Novel Human Podocyte Cell Model Carrying G2/G2 APOL1 High-Risk Genotype
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. Reagents and Antibodies
2.3. Participants and APOL1 Genotyping
2.4. Isolation and Culture of Podocytes Exfoliated into Urine
2.5. Quantitative Polymerase Chain Reaction (qPCR)
2.6. Immunofluorescence Staining
2.7. Detachment Assay
2.8. Cytotoxicity Assay
2.9. FITC-Annexin V/PI Staining for Apoptosis Assay
2.10. Western Blot for Autophagy Analysis
2.11. Perfusion Assay for Glomerular Membrane Permeability Assessment Using G2/G2 Podocytes
2.12. Statistical Analysis
3. Results
3.1. Generation of a Novel Podocyte Model from a Human Carrying APOL1 High-Risk Genotype
3.1.1. APOL1 Genotyping and Culture of Cells Harvested from APOL1 HRG Carriers
3.1.2. Characterisation of APOL1 G2/G2 Podocyte Cell Model
3.2. Functional Features of Podocyte Dysfunction in Human APOL1 G2/G2 Podocyte Model
3.2.1. APOL1-Induced Cytotoxicity
3.2.2. APOL1-Induced Alteration of Cytoskeleton and Filtration Barrier
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Saran, R.; Robinson, B.; Abbott, K.C.; Bragg-Gresham, J.; Chen, X.; Gipson, D.; Gu, H.; Hirth, R.A.; Hutton, D.; Jin, Y.; et al. US Renal Data System 2019 Annual Data Report: Epidemiology of Kidney Disease in the United States. Am. J. Kidney Dis. 2020, 75, A6–A7. [Google Scholar] [CrossRef] [Scilit]
- Genovese, G.; Tonna, S.J.; Knob, A.U.; Appel, G.B.; Katz, A.; Bernhardy, A.J.; Needham, A.W.; Lazarus, R.; Pollak, M.R. A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9. Kidney Int. 2010, 78, 698–704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Genovese, G.; Friedman, D.; Ross, M.D.; Lecordier, L.; Uzureau, P.; Freedman, B.I.; Bowden, D.W.; Langefeld, C.D.; Oleksyk, T.K.; Knob, A.L.U.; et al. Association of Trypanolytic ApoL1 Variants with Kidney Disease in African Americans. Science 2010, 329, 841–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kopp, J.; Nelson, G.W.; Sampath, K.; Johnson, R.; Genovese, G.; An, P.; Friedman, D.; Briggs, W.; Dart, R.; Korbet, S.; et al. APOL1 Genetic Variants in Focal Segmental Glomerulosclerosis and HIV-Associated Nephropathy. J. Am. Soc. Nephrol. 2011, 22, 2129–2137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ekulu, P.M.; Nkoy, A.B.; Betukumesu, D.K.; Aloni, M.N.; Makulo, J.R.R.; Sumaili, E.K.; Mafuta, E.M.; Elmonem, M.; Arcolino, F.O.; Kitetele, F.N.; et al. APOL1 Risk Genotypes Are Associated With Early Kidney Damage in Children in Sub-Saharan Africa. Kidney Int. Rep. 2019, 4, 930–938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ekulu, P.M.; Nkoy, A.B.; Adebayo, O.C.; Kazadi, O.K.; Aloni, M.N.; Arcolino, F.O.; Ngiyulu, R.M.; Gini, J.-L.E.; Lepira, F.B.; Heuvel, L.P.V.D.; et al. A focus on the association of Apol1 with kidney disease in children. Pediatr. Nephrol. 2020, 36, 777–788. [Google Scholar] [CrossRef] [Scilit]
- Kasembeli, A.N.; Duarte, R.; Ramsay, M.; Mosiane, P.; Dickens, C.; Dix-Peek, T.; Limou, S.; Sezgin, E.; Nelson, G.W.; Fogo, A.B.; et al. APOL1 Risk Variants Are Strongly Associated with HIV-Associated Nephropathy in Black South Africans. J. Am. Soc. Nephrol. 2015, 26, 2882–2890. [Google Scholar] [CrossRef] [Scilit]
- Thomson, R.; Genovese, G.; Canon, C.; Kovacsics, D.; Higgins, M.; Carrington, M.; Winkler, C.A.; Kopp, J.; Rotimi, C.; Adeyemo, A.; et al. Evolution of the primate trypanolytic factor APOL1. Proc. Natl. Acad. Sci. USA 2014, 111, E2130–E2139. [Google Scholar] [CrossRef] [Scilit]
