Novel Primary Human Cancer Stem-Like Cell Populations from Non-Small Cell Lung Cancer: Inhibition of Cell Survival by Targeting NF-κB and MYC Signaling
Abstract
1. Introduction
2. Materials and Methods
2.1. Lung Cancer Stem Cell-like Cell Population Establishment and Cell Culture
2.2. Immunocytochemistry
2.3. Western Blot
2.4. Senescence Assay
2.5. Quantitaive Polymerase Chain Reaction
2.6. Inhibitor Treatments
2.7. Statistical Analysis
3. Results
3.1. Squamous Cell Carcinoma- and Adenocarcinoma-Derived Cells Depicted Stemness-like Phenotype
3.2. Tumor Necrosis Factor-α Stimulation Activated NF-κB RelA in Squamous Cell Carcinoma- and Adenocarcinoma-Derived Lung Cancer Stem Cell-like Cells
3.3. Inhibition of MYC and NMYC in Squamous Cell Carcinoma- and Adenocarcinoma-Derived Lung Cancer Stem Cell-like Cells Significantly Impaired Cell Survival
3.4. Inhibition of NF-κB Signaling Decreased Survival of Squamous Cell Carcinoma- and Adenocarcinoma-Derived Lung Cancer Stem Cell-like Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruiz-Ceja, K.A.; Chirino, Y.I. Current FDA-approved treatments for non-small cell lung cancer and potential biomarkers for its detection. Biomed. Pharmacother. 2017, 90, 24–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zappa, C.; Mousa, S.A. Non-small cell lung cancer: Current treatment and future advances. Transl. Lung Cancer Res. 2016, 5, 288–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Sousa, V.M.L.; Carvalho, L. Heterogeneity in Lung Cancer. Pathobiology 2018, 85, 96–107. [Google Scholar] [CrossRef] [Scilit]
- Eramo, A.; Lotti, F.; Sette, G.; Pilozzi, E.; Biffoni, M.; Di Virgilio, A.; Conticello, C.; Ruco, L.; Peschle, C.; De Maria, R. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ. 2007, 15, 504–514. [Google Scholar] [CrossRef] [Scilit]
- Pardal, R.; Clarke, M.F.; Morrison, S.J. Applying the principles of stem-cell biology to cancer. Nat. Rev. Cancer 2003, 3, 895–902. [Google Scholar] [CrossRef] [Scilit]
- Prabavathy, D.; Swarnalatha, Y.; Ramadoss, N. Lung cancer stem cells—origin, characteristics and therapy. Stem Cell Investig. 2018, 5, 6. [Google Scholar] [CrossRef] [Scilit]
- Sun, F.-F.; Hu, Y.-H.; Xiong, L.-P.; Tu, X.-Y.; Zhao, J.-H.; Chen, S.-S.; Song, J.; Ye, X.-Q. Enhanced expression of stem cell markers and drug resistance in sphere-forming non-small cell lung cancer cells. Int. J. Clin. Exp. Pathol. 2015, 8, 6287–6300. [Google Scholar]
- Zakaria, N.; Yusoff, N.M.; Zakaria, Z.; Lim, M.N.; Baharuddin, P.J.N.; Fakiruddin, K.S.; Yahaya, B. Human non-small cell lung cancer expresses putative cancer stem cell markers and exhibits the transcriptomic profile of multipotent cells. BMC Cancer 2015, 15, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.Z.; Lin, X.G.; Hua, P.; Wang, M.; Ao, X.; Xiong, L.H.; Wu, C.; Guo, J.J. The study of the tumor stem cell properties of CD133+CD44+ cells in the human lung adenocarcinoma cell line A549. Cell. Mol. Biol. 2010, 56, 1350–1358. [Google Scholar]
- Maiuthed, A.; Chantarawong, W.; Chanvorachote, P. Lung Cancer Stem Cells and Cancer Stem Cell-targeting Natural Compounds. Anticancer. Res. 2018, 38, 3797–3809. [Google Scholar] [CrossRef] [Scilit]
- Tan, Y.; Chen, B.; Xu, W.; Zhao, W.; Wu, J. Clinicopathological significance of CD133 in lung cancer: A meta-analysis. Mol. Clin. Oncol. 2014, 2, 111–115. [Google Scholar] [CrossRef] [Scilit]
