTEN/Akt axis. Proc. Natl. Acad. Sci. USA 2015, 112, 2853–2858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, D.S.; Li, C.Y.; Qin, C.; Murugan, M.; Wu, L.J.; Liu, J.L. Deficiency in the voltage-gated proton channel Hv1 increases M2 polarization of microglia and attenuates brain damage from photothrombotic ischemic stroke. J. Neurochem. 2016, 139, 96–105. [Google Scholar] [CrossRef]
- Anderson, C.F.; Mosser, D.M. A novel phenotype for an activated macrophage: The type 2 activated macrophage. J. Leukoc. Biol. 2002, 72, 101–106. [Google Scholar]
- Franco, R.; Fernández-Suárez, D. Alternatively activated microglia and macrophages in the central nervous system. Prog. Neurobiol. 2015, 131, 65–86. [Google Scholar] [CrossRef] [PubMed]
- David, S.; Kroner, A.; Greenhalgh, A.D.; Zarruk, J.G.; López-Vales, R. Myeloid cell responses after spinal cord injury. J. Neuroimmunol. 2018, 321, 97–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bellver-Landete, V.; Bretheau, F.; Mailhot, B.; Vallières, N.; Lessard, M.; Janelle, M.E.; Vernoux, N.; Tremblay, M.È.; Fuehrmann, T.; Shoichet, M.S.; et al. Microglia are an essential component of the neuroprotective scar that forms after spinal cord injury. Nat. Commun. 2019, 10, 518. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hausmann, O.N. Post-traumatic inflammation following spinal cord injury. Spinal Cord 2003, 41, 369–378. [Google Scholar] [CrossRef]
- Bacova, M.; Bimbova, K.; Fedorova, J.; Lukacova, N.; Galik, J. Epidural oscillating field stimulation as an effective therapeutic approach in combination therapy for spinal cord injury. J. Neurosci. Methods 2019, 311, 102–110. [Google Scholar] [CrossRef] [PubMed]
- Malyshev, I.; Malyshev, Y. Current Concept and Update of the Macrophage Plasticity Concept: Intracellular Mechanisms of Reprogramming and M3 Macrophage “Switch” Phenotype. BioMed Res. Int. 2015, 2015, 341308. [Google Scholar] [CrossRef] [Green Version]
- Walker, D.G.; Lue, L.F. Immune phenotypes of microglia in human neurodegenerative disease: Challenges to detecting microglial polarization in human brains. Alzheimer’s Res. Ther. 2015, 7, 56. [Google Scholar] [CrossRef] [Green Version]
- Zhou, X.; He, X.; Ren, Y. Function of microglia and macrophages in secondary damage after spinal cord injury. Neural Regen. Res. 2014, 9, 1787–1795. [Google Scholar] [CrossRef]
- Tang, Y.; Le, W. Differential Roles of M1 and M2 Microglia in Neurodegenerative Diseases. Mol. Neurobiol. 2016, 53, 1181–1194. [Google Scholar] [CrossRef]
- Kroner, A.; Greenhalgh, A.D.; Zarruk, J.G.; Passos Dos Santos, R.; Gaestel, M.; David, S. TNF and increased intracellular iron alter macrophage polarization to a detrimental M1 phenotype in the injured spinal cord. Neuron 2014, 83, 1098–1116. [Google Scholar] [CrossRef] [Green Version]
- Figley, S.A.; Khosravi, R.; Legasto, J.M.; Tseng, Y.F.; Fehlings, M.G. Characterization of vascular disruption and blood-spinal cord barrier permeability following traumatic spinal cord injury. J. Neurotrauma 2014, 31, 541–552. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carlos, T.M.; Harlan, J.M. Leukocyte-endothelial adhesion molecules. Blood 1994, 84, 2068–2101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Isaksson, J.; Farooque, M.; Holtz, A.; Hillered, L.; Olsson, Y. Expression of ICAM-1 and CD11b after experimental spinal cord injury in rats. J. Neurotrauma. 1999, 16, 165–173. [Google Scholar] [CrossRef] [PubMed]
- Saville, L.R.; Pospisil, C.H.; Mawhinney, L.A.; Bao, F.; Simedrea, F.C.; Peters, A.A.; O’Connell, P.J.; Weaver, L.C.; Dekaban, G.A. A monoclonal antibody to CD11d reduces the inflammatory infiltrate into the injured spinal cord: A potential neuroprotective treatment. J. Neuroimmunol. 2004, 156, 42–57. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, A.B.; Buss, A.; Breuer, S.; Brook, G.A.; Pech, K.; Martin, D.; Schoenen, J.; Noth, J.; Love, S.; Schröder, J.M.; et al. Major histocompatibility complex class II expression by activated microglia caudal to lesions of descending tracts in the human spinal cord is not associated with a T cell response. Acta Neuropathol. 2000, 100, 528–536. [Google Scholar] [CrossRef]