- Friedman, D.J.; Pollak, M.R. Apolipoprotein L1 and Kidney Disease in African Americans. Trends Endocrinol. Metab. 2016, 27, 204–215. [Google Scholar] [CrossRef] [Scilit]
- Van Xong, H.; Vanhamme, L.; Chamekh, M.; Chimfwembe, C.E.; Abbeele, J.V.D.; Pays, A.; Van Meirvenne, N.; Hamers, R.; De Baetselier, P.; Pays, E. A VSG Expression Site–Associated Gene Confers Resistance to Human Serum in Trypanosoma rhodesiense. Cell 1998, 95, 839–846. [Google Scholar] [CrossRef] [Scilit]
- Vanhamme, L.; Paturiaux-Hanocq, F.; Poelvoorde, P.; Nolan, D.; Lins, L.; Abbeele, J.V.D.; Pays, A.; Tebabi, P.; Van Xong, H.; Jacquet, A.; et al. Apolipoprotein L-I is the trypanosome lytic factor of human serum. Nat. Cell Biol. 2003, 422, 83–87. [Google Scholar] [CrossRef] [Scilit]
- Perez-Morga, D.; Vanhollebeke, B.; Paturiaux-Hanocq, F.; Nolan, D.; Lins, L.; Homble, F.; Vanhamme, L.; Tebabi, P.; Pays, A.; Poelvoorde, P.; et al. Apolipoprotein L-I Promotes Trypanosome Lysis by Forming Pores in Lysosomal Membranes. Science 2005, 309, 469–472. [Google Scholar] [CrossRef] [Scilit]
- Vanhollebeke, B.; Truc, P.; Poelvoorde, P.; Pays, A.; Joshi, P.P.; Katti, R.; Jannin, J.G.; Pays, E. Human Trypanosoma evansi Infection Linked to a Lack of Apolipoprotein L-I. N. Engl. J. Med. 2006, 355, 2752–2756. [Google Scholar] [CrossRef] [Scilit]
- Vanhollebeke, B.; De Muylder, G.; Nielsen, M.J.; Pays, A.; Tebabi, P.; Dieu, M.; Raes, M.; Moestrup, S.K.; Pays, E. A Haptoglobin-Hemoglobin Receptor Conveys Innate Immunity to Trypanosoma brucei in Humans. Science 2008, 320, 677–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berberof, M.; Perez-Morga, D.; Pays, E. A receptor-like flagellar pocket glycoprotein specific to Trypanosoma brucei gambiense. Mol. Biochem. Parasitol. 2001, 113, 127–138. [Google Scholar] [CrossRef] [Scilit]
- Lecordier, L.; Vanhollebeke, B.; Poelvoorde, P.; Tebabi, P.; Paturiaux-Hanocq, F.; Andris, F.; Lins, L.; Pays, E. C-Terminal Mutants of Apolipoprotein L-I Efficiently Kill Both Trypanosoma brucei brucei and Trypanosoma brucei rhodesiense. PLOS Pathog. 2009, 5, e1000685. [Google Scholar] [CrossRef] [Scilit]
- Madhavan, S.M.; O’Toole, J.F. The biology of APOL1 with insights into the association between APOL1 variants and chronic kidney disease. Clin. Exp. Nephrol. 2013, 18, 238–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heymann, J.; A Winkler, C.; Hoek, M.; Suszták, K.; Kopp, J.B. Therapeutics for APOL1 nephropathies: Putting out the fire in the podocyte. Nephrol. Dial. Transplant. 2017, 32, i65–i70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.P.; Zaky, Z.S.; Schold, J.D.; Herlitz, L.C.; El-Rifai, R.; Drawz, P.E.; Bruggeman, L.A.; Barisoni, L.; Hogan, S.L.; Hu, Y.; et al. Podocyte density is reduced in kidney allografts with high-risk APOL1 genotypes at transplantation. Clin. Transplant. 2021, 35, e14234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nichols, B.; Jog, P.; Lee, J.H.; Blackler, D.; Wilmot, M.; D’Agati, V.; Markowitz, G.; Kopp, J.; Alper, S.L.; Pollak, M.R.; et al. Innate immunity pathways regulate the nephropathy gene Apolipoprotein L1. Kidney Int. 2015, 87, 332–342. [Google Scholar] [CrossRef] [Scilit]