- Bertolini, G.; Roz, L.; Perego, P.; Tortoreto, M.; Fontanella, E.; Gatti, L.; Pratesi, G.; Fabbri, A.; Andriani, F.; Tinelli, S.; et al. Highly tumorigenic lung cancer CD133+ cells display stem-like features and are spared by cisplatin treatment. Proc. Natl. Acad. Sci. USA 2009, 106, 16281–16286. [Google Scholar] [CrossRef] [Scilit]
- Schaub, F.X.; Dhankani, V.; Berger, A.C.; Trivedi, M.; Richardson, A.B.; Shaw, R.; Zhao, W.; Zhang, X.; Ventura, A.; Liu, Y.; et al. Pan-cancer Alterations of the MYC Oncogene and Its Proximal Network across the Cancer Genome Atlas. Cell Syst. 2018, 6, 282–300.e2. [Google Scholar] [CrossRef] [Scilit]
- Iwakawa, R.; Kohno, T.; Kato, M.; Shiraishi, K.; Tsuta, K.; Noguchi, M.; Ogawa, S.; Yokota, J. MYC Amplification as a Prognostic Marker of Early-Stage Lung Adenocarcinoma Identified by Whole Genome Copy Number Analysis. Clin. Cancer Res. 2010, 17, 1481–1489. [Google Scholar] [CrossRef] [Scilit]
- Seo, A.N.; Yang, J.M.; Kim, H.; Jheon, S.; Kim, K.; Lee, C.T.; Jin, Y.; Yun, S.; Chung, J.-H.; Paik, J.H. Clinicopathologic and prognostic significance of c-MYC copy number gain in lung adenocarcinomas. Br. J. Cancer 2014, 110, 2688–2699. [Google Scholar] [CrossRef] [Scilit]
- Tao, X.; Yin, Y.; Lian, D.; Gu, H.; Chen, W.; Yang, L.; Yin, G.; Liu, P.; Li, L.; Wei, Y.; et al. Puerarin 6″-O-xyloside suppresses growth, self-renewal and invasion of lung cancer stem-like cells derived from A549 cells via regulating Akt/c-Myc signalling. Clin. Exp. Pharmacol. Physiol. 2020, 47, 1311–1319. [Google Scholar] [CrossRef] [Scilit]
- Bhummaphan, N.; Petpiroon, N.; Prakhongcheep, O.; Sritularak, B.; Chanvorachote, P. Lusianthridin targeting of lung cancer stem cells via Src-STAT3 suppression. Phytomedicine 2019, 62, 152932. [Google Scholar] [CrossRef] [Scilit]
- Lawrence, T. The Nuclear Factor NF- B Pathway in Inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [Scilit]
- Kaltschmidt, B.; Kaltschmidt, C. NF- B in the Nervous System. Cold Spring Harb. Perspect. Biol. 2009, 1, a001271. [Google Scholar] [CrossRef] [Scilit]
- Xia, L.; Tan, S.; Zhou, Y.; Lin, J.; Wang, H.; Oyang, L.; Tian, Y.; Liu, L.; Su, M.; Wang, H.; et al. Role of the NFκB-signaling pathway in cancer. OncoTargets Ther. 2018, 11, 2063–2073. [Google Scholar] [CrossRef] [Scilit]
- Sau, A.; Lau, R.; Cabrita, M.A.; Nolan, E.; Crooks, P.A.; Visvader, J.E.; Pratt, M.C. Persistent Activation of NF-κB in BRCA1-Deficient Mammary Progenitors Drives Aberrant Proliferation and Accumulation of DNA Damage. Cell Stem Cell 2016, 19, 52–65. [Google Scholar] [CrossRef] [Scilit]
- Forlani, G.; Abdallah, R.; Accolla, R.S.; Tosi, G. The Major Histocompatibility Complex Class II Transactivator CIITA Inhibits the Persistent Activation of NF-κB by the Human T Cell Lymphotropic Virus Type 1 Tax-1 Oncoprotein. J. Virol. 2016, 90, 3708–3721. [Google Scholar] [CrossRef] [Scilit]
- Walther, W.; Kobelt, D.; Bauer, L.; Aumann, J.; Stein, U. Chemosensitization by diverging modulation by short-term and long-term TNF-? action on ABCB1 expression and NF-?B signaling in colon cancer. Int. J. Oncol. 2015, 47, 2276–2285. [Google Scholar] [CrossRef] [Scilit]
- Kaltschmidt, B.; Greiner, J.F.W.; Kadhim, H.M.; Kaltschmidt, C. Subunit-Specific Role of NF-κB in Cancer. Biomedicines 2018, 6, 44. [Google Scholar] [CrossRef] [Scilit]
- Gu, L.; Wang, Z.; Zuo, J.; Li, H.; Zha, L. Prognostic significance of NF-κB expression in non-small cell lung cancer: A meta-analysis. PLoS ONE 2018, 13, e0198223. [Google Scholar] [CrossRef] [Scilit]
- Hart, J.R.; Garner, A.L.; Yu, J.; Ito, Y.; Sun, M.; Ueno, L.; Rhee, J.-K.; Baksh, M.M.; Stefan, E.; Hartl, M.; et al. Inhibitor of MYC identified in a Krohnke pyridine library. Proc. Natl. Acad. Sci. USA 2014, 111, 12556–12561. [Google Scholar] [CrossRef] [Scilit]
