Characterization of Early-Onset Finger Osteoarthritis-Like Condition Using Patient-Derived Induced Pluripotent Stem Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient Consent and Ethical Procedures
2.2. Dermal Fibroblast Isolation and Maintenance
2.3. hiPSC Generation Using Patient-Derived Dermal Fibroblasts
2.4. Chondrogenic Differentiation Using Pellet Culture
2.5. Real Time-Polymerase Chain Reaction (PCR)
2.6. Immunocytochemical Staining of iPSCs
2.7. Histological Analysis of Pellets
2.8. Inflammatory Cytokine and Matrix Metalloproteinase (MMP) Array
2.9. Statistical Analysis
3. Results
3.1. Generation of hiPSCs from Fibroblasts of a Patient with Early-Onset Finger OA (efOA)
3.2. Chondrogenic Differentiation Using efOA-hiPSCs
3.3. Characterization of efOA Using Early-Stage CPs
3.4. Cytokine and MMP Analysis in Early Stage efOA-CP Culture Media Supernatant
3.5. Analysis of Inflammatory Cytokines and MMPs in Early and Late Stage efOA-CPs
3.6. Analysis of Inflammatory Cytokines and MMPs in Early and Late Stage efOA-CPs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Castro-Viñuelas, R.; Sanjurjo-Rodríguez, C.; Piñeiro-Ramil, M.; Hermida-Gómez, T.; Rodríguez-Fernández, S.; Oreiro, N.; De Toro, J.; Fuentes, I.; Blanco, F.J.; Díaz-Prado, S. Generation and characterization of human induced pluripotent stem cells (iPSCs) from hand osteoarthritis patient-derived fibroblasts. Sci. Rep. 2020, 10, 4272. [Google Scholar] [CrossRef] [Green Version]
- Marshall, M.; Watt, F.E.; Vincent, T.L.; Dziedzic, K. Hand osteoarthritis: Clinical phenotypes, molecular mechanisms and disease management. Nat. Rev. Rheumatol. 2018, 14, 641–656. [Google Scholar] [CrossRef] [PubMed]
- Qin, J.; Barbour, K.E.; Murphy, L.B.; Nelson, A.E.; Schwartz, T.A.; Helmick, C.G.; Allen, K.D.; Renner, J.B.; Baker, N.A.; Jordan, J.M. Lifetime Risk of Symptomatic Hand Osteoarthritis: The Johnston County Osteoarthritis Project. Arthritis Rheumatol. 2017, 69, 1204–1212. [Google Scholar] [CrossRef]
- Kumar, S.; Blangero, J.; Curran, J.E. Induced Pluripotent Stem Cells in Disease Modeling and Gene Identification. Methods Mol. Biol. 2018, 1706, 17–38. [Google Scholar] [CrossRef]
- Rim, Y.A.; Nam, Y.; Park, N.; Jung, H.; Jang, Y.; Lee, J.; Ju, J.H. Different Chondrogenic Potential among Human Induced Pluripotent Stem Cells from Diverse Origin Primary Cells. Stem Cells Int. 2018, 2018, 9432616. [Google Scholar] [CrossRef] [Green Version]
- Suga, M.; Kondo, T.; Imamura, K.; Shibukawa, R.; Okanishi, Y.; Sagara, Y.; Tsukita, K.; Enami, T.; Furujo, M.; Saijo, K.; et al. Generation of a human induced pluripotent stem cell line, BRCi001-A, derived from a patient with mucopolysaccharidosis type I. Stem Cell Res. 2019, 36, 101406. [Google Scholar] [CrossRef]
- Lee, J.; Kim, Y.; Yi, H.; Diecke, S.; Kim, J.; Jung, H.; Rim, Y.A.; Jung, S.M.; Kim, M.; Kim, Y.G.; et al. Generation of disease-specific induced pluripotent stem cells from patients with rheumatoid arthritis and osteoarthritis. Arthritis Res. Ther. 2014, 16, R41. [Google Scholar] [CrossRef] [Green Version]
- Willard, V.P.; Diekman, B.O.; Sanchez-Adams, J.; Christoforou, N.; Leong, K.W.; Guilak, F. Use of Cartilage Derived From Murine Induced Pluripotent Stem Cells for Osteoarthritis Drug Screening. Arthritis Rheumatol. 2014, 66, 3062–3072. [Google Scholar] [CrossRef] [Green Version]
- Rim, Y.A.; Nam, Y.; Park, N.; Jung, H.; Lee, K.; Lee, J.; Ju, J.H. Chondrogenic Differentiation from Induced Pluripotent Stem Cells Using Non-Viral Minicircle Vectors. Cells 2020, 9, 582. [Google Scholar] [CrossRef]
- Nam, Y.; Rim, Y.A.; Ju, J.H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. 2017, e55988. [Google Scholar] [CrossRef] [PubMed]
- Nam, Y.; Rim, Y.A.; Jung, S.M.; Ju, J.H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res. Ther. 2017, 8, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rim, Y.A.; Nam, Y.; Park, N.; Lee, J.; Park, S.-H.; Ju, J.H. Repair potential of nonsurgically delivered induced pluripotent stem cell-derived chondrocytes in a rat osteochondral defect model. J. Tissue Eng. Regen. Med. 2018, 12, 1843–1855. [Google Scholar] [CrossRef] [PubMed]