- Uzureau, S.; Coquerelle, C.; Vermeiren, C.; Uzureau, P.; Van Acker, A.; Pilotte, L.; Monteyne, D.; Acolty, V.; Vanhollebeke, B.; Eynde, B.V.D.; et al. Apolipoproteins L control cell death triggered by TLR3/TRIF signaling in dendritic cells. Eur. J. Immunol. 2016, 46, 1854–1866. [Google Scholar] [CrossRef] [Scilit]
- Lan, X.; Jhaveri, A.; Cheng, K.; Wen, H.; Saleem, M.A.; Mathieson, P.W.; Mikulak, J.; Aviram, S.; Malhotra, A.; Skorecki, K.; et al. APOL1 risk variants enhance podocyte necrosis through compromising lysosomal membrane permeability. Am. J. Physiol. Physiol. 2014, 307, F326–F336. [Google Scholar] [CrossRef] [Scilit]
- A Giovinazzo, J.; Thomson, R.P.; Khalizova, N.; Zager, P.J.; Malani, N.; Rodriguez-Boulan, E.; Raper, J.; Schreiner, R. Apolipoprotein L-1 renal risk variants form active channels at the plasma membrane driving cytotoxicity. eLife 2020, 9, e51185. [Google Scholar] [CrossRef] [Scilit]
- Beckerman, P.; Karchin, J.; Park, A.S.D.; Qiu, C.; Dummer, P.D.; Soomro, I.; Boustany-Kari, C.M.; Pullen, S.S.; Miner, J.H.; A Hu, C.-A.; et al. Transgenic expression of human APOL1 risk variants in podocytes induces kidney disease in mice. Nat. Med. 2017, 23, 429–438. [Google Scholar] [CrossRef] [Scilit]
- Shah, S.; Lannon, H.; Dias, L.; Zhang, J.-Y.; Alper, S.L.; Pollak, M.R.; Friedman, D.J. APOL1 Kidney Risk Variants Induce Cell Death via Mitochondrial Translocation and Opening of the Mitochondrial Permeability Transition Pore. J. Am. Soc. Nephrol. 2019, 30, 2355–2368. [Google Scholar] [CrossRef] [Scilit]
- Ge, M.; Molina, J.; Ducasa, G.M.; Mallela, S.K.; Santos, J.V.; Mitrofanova, A.; Kim, J.-J.; Liu, X.; Sloan, A.; Mendez, A.J.; et al. APOL1 risk variants affect podocyte lipid homeostasis and energy production in focal segmental glomerulosclerosis. Hum. Mol. Genet. 2021, 30, 182–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olabisi, O.A.; Zhang, J.-Y.; VerPlank, L.; Zahler, N.; DiBartolo, S.; Heneghan, J.F.; Schlondorff, J.; Suh, J.H.; Yan, P.; Alper, S.L.; et al. APOL1 kidney disease risk variants cause cytotoxicity by depleting cellular potassium and inducing stress-activated protein kinases. Proc. Natl. Acad. Sci. USA 2015, 113, 830–837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schwartz, G.J.; Muñoz, A.; Schneider, M.F.; Mak, R.H.; Kaskel, F.; Warady, B.A.; Furth, S.L. New Equations to Estimate GFR in Children with CKD. J. Am. Soc. Nephrol. 2009, 20, 629–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cockcroft, D.W.; Gault, H. Prediction of Creatinine Clearance from Serum Creatinine. Nephron 1976, 16, 31–41. [Google Scholar] [CrossRef] [Scilit]
- Ivanova, E.A.; Arcolino, F.O.; Elmonem, M.; Rastaldi, M.P.; Giardino, L.; Cornelissen, E.; Heuvel, L.P.V.D.; Levtchenko, E.N. Cystinosin deficiency causes podocyte damage and loss associated with increased cell motility. Kidney Int. 2016, 89, 1037–1048. [Google Scholar] [CrossRef] [Scilit]
- A Saleem, M.; O’Hare, M.J.; Reiser, J.; Coward, R.J.; Inward, C.D.; Farren, T.; Xing, C.Y.; Ni, L.; Mathieson, P.W.; Mundel, P. A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J. Am. Soc. Nephrol. 2002, 13. [Google Scholar] [CrossRef] [Scilit]
- Mizushima, N.; Yoshimori, T. How to Interpret LC3 Immunoblotting. Autophagy 2007, 3, 542–545. [Google Scholar] [CrossRef] [Scilit]
- Kikuchi, M.; Wickman, L.; Hodgin, J.B.; Wiggins, R.C. Podometrics as a Potential Clinical Tool for Glomerular Disease Management. Semin. Nephrol. 2015, 35, 245–255. [Google Scholar] [CrossRef] [Scilit]