- Esch, J.S.A.S.A.; Windmöller, B.A.; Hanewinkel, J.; Storm, J.; Förster, C.; Wilkens, L.; Krüger, M.; Kaltschmidt, B.; Kaltschmidt, C. Isolation and Characterization of Two Novel Colorectal Cancer Cell Lines, Containing a Subpopulation with Potential Stem-Like Properties: Treatment Options by MYC/NMYC Inhibition. Cancers 2020, 12, 2582. [Google Scholar] [CrossRef] [Scilit]
- Stammler, G.; Pommerenke, E.; Mattern, J.; Volm, M. Effects of single doses of irradiation on the expression of resistance-related proteins in murine NIH 3T3 and human lung carcinoma cells. Carcinogenesis 1995, 16, 2051–2055. [Google Scholar] [CrossRef] [Scilit]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelley, J.B.; Paschal, B.M. Fluorescence-based quantification of nucleocytoplasmic transport. Methods 2019, 157, 106–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Debacq-Chainiaux, F.; Erusalimsky, J.D.; Campisi, J.; Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-βgal) activity, a biomarker of senescent cells in culture and in vivo. Nat. Protoc. 2009, 4, 1798–1806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Preter, K.; Speleman, F.; Combaret, V.; Lunec, J.; Laureys, G.; Eussen, B.H.; Francotte, N.; Board, J.; Pearson, A.D.; De Paepe, A.; et al. Quantification of MYCN, DDX1, and NAG Gene Copy Number in Neuroblastoma Using a Real-Time Quantitative PCR Assay. Mod. Pathol. 2002, 15, 159–166. [Google Scholar] [CrossRef] [Scilit]
- Yin, L.; Wen, X.; Lai, Q.; Li, J.; Wang, X. Lenalidomide improvement of cisplatin antitumor efficacy on triple-negative breast cancer cells in�vitro. Oncol. Lett. 2018, 15, 6469–6474. [Google Scholar] [CrossRef] [Scilit]
- Lu, L.; Payvandi, F.; Wu, L.; Zhang, L.-H.; Hariri, R.J.; Man, H.-W.; Chen, R.S.; Muller, G.W.; Hughes, C.C.; Stirling, D.I.; et al. The anti-cancer drug lenalidomide inhibits angiogenesis and metastasis via multiple inhibitory effects on endothelial cell function in normoxic and hypoxic conditions. Microvasc. Res. 2009, 77, 78–86. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Gu, W.; Zhang, Y.; Ji, Y.; Wen, Y.; Xu, X. Nicotine promotes cervical carcinoma cell line HeLa migration and invasion by activating PI3k/Akt/NF-κB pathway in vitro. Exp. Toxicol. Pathol. 2017, 69, 402–407. [Google Scholar] [CrossRef] [Scilit]
- Kanekura, T.; Higashi, Y.; Kanzaki, T. Inhibitory effects of 9-cis-retinoic acid and pyrrolidinedithiocarbamate on cyclooxygenase (COX)-2 expression and cell growth in human skin squamous carcinoma cells. Cancer Lett. 2000, 161, 177–183. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Zhou, J.; Yang, W.; Zhou, Q.; Liang, X.; Pang, X.; Li, J.; Pan, F.; Liang, H. Dexamethasone affects cell growth/apoptosis/chemosensitivity of colon cancer via glucocorticoid receptor α/NF-κB. Oncotarget 2017, 8, 67670–67683. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, S.; Okada, M.; Sanomachi, T.; Togashi, K.; Seino, S.; Sato, A.; Yamamoto, M.; Kitanaka, C. Therapeutic targeting of pancreatic cancer stem cells by dexamethasone modulation of the MKP-1–JNK axis. J. Biol. Chem. 2020, 295, 18328–18342. [Google Scholar] [CrossRef] [Scilit]
- Behrooz, A.B.; Syahir, A.; Ahmad, S. CD133: Beyond a cancer stem cell biomarker. J. Drug Target. 2019, 27, 257–269. [Google Scholar] [CrossRef] [Scilit]
- Yan, Y.; Zuo, X.; Wei, D. Concise Review: Emerging Role of CD44 in Cancer Stem Cells: A Promising Biomarker and Therapeutic Target. STEM CELLS Transl. Med. 2015, 4, 1033–1043. [Google Scholar] [CrossRef] [Scilit]