- Chamankhah, M.; Eftekharpour, E.; Karimi-Abdolrezaee, S.; Boutros, P.C.; San-Marina, S.; Fehlings, M.G. Genome-wide gene expression profiling of stress response in a spinal cord clip compression injury model. BMC Genom. 2013, 14, 583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allan, S.M.; Tyrrell, P.J.; Rothwell, N.J. Interleukin-1 and neuronal injury. Nat. Rev. Immunol. 2005, 5, 629–640. [Google Scholar] [CrossRef]
- Rust, R.; Kaiser, J. Insights into the Dual Role of Inflammation after Spinal Cord Injury. J. Neurosci. 2017, 37, 4658–4660. [Google Scholar] [CrossRef] [Green Version]
- Fan, H.; Zhang, K.; Shan, L.; Kuang, F.; Chen, K.; Zhu, K.; Ma, H.; Ju, G.; Wang, Y.Z. Reactive astrocytes undergo M1 microglia/macrohpages-induced necroptosis in spinal cord injury. Mol. Neurodegener. 2016, 11, 14. [Google Scholar] [CrossRef] [Green Version]
- Ren, Y.; Ao, Y.; O’Shea, T.M.; Burda, J.E.; Bernstein, A.M.; Brumm, A.J.; Muthusamy, N.; Ghashghaei, H.T.; Carmichael, S.T.; Cheng, L.; et al. Ependymal cell contribution to scar formation after spinal cord injury is minimal, local and dependent on direct ependymal injury. Sci. Rep. 2017, 7, 41122. [Google Scholar] [CrossRef] [Green Version]











| Target | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
|---|---|---|
| 18s RNA | GACCATAAACGATGCCGACT | GTGAGGTTTCCCGTGTTGAG |
| Arg-1 | CGGTGGCCTTTCTCCTGAA | GCAAGCCGATGTACACGATG |
| C1q | CCTCTTGTGTTTGGGGTCCC | CGTGTCAGCAGGGGACAGT |
| C3 | GGAAGTGTTGTGAGGATGGCA | CTGATGAAGTGGTTGAAGACGG |
| CD109 | GCTGCTTATGCGTTGCTCG | GGCCCTTTGATGGTCACTTG |
| CD11b | TGAAGAGCACCATCTGGGAC | AGATGGCGTACTTCACAGGC |
| CD206 | AAGGTTCCGGTTTGTGGAG | TGCATTGCCCAGTAAGGAG |
| CD68 | TCATGGGAATGCCACAGTTTC | GAGGGCCAACAGTGGAGAA |
| Cx3Cr1 | TCCCGGAATTGGATCTAGAG | GCAGGACCTCGGGGTAATCA |
| GFAP | CAGCTTCGAGCCAAGGAG | TGTCCCTCTCCACCTCCA |
| Iba1 | ATCCCAAGTACAGCAGTGATGAGGA | AAATAGCTTTCTTGGCTGGGGGAC |
| IL1β | TGACCCATGTGAGCTGAAAG | AGGGATTTTGTCGTTGCTTG |
| IL1rn | GGGAAAAGACCCTGCAAGA | GTGGATGCCCAAGAACACA |
| IL4Rα | TCCGCACTTCTACGTGTGAG | AGACCACAGTTCCAGCCAGT |
| IL-6 | CAGGAACGAAAGTCAACTCCA | ATCAGTCCCAAGAAGGCAACT |
| iNOS | GCTACGCCTTCAACACCAA | GCTTGTAACCACCAGCAGT |
| Lcn2 | CTGTCTGTCTGCCGCTCCAT | AAGAGGGATCAGATGCTTGGTG |
| Ptx3 | TGGTGGGTGGGAAGGAGAA | TGGCCATCTCCAGAGTGGTA |
| S100B | TTGCCCTCATTGATGTCTTCCA | TCTGCCTTGATTCTTACAGGTGAC |
| Serpina3n | TGCAAAACTGGACCCTCTGA | GCCTCAGGAGAAGCATCAACT |
| SOCS3 | GGGACCAAGAACCTACGCAT | GGCTGCTCCTGAACCTCAAA |
| TGF-β | ATACGCCTGAGTGGCTGTC | GCCCTGTATTCCGTCTCCT |
| Tgm1 | GCTCGAAGGTTCTGGGTTACA | TGGGAAAGCTGTGGACTGTC |
| TNFα | GCCCACGTCGTAGCAAAC | GCAGCCTTGTCCCTTGAA |
| Ym1 | TGGAGGCTGGAAGTTTGGATC | CCACGAGACCCAGGGTATTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kisucká, A.; Bimbová, K.; Bačová, M.; Gálik, J.; Lukáčová, N. Activation of Neuroprotective Microglia and Astrocytes at the Lesion Site and in the Adjacent Segments Is Crucial for Spontaneous Locomotor Recovery after Spinal Cord Injury. Cells 2021, 10, 1943. https://doi.org/10.3390/cells10081943
Kisucká A, Bimbová K, Bačová M, Gálik J, Lukáčová N. Activation of Neuroprotective Microglia and Astrocytes at the Lesion Site and in the Adjacent Segments Is Crucial for Spontaneous Locomotor Recovery after Spinal Cord Injury. Cells. 2021; 10(8):1943. https://doi.org/10.3390/cells10081943
Chicago/Turabian StyleKisucká, Alexandra, Katarína Bimbová, Mária Bačová, Ján Gálik, and Nadežda Lukáčová. 2021. "Activation of Neuroprotective Microglia and Astrocytes at the Lesion Site and in the Adjacent Segments Is Crucial for Spontaneous Locomotor Recovery after Spinal Cord Injury" Cells 10, no. 8: 1943. https://doi.org/10.3390/cells10081943
APA StyleKisucká, A., Bimbová, K., Bačová, M., Gálik, J., & Lukáčová, N. (2021). Activation of Neuroprotective Microglia and Astrocytes at the Lesion Site and in the Adjacent Segments Is Crucial for Spontaneous Locomotor Recovery after Spinal Cord Injury. Cells, 10(8), 1943. https://doi.org/10.3390/cells10081943