- Bruggeman, L.A.; Wu, Z.; Luo, L.; Madhavan, S.; Drawz, P.E.; Thomas, D.B.; Barisoni, L.; O’Toole, J.F.; Sedor, J.R. APOL1-G0 protects podocytes in a mouse model of HIV-associated nephropathy. PLoS ONE 2019, 14, e0224408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Granado, D.; Müller, D.; Krausel, V.; Kruzel-Davila, E.; Schuberth, C.; Eschborn, M.; Wedlich-Söldner, R.; Skorecki, K.; Pavenstädt, H.; Michgehl, U.; et al. Intracellular APOL1 Risk Variants Cause Cytotoxicity Accompanied by Energy Depletion. J. Am. Soc. Nephrol. 2017, 28, 3227–3238. [Google Scholar] [CrossRef] [Scilit]
- Zhaorigetu, S.; Wan, G.; Kaini, R.; Jiang, Z.; Hu, C.-A.A. ApoL1, a BH3-only lipid-binding protein, induces autophagic cell death. Autophagy 2008, 4, 1079–1082. [Google Scholar] [CrossRef] [Scilit]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, J.; Abeliovich, H.; Acevedo-Arozena, A.; Adachi, H.; Adams, C.; Adams, P.D.; Adeli, K.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 2016, 12, 1–222. [Google Scholar] [CrossRef] [Scilit]
- Schell, C.; Huber, T.B. The Evolving Complexity of the Podocyte Cytoskeleton. J. Am. Soc. Nephrol. 2017, 28, 3166–3174. [Google Scholar] [CrossRef] [Scilit]
- Iampietro, C.; Bellucci, L.; O Arcolino, F.; Arigoni, M.; Alessandri, L.; Gomez, Y.; Papadimitriou, E.; Calogero, R.; Cocchi, E.; Heuvel, L.V.D.; et al. Molecular and functional characterization of urine-derived podocytes from patients with Alport syndrome. J. Pathol. 2020, 252, 88–100. [Google Scholar] [CrossRef] [Scilit]
- Arcolino, F.O.; Zia, S.; Held, K.; Papadimitriou, E.; Theunis, K.; Bussolati, B.; Raaijmakers, A.; Allegaert, K.; Voet, T.; Deprest, J.; et al. Urine of Preterm Neonates as a Novel Source of Kidney Progenitor Cells. J. Am. Soc. Nephrol. 2016, 27, 2762–2770. [Google Scholar] [CrossRef] [Scilit]
- Arcolino, F.O.; Piella, A.T.; Papadimitriou, E.; Bussolati, B.; Antonie, D.J.; Murray, P.; Heuvel, L.V.D.; Levtchenko, E. Human Urine as a Noninvasive Source of Kidney Cells. Stem Cells Int. 2015, 2015, 362562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bondue, T.; Arcolino, F.; Veys, K.; Adebayo, O.; Levtchenko, E.; Heuvel, L.V.D.; Elmonem, M. Urine-Derived Epithelial Cells as Models for Genetic Kidney Diseases. Cells 2021, 10, 1413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilmer, M.J.; Saleem, M.A.; Masereeuw, R.; Ni, L.; Van Der Velden, T.J.; Russel, F.; Mathieson, P.W.; Monnens, L.A.; Heuvel, L.P.V.D.; Levtchenko, E.N. Novel conditionally immortalized human proximal tubule cell line expressing functional influx and efflux transporters. Cell Tissue Res. 2009, 339, 449–457. [Google Scholar] [CrossRef] [Scilit]
- Uzureau, S.; Lecordier, L.; Uzureau, P.; Hennig, D.; Graversen, J.H.; Homblé, F.; Mfutu, P.E.; Arcolino, F.O.; Ramos, A.R.; La Rovere, R.M.; et al. APOL1 C-Terminal Variants May Trigger Kidney Disease through Interference with APOL3 Control of Actomyosin. Cell Rep. 2020, 30, 3821–3836.e13. [Google Scholar] [CrossRef] [Scilit]
- O’Toole, J.F.; Schilling, W.; Kunze, D.; Madhavan, S.M.; Konieczkowski, M.; Gu, Y.; Luo, L.; Wu, Z.; Bruggeman, L.A.; Sedor, J.R. ApoL1 Overexpression Drives Variant-Independent Cytotoxicity. J. Am. Soc. Nephrol. 2017, 29, 869–879. [Google Scholar] [CrossRef] [Scilit]