- Neradil, J.; Veselska, R. Nestin as a marker of cancer stem cells. Cancer Sci. 2015, 106, 803–811. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.-C.; Hsu, H.-S.; Chen, Y.-W.; Tsai, T.-H.; How, C.-K.; Wang, C.-Y.; Hung, S.-C.; Chang, Y.-L.; Tsai, M.-L.; Lee, Y.-Y.; et al. Oct-4 Expression Maintained Cancer Stem-Like Properties in Lung Cancer-Derived CD133-Positive Cells. PLoS ONE 2008, 3, e2637. [Google Scholar] [CrossRef] [Scilit]
- Tirino, V.; Camerlingo, R.; Franco, R.; Malanga, D.; La Rocca, A.; Viglietto, G.; Rocco, G.; Pirozzi, G. The role of CD133 in the identification and characterisation of tumour-initiating cells in non-small-cell lung cancer. Eur. J. Cardio-Thorac. Surg. 2009, 36, 446–453. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Huang, J.; Leng, D.; Yang, S.; Yao, Q.; Sun, J.; Hu, J. Gefitinib-loaded DSPE-PEG2000 nanomicelles with CD133 aptamers target lung cancer stem cells. World J. Surg. Oncol. 2017, 15, 167. [Google Scholar] [CrossRef] [Scilit]
- Leung, E.L.-H.; Fiscus, R.R.; Tung, J.W.; Tin, V.P.-C.; Cheng, L.C.; Sihoe, A.D.-L.; Fink, L.M.; Ma, Y.; Wong, M.P. Non-Small Cell Lung Cancer Cells Expressing CD44 Are Enriched for Stem Cell-Like Properties. PLoS ONE 2010, 5, e14062. [Google Scholar] [CrossRef] [Scilit]
- Satar, N.A.; Fakiruddin, K.S.; Lim, M.N.; Mok, P.L.; Zakaria, N.; Fakharuzi, N.A.; Rahman, A.Z.A.; Zakaria, Z.; Yahaya, B.H.; Baharuddin, P. Novel triple-positive markers identified in human non-small cell lung cancer cell line with chemotherapy-resistant and putative cancer stem cell characteristics. Oncol. Rep. 2018, 40, 669–681. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Xiao, Z.; Wong, S.K.-M.; Tin, V.P.-C.; Ho, K.-Y.; Wang, J.; Sham, M.-H.; Wong, M.P. Lung cancer tumorigenicity and drug resistance are maintained through ALDHhiCD44hi tumor initiating cells. Oncotarget 2013, 4, 1698–1711. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Qing, H.; Su, X.; Wang, C.; Li, Z.; Liu, S. Association of CD44 Gene Polymorphism with Survival of NSCLC and Risk of Bone Metastasis. Med. Sci. Monit. 2015, 21, 2694–2700. [Google Scholar] [CrossRef] [Scilit]
- Li, G.; Gao, Y.; Cui, Y.; Zhang, T.; Cui, R.; Jiang, Y.; Shi, J. Overexpression of CD44 is associated with the occurrence and migration of non-small cell lung cancer. Mol. Med. Rep. 2016, 14, 3159–3167. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zhao, X.; Shi, L.; Wu, Y.; Zhang, X.; Fan, Z.; Shen, B. IL6 pretreatment promotes chemosensitivity by eliminating quiescent cancer (stem) cells in lung adenocarcinoma. Clin. Transl. Med. 2020, 10, e217. [Google Scholar] [CrossRef] [Scilit]
- Park, D.; Xiang, A.P.; Mao, F.F.; Zhang, L.; Di, C.-G.; Liu, X.-M.; Shao, Y.; Ma, B.-F.; Lee, J.-H.; Ha, K.-S.; et al. Nestin Is Required for the Proper Self-Renewal of Neural Stem Cells. Stem Cells 2010, 28, 2162–2171. [Google Scholar] [CrossRef] [Scilit]
- Narita, K.; Matsuda, Y.; Seike, M.; Naito, Z.; Gemma, A.; Ishiwata, T. Nestin regulates proliferation, migration, invasion and stemness of lung adenocarcinoma. Int. J. Oncol. 2014, 44, 1118–1130. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.; Zhang, Y.; Lu, M.; Wang, C.; Li, Q.; Gao, Y.; Mu, D.; Cao, Y.; Li, M.; Meng, X. Nestin servers as a promising prog-nostic biomarker in non-small cell lung cancer. Am. J. Transl. Res. 2017, 9, 1392–1401. [Google Scholar]
- Qiu, X.; Wang, Z.; Li, Y.; Miao, Y.; Ren, Y.; Luan, Y. Characterization of sphere-forming cells with stem-like properties from the small cell lung cancer cell line H446. Cancer Lett. 2012, 323, 161–170. [Google Scholar] [CrossRef] [Scilit]
- Adhikary, S.; Eilers, M. Transcriptional regulation and transformation by Myc proteins. Nat. Rev. Mol. Cell Biol. 2005, 6, 635–645. [Google Scholar] [CrossRef] [Scilit]
- Jacob, N.T.; Miranda, P.O.; Shirey, R.J.; Gautam, R.; Zhou, B.; Izquierdo, M.E.D.O.; Hixon, M.S.; Hart, J.R.; Ueno, L.; Vogt, P.K.; et al. Synthetic molecules for disruption of the MYC protein-protein interface. Bioorganic Med. Chem. 2018, 26, 4234–4239. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.-Q.; Xie, Y.-K.; Wu, Y.; Li, L.-L.; Liu, Y.; Miao, X.-B.; Liu, Q.-Z.; Yao, K.-T.; Xiao, G.-H. Sulforaphane inhibits cancer stem-like cell properties and cisplatin resistance through miR-214-mediated downregulation of c-MYC in non-small cell lung cancer. Oncotarget 2017, 8, 12067–12080. [Google Scholar] [CrossRef] [Scilit]
- Choi, S.H.; Mahankali, M.; Lee, S.J.; Hull, M.; Petrassi, H.M.; Chatterjee, A.K.; Schultz, P.G.; Jones, K.A.; Shen, W. Targeted Disruption of Myc–Max Oncoprotein Complex by a Small Molecule. ACS Chem. Biol. 2017, 12, 2715–2719. [Google Scholar] [CrossRef] [Scilit]
- Castell, A.; Yan, Q.; Fawkner, K.; Hydbring, P.; Zhang, F.; Verschut, V.; Franco, M.; Zakaria, S.M.; Bazzar, W.; Goodwin, J.; et al. A selective high affinity MYC-binding compound inhibits MYC:MAX interaction and MYC-dependent tumor cell proliferation. Sci. Rep. 2018, 8, 1–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Witte, K.; Hertel, O.; Windmöller, B.; Helweg, L.; Höving, A.; Knabbe, C.; Busche, T.; Greiner, J.; Kalinowski, J.; Noll, T.; et al. Nanopore Sequencing Reveals Global Transcriptome Signatures of Mitochondrial and Ribosomal Gene Expressions in Various Human Cancer Stem-like Cell Populations. Cancers 2021, 13, 1136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Van Calcar, S.; Qu, C.; Cavenee, W.K.; Zhang, M.Q.; Ren, B. A global transcriptional regulatory role for c-Myc in Burkitt’s lymphoma cells. Proc. Natl. Acad. Sci. USA 2003, 100, 8164–8169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandez, P.C.; Frank, S.R.; Wang, L.; Schroeder, M.; Liu, S.; Greene, J.; Cocito, A.; Amati, B. Genomic targets of the human c-Myc protein. Genes Dev. 2003, 17, 1115–1129. [Google Scholar] [CrossRef] [Scilit]
- Schuhmacher, M.; Eick, D. Dose-dependent regulation of target gene expression and cell proliferation by c-Myc levels. Transcription 2013, 4, 192–197. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.; Lee, J.-H.; Iyer, V.R. Global Identification of Myc Target Genes Reveals Its Direct Role in Mitochondrial Biogenesis and Its E-Box Usage In Vivo. PLoS ONE 2008, 3, e1798. [Google Scholar] [CrossRef] [Scilit]
- He, T.-L.; Zhang, Y.-J.; Jiang, H.; Li, X.-H.; Zhu, H.; Zheng, K.-L. The c-Myc–LDHA axis positively regulates aerobic glycolysis and promotes tumor progression in pancreatic cancer. Med. Oncol. 2015, 32, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Gu, T.; Lu, Z.; Qiu, L.; Xiao, G.; Zhu, X.; Li, F.; Yu, H.; Li, G.; Liu, H. Roles of MYC-targeting long non-coding RNA MINCR in cell cycle regulation and apoptosis in non-small cell lung Cancer. Respir. Res. 2019, 20, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Wu, F.; Jin, W.; Yan, B.; Chen, X.; He, Y.; Yang, W.; Du, W.; Zhang, Q.; Guo, Y.; et al. Theabrownin Inhibits Cell Cycle Progression and Tumor Growth of Lung Carcinoma through c-myc-Related Mechanism. Front. Pharmacol. 2017, 8, 75. [Google Scholar] [CrossRef] [Scilit]