- Lannon, H.; Shah, S.; Dias, L.; Blackler, D.; Alper, S.L.; Pollak, M.R.; Friedman, D.J. Apolipoprotein L1 (APOL1) risk variant toxicity depends on the haplotype background. Kidney Int. 2019, 96, 1303–1307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heneghan, J.F.; Vandorpe, D.H.; E Shmukler, B.; Giovinazzo, J.; Raper, J.; Friedman, D.; Pollak, M.R.; Alper, S.L. BH3 domain-independent apolipoprotein L1 toxicity rescued by BCL2 prosurvival proteins. Am. J. Physiol. Physiol. 2015, 309, C332–C347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, V.; Paliwal, N.; Ayasolla, K.; Vashistha, H.; Jha, A.; Chandel, N.; Chowdhary, S.; Saleem, M.A.; Malhotra, A.; Chander, P.N.; et al. Disruption of APOL1-miR193a Axis Induces Disorganization of Podocyte Actin Cytoskeleton. Sci. Rep. 2019, 9, 3582. [Google Scholar] [CrossRef] [Scilit]
- Kumar, V.; Ayasolla, K.; Jha, A.; Mishra, A.; Vashistha, H.; Lan, X.; Qayyum, M.; Chinnapaka, S.; Purohit, R.; Mikulak, J.; et al. Disrupted apolipoprotein L1-miR193a axis dedifferentiates podocytes through autophagy blockade in an APOL1 risk milieu. Am. J. Physiol. Physiol. 2019, 317, C209–C225. [Google Scholar] [CrossRef] [Scilit]




| Target | Forward Primer | Reverse Primer |
|---|---|---|
| CD2AP | AGGCTGGTGGAGTGGAAC | CAGGAAGGTATAGGTGAAGTAGG |
| Synaptopodin | AGCCCAAGGTGACCCCGAAT | CCCTGTCACGAGGTGCTGGC |
| Podocalyxin | CTTGAGACACAGACACAGAG | CCGTATGCCGCACTTATC |
| APOL1 | AATGAGGCCTGGAACGGAT | TCAACCGAGGAAACTCTTTCA |
| β-actin | AAGAGCTACGAGCTGCCTGA | GACTCCATGCCCAGGAAGG |
| Participant | Age (Years) | Gender | Country | Medical History | eGFR (mL/min/1.73 m2) | P/C Ratio mg/mg | APOL1 Genotype |
|---|---|---|---|---|---|---|---|
| 1 | 6 | M | Ghana | Kidney injury post neonatal asphyxia | 28 | 0.15 | G2/G2 |
| 2 | 28 | F | Cameroon | Normal | NA | NA | G1/G2 |
| 3 | 37 | M | DRC | Hypertension | 98 | 0.25 | G1/G1 |
| 4 | 38 | F | DRC | Normal | 104 | 0.18 | G1/G2 |
| 5 | 40 | M | DRC | Normal | NA | NA | G1/G2 |
| 6 | 43 | F | DRC | Sickle cell trait | 112 | 0.12 | G1/G2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ekulu, P.M.; Adebayo, O.C.; Decuypere, J.-P.; Bellucci, L.; Elmonem, M.A.; Nkoy, A.B.; Mekahli, D.; Bussolati, B.; van den Heuvel, L.P.; Arcolino, F.O.; et al. Novel Human Podocyte Cell Model Carrying G2/G2 APOL1 High-Risk Genotype. Cells 2021, 10, 1914. https://doi.org/10.3390/cells10081914
Ekulu PM, Adebayo OC, Decuypere J-P, Bellucci L, Elmonem MA, Nkoy AB, Mekahli D, Bussolati B, van den Heuvel LP, Arcolino FO, et al. Novel Human Podocyte Cell Model Carrying G2/G2 APOL1 High-Risk Genotype. Cells. 2021; 10(8):1914. https://doi.org/10.3390/cells10081914
Chicago/Turabian StyleEkulu, Pepe M., Oyindamola C. Adebayo, Jean-Paul Decuypere, Linda Bellucci, Mohamed A. Elmonem, Agathe B. Nkoy, Djalila Mekahli, Benedetta Bussolati, Lambertus P. van den Heuvel, Fanny O. Arcolino, and et al. 2021. "Novel Human Podocyte Cell Model Carrying G2/G2 APOL1 High-Risk Genotype" Cells 10, no. 8: 1914. https://doi.org/10.3390/cells10081914
APA StyleEkulu, P. M., Adebayo, O. C., Decuypere, J.-P., Bellucci, L., Elmonem, M. A., Nkoy, A. B., Mekahli, D., Bussolati, B., van den Heuvel, L. P., Arcolino, F. O., & Levtchenko, E. N. (2021). Novel Human Podocyte Cell Model Carrying G2/G2 APOL1 High-Risk Genotype. Cells, 10(8), 1914. https://doi.org/10.3390/cells10081914