- Van Riggelen, J.; Yetil, A.; Felsher, D.W. MYC as a regulator of ribosome biogenesis and protein synthesis. Nat. Rev. Cancer 2010, 10, 301–309. [Google Scholar] [CrossRef] [Scilit]
- Destefanis, F.; Manara, V.; Bellosta, P. Myc as a Regulator of Ribosome Biogenesis and Cell Competition: A Link to Cancer. Int. J. Mol. Sci. 2020, 21, 4037. [Google Scholar] [CrossRef] [Scilit]
- Liang, T.; Ye, X.; Yan, D.; Deng, C.; Li, Z.; Tian, B. FAM46B Promotes Apoptosis and Inhibits Glycolysis of Prostate Cancer Through Inhibition of the MYC-LDHA Axis. OncoTargets Ther. 2020, 13, 8771–8782. [Google Scholar] [CrossRef] [Scilit]
- Yue, M.; Jiang, J.; Gao, P.; Liu, H.; Qing, G. Oncogenic MYC Activates a Feedforward Regulatory Loop Promoting Essential Amino Acid Metabolism and Tumorigenesis. Cell Rep. 2017, 21, 3819–3832. [Google Scholar] [CrossRef] [Scilit]
- Batra, S.; Balamayooran, G.; Sahoo, M.K. Nuclear Factor-κB: A Key Regulator in Health and Disease of Lungs. Arch. Immunol. Ther. Exp. 2011, 59, 335–351. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Li, Z.; Bai, L.; Lin, Y. NF-kappaB, a mediator for lung carcinogenesis and a target for lung cancer preven-tion and therapy. Front. Biosci. 2011, 16, 1172–1185. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Jin, X.; Wang, F.; Wang, S.; Deng, C.; Gao, Z.; Guo, C. Combined Prognostic Value of Both RelA and IκB-α Expression in Human Non–Small Cell Lung Cancer. Ann. Surg. Oncol. 2007, 14, 3581–3592. [Google Scholar] [CrossRef] [Scilit]
- Kaltschmidt, C.; Banz-Jansen, C.; Benhidjeb, T.; Beshay, M.; Förster, C.; Greiner, J.; Hamelmann, E.; Jorch, N.; Mertzlufft, F.; Pfitzenmaier, J.; et al. A Role for NF-κB in Organ Specific Cancer and Cancer Stem Cells. Cancers 2019, 11, 655. [Google Scholar] [CrossRef] [Scilit]
- Zakaria, N.; Yusoff, N.M.; Zakaria, Z.; Widera, D.; Yahaya, B.H. Inhibition of NF-κB Signaling Reduces the Stemness Characteristics of Lung Cancer Stem Cells. Front. Oncol. 2018, 8, 166. [Google Scholar] [CrossRef] [Scilit]
- Gong, K.; Guo, G.; Gerber, D.E.; Gao, B.; Peyton, M.; Huang, C.; Minna, J.D.; Hatanpaa, K.J.; Kernstine, K.; Cai, L.; et al. TNF-driven adaptive response mediates resistance to EGFR inhibition in lung cancer. J. Clin. Investig. 2018, 128, 2500–2518. [Google Scholar] [CrossRef] [Scilit]
- Shang, G.-S.; Liu, L.; Qin, Y.-W. IL-6 and TNF-α promote metastasis of lung cancer by inducing epithelial-mesenchymal transition. Oncol. Lett. 2017, 13, 4657–4660. [Google Scholar] [CrossRef] [Scilit]
- Yu, W.-N.; Lai, Y.-J.; Ma, J.-W.; Ho, C.-T.; Hung, S.-W.; Chen, Y.-H.; Chen, C.-T.; Kao, J.-Y.; Way, T.-D. Citronellol Induces Necroptosis of Human Lung Cancer Cells via TNF-α Pathway and Reactive Oxygen Species Accumulation. In Vivo 2019, 33, 1193–1201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taniguchi, K.; Karin, M. NF-κB, inflammation, immunity and cancer: Coming of age. Nat. Rev. Immunol. 2018, 18, 309–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ridker, P.M.; MacFadyen, J.G.; Thuren, T.; Everett, B.M.; Libby, P.; Glynn, R.J.; Lorenzatti, A.; Krum, H.; Varigos, J.; Siostrzonek, P.; et al. Effect of interleukin-1β inhibition with canakinumab on incident lung cancer in patients with atherosclerosis: Exploratory results from a randomised, double-blind, placebo-controlled trial. Lancet 2017, 390, 1833–1842. [Google Scholar] [CrossRef] [Scilit]
- Teo, S.K. Properties of thalidomide and its analogues: Implications for anticancer therapy. AAPS J. 2005, 7, E14–E19. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.; An, S.; Cha, H.J.; Choi, Y.M.; Choi, S.J.; An, I.-S.; Lee, H.G.; Min, Y.H.; Lee, S.-J.; Bae, S. Lenalidomide induces apoptosis and alters gene expression in non-small cell lung cancer cells. Oncol. Lett. 2012, 5, 588–592. [Google Scholar] [CrossRef] [Scilit]
- Mitsiades, N.; Mitsiades, C.S.; Poulaki, V.; Chauhan, D.; Richardson, P.G.; Hideshima, T.; Munshi, N.C.; Treon, S.P.; Anderson, K.C. Apoptotic signaling induced by immunomodulatory thalidomide analogs in human multiple myeloma cells: Therapeutic implications. Blood 2002, 99, 4525–4530. [Google Scholar] [CrossRef] [Scilit]
- Crinelli, R.; Antonelli, A.; Bianchi, M.; Gentilini, L.; Scaramucci, S.; Magnani, M. Selective Inhibition of NF-kB Activation and TNF-α Production in Macrophages by Red Blood Cell-Mediated Delivery of Dexamethasone. Blood Cells. Mol. Dis. 2000, 26, 211–222. [Google Scholar] [CrossRef] [Scilit]
- Chang, C.K.; Llanes, S.; Schumer, W. Effect of Dexamethasone on NF-kB Activation, Tumor Necrosis Factor Formation, and Glucose Dyshomeostasis in Septic Rats. J. Surg. Res. 1997, 72, 141–145. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Zhang, Y.; Cai, Z.; Tu, Y.; Hu, Z. Dexamethasone and lenvatinib inhibit migration and invasion of non-small cell lung cancer by regulating EKR/AKT and VEGF signal pathways. Exp. Ther. Med. 2019, 19, 762–770. [Google Scholar] [CrossRef] [Scilit]
- Ge, H.; Ke, J.; Xu, N.; Li, H.; Gong, J.; Li, X.; Song, Y.; Zhu, H.; Bai, C. Dexamethasone alleviates pemetrexed-induced senescence in Non-Small-Cell Lung Cancer. Food Chem. Toxicol. 2018, 119, 86–97. [Google Scholar] [CrossRef] [Scilit]
- Herrmann, J.L.; Beham, A.W.; Sarkiss, M.; Chiao, P.J.; Rands, M.; Bruckheimer, E.M.; Brisbay, S.; McDonnell, T.J. Bcl-2 Suppresses Apoptosis Resulting from Disruption of the NF-κB Survival Pathway. Exp. Cell Res. 1997, 237, 101–109. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Wang, H.; Xu, Z.; Bai, Y.; Xu, L. Lymphatic Metastasis of NSCLC Involves Chemotaxis Effects of Lymphatic Endothelial Cells through the CCR7–CCL21 Axis Modulated by TNF-α. Genes 2020, 11, 1309. [Google Scholar] [CrossRef] [Scilit]
- Herreros-Pomares, A.; De-Maya-Girones, J.D.; Calabuig-Fariñas, S.; Lucas, R.; Martínez, A.; Pardo-Sánchez, J.M.; Alonso, S.; Blasco, A.; Guijarro, R.; Martorell, M.; et al. Lung tumorspheres reveal cancer stem cell-like properties and a score with prognostic impact in resected non-small-cell lung cancer. Cell Death Dis. 2019, 10, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Gupta, P.B.; Onder, T.T.; Jiang, G.; Tao, K.; Kuperwasser, C.; Weinberg, R.A.; Lander, E.S. Identification of Selective Inhibitors of Cancer Stem Cells by High-Throughput Screening. Cell 2009, 138, 645–659. [Google Scholar] [CrossRef] [Scilit]
- Ketola, K.; Hilvo, M.; Hyötyläinen, T.; Vuoristo, A.; Ruskeepää, A.-L.; Orešič, M.; Kallioniemi, O.; Iljin, K. Salinomycin inhibits prostate cancer growth and migration via induction of oxidative stress. Br. J. Cancer 2012, 106, 99–106. [Google Scholar] [CrossRef] [Scilit]
- Tahata, S.; Yuan, B.; Kikuchi, H.; Takagi, N.; Hirano, T.; Toyoda, H. Cytotoxic effects of pyrrolidine dithiocarbamate in small-cell lung cancer cells, alone and in combination with cisplatin. Int. J. Oncol. 2014, 45, 1749–1759. [Google Scholar] [CrossRef] [Scilit]







| Target Gene | Sequence 5′–3′ |
|---|---|
| NMYC (genomic) | CGCAAAAGCCACCTCTCATTA |
| Rev-NMYC (genomic) | TCCAGCAGATGCCACATAAGG |
| MYC (genomic) | AAAAGTGGGCGGCTGGATAC |
| Rev-MYC (genomic) | AGGGATGGGAGGAAACGCTA |
| Syndecan 4 (genomic) | CAGGGTCTGGGAGCCAAGT |
| Rev-Syndecan 4 (genomic) | GCACAGTGCTGGACATTGACA |
| Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (genomic) | AGACTGGCTCTTAAAAAGTGCAGG |
| Rev-GAPDH (genomic) | TGCTGTAGCCAAATTCGTTGTC |
| Beta-actin (ACTB) | CTTCGCGGGCGACGAT |
| Rev-ACTB | CCACATAGGAATCCTTCTGACC |
| Cyclin D1 (CCND1) | ATGCCAACCTCCTCAACGAC |
| Rev-CCND1 | TCTGTTCCTCGCAGACCTCC |
| Cyclin D3 (CCND3) | ACTGGCACTGAAGTGGACTG |
| Rev-CCND3 | GGGCTACAGGTGTATGGCTG |
| Lactate dehydrogenase A (LDHA) | CTTGACCTACGTGGCTTGGA |
| Rev-LDHA | CCAGCCTTTCCCCCATTAGG |
| Ribosomal protein L5 (RPL5) | CAGCGTATGCACACGAACTG |
| Rev-RPL5 | ACCTATTGAGAAGCCTGCGG |
| Ribosomal protein L14 (RPL14) | TTGGACCTCATGCCGGAAAA |
| Rev-RPL14 | GCACTGTGCGGAAACTTGAG |
| Ribosomal protein L28 (RPL28) | CTCTTTCCGTCTCAGGTCGC |
| Rev-RPL28 | TCTTGCGGTGAATCAGTCCG |
| Ribosomal protein P1 (RPLP1) | TGAAAACTGCACTGGGGTGG |
| Rev-RPLP1 | AGGGTAAATACCCAGGAGGCT |
| GAPDH Rev-GAPDH | CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT |
| MYC | GGCACTTTGCACTGGAACTT |
| Rev-MYC | AGGCTGCTGGTTTTCCACTA |
| Treatment | Concentration | Target | Survival Rate of SCC-Derived LCSC-Like Cells | Survival Rate of AD-Derived LCSC-Like Cells |
|---|---|---|---|---|
| KJ-Pyr-9 | 1 µM | MYC | 96.35% (±1.23) | 103.0% (±1.99) |
| KJ-Pyr-9 | 5 µM | MYC | 91.77% (±2.86) | 102.1% (±2.16) |
| KJ-Pyr-9 | 10 µM | MYC | 74.22% (±3.17) | 88.38% (±4.11) |
| KJ-Pyr-9 | 20 µM | MYC | 3.86% (±0.30) | 3.80% (±0.65) |
| PDTC 1 | 100 µM | NF-κB | 14.60% (±2.17) | 24.16% (±6.04) |
| Dexa 2 | 300 µM | NF-κB | 27.17% (±5.17) | 26.24% (±5.12) |
| PDTC + Dexa | 100 µM/300 µM | NF-κB | 14.61% (±1.91) | 16.33% (±3.29) |
| KJ-Pyr-9 + PDTC | 10 µM/100 µM | MYC/NF-κB | 11.18% (±1.48) | 18.84% (±5.25) |
| KJ-Pyr-9 + Dexa | 10 µM/300 µM | MYC/NF-κB | 22.53% (±2.95) | 20.09% (±1.90) |
| KJ-Pyr-9 + PDTC + Dexa | 10 µM/100 µM/300 µM | MYC/NF-κB | 13.40% (±1.60) | 16.84% (±3.61) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Windmöller, B.A.; Beshay, M.; Helweg, L.P.; Flottmann, C.; Beermann, M.; Förster, C.; Wilkens, L.; Greiner, J.F.W.; Kaltschmidt, C.; Kaltschmidt, B. Novel Primary Human Cancer Stem-Like Cell Populations from Non-Small Cell Lung Cancer: Inhibition of Cell Survival by Targeting NF-κB and MYC Signaling. Cells 2021, 10, 1024. https://doi.org/10.3390/cells10051024
Windmöller BA, Beshay M, Helweg LP, Flottmann C, Beermann M, Förster C, Wilkens L, Greiner JFW, Kaltschmidt C, Kaltschmidt B. Novel Primary Human Cancer Stem-Like Cell Populations from Non-Small Cell Lung Cancer: Inhibition of Cell Survival by Targeting NF-κB and MYC Signaling. Cells. 2021; 10(5):1024. https://doi.org/10.3390/cells10051024
Chicago/Turabian StyleWindmöller, Beatrice A., Morris Beshay, Laureen P. Helweg, Clara Flottmann, Miriam Beermann, Christine Förster, Ludwig Wilkens, Johannes F. W. Greiner, Christian Kaltschmidt, and Barbara Kaltschmidt. 2021. "Novel Primary Human Cancer Stem-Like Cell Populations from Non-Small Cell Lung Cancer: Inhibition of Cell Survival by Targeting NF-κB and MYC Signaling" Cells 10, no. 5: 1024. https://doi.org/10.3390/cells10051024
APA StyleWindmöller, B. A., Beshay, M., Helweg, L. P., Flottmann, C., Beermann, M., Förster, C., Wilkens, L., Greiner, J. F. W., Kaltschmidt, C., & Kaltschmidt, B. (2021). Novel Primary Human Cancer Stem-Like Cell Populations from Non-Small Cell Lung Cancer: Inhibition of Cell Survival by Targeting NF-κB and MYC Signaling. Cells, 10(5), 1024. https://doi.org/10.3390/cells10051024