- Mobasheri, A.; Trujillo, E.; Bell, S.; Carter, S.D.; Clegg, P.D.; Martín-Vasallo, P.; Marples, D. Aquaporin water channels AQP1 and AQP3, are expressed in equine articular chondrocytes. Vet. J. 2004, 168, 143–150. [Google Scholar] [CrossRef]
- Tan, C.; Zhang, J.; Chen, W.; Feng, F.; Yu, C.; Lu, X.; Lin, R.; Li, Z.; Huang, Y.; Zheng, L.; et al. Inflammatory cytokines via up-regulation of aquaporins deteriorated the pathogenesis of early osteoarthritis. PLoS ONE 2019, 14, e0220846. [Google Scholar] [CrossRef] [Green Version]
- Parrini, M.; Ghezzi, D.; Deidda, G.; Medrihan, L.; Castroflorio, E.; Alberti, M.; Baldelli, P.; Cancedda, L.; Contestabile, A. Aerobic exercise and a BDNF-mimetic therapy rescue learning and memory in a mouse model of Down syndrome. Sci. Rep. 2017, 7, 16825. [Google Scholar] [CrossRef]
- Murthi, P.; Fitzpatrick, E.; Borg, A.J.; Donath, S.; Brennecke, S.P.; Kalionis, B. GAPDH, 18S rRNA and YWHAZ are Suitable Endogenous Reference Genes for Relative Gene Expression Studies in Placental Tissues from Human Idiopathic Fetal Growth Restriction. Placenta 2008, 29, 798–801. [Google Scholar] [CrossRef] [PubMed]
- Hwang, E.H.; Kim, T.H.; Oh, S.M.; Lee, K.B.; Yang, S.J.; Park, J.H. Toll/IL-1 domain-containing adaptor inducing IFN-β (TRIF) mediates innate immune responses in murine peritoneal mesothelial cells through TLR3 and TLR4 stimulation. Cytokine 2016, 77, 127–134. [Google Scholar] [CrossRef]
- Sancéau, J.; Falcoff, R.; Beranger, F.; Carter, D.B.; Wietzerbin, J. Secretion of interleukin-6 (IL-6) by human monocytes stimulated by muramyl dipeptide and tumour necrosis factor alpha. Immunology 1990, 69, 52–56. [Google Scholar]
- Afshari, J.T.; Ghomian, N.; Shameli, A.; Shakeri, M.T.; Fahmidehkar, M.A.; Mahajer, E.; Khoshnavaz, R.; Emadzadeh, M. Determination of Interleukin-6 and Tumor Necrosis Factor-alpha concentrations in Iranian-Khorasanian patients with preeclampsia. BMC Pregnancy Childbirth 2005, 5, 14. [Google Scholar] [CrossRef] [Green Version]
- Doss, M.X.; Sachinidis, A. Current Challenges of iPSC-Based Disease Modeling and Therapeutic Implications. Cells 2019, 8, 403. [Google Scholar] [CrossRef] [Green Version]
- Gunaseeli, I.; Doss, M.X.; Antzelevitch, C.; Hescheler, J.; Sachinidis, A. Induced pluripotent stem cells as a model for accelerated patient- and disease-specific drug discovery. Curr. Med. Chem. 2010, 17, 759–766. [Google Scholar] [CrossRef] [Green Version]
- Roughley, P.J.; Mort, J.S. The role of aggrecan in normal and osteoarthritic cartilage. J. Exp. Orthop. 2014, 1, 8. [Google Scholar] [CrossRef] [Green Version]
- Grunwald, L.-M.; Stock, R.; Haag, K.; Buckenmaier, S.; Eberle, M.-C.; Wildgruber, D.; Storchak, H.; Kriebel, M.; Weißgraeber, S.; Mathew, L.; et al. Comparative characterization of human induced pluripotent stem cells (hiPSC) derived from patients with schizophrenia and autism. Transl. Psychiatry 2019, 9, 179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, M.D.; Triantafillou, S.; Parker, A.; Youssef, P.P.; Coleman, M. Synovial membrane inflammation and cytokine production in patients with early osteoarthritis. J. Rheumatol. 1997, 24, 365–371. [Google Scholar] [PubMed]
- Vignon, E.; Balblanc, J.C.; Mathieu, P.; Louisot, P.; Richard, M. Metalloprotease activity, phospholipase A2 activity and cytokine concentration in osteoarthritis synovial fluids. Osteoarthr. Cartil. 1993, 1, 115–120. [Google Scholar] [CrossRef]
- Stannus, O.; Jones, G.; Cicuttini, F.; Parameswaran, V.; Quinn, S.; Burgess, J.; Ding, C. Circulating levels of IL-6 and TNF-α are associated with knee radiographic osteoarthritis and knee cartilage loss in older adults. Osteoarthr. Cartil. 2010, 18, 1441–1447. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laavola, M.; Leppänen, T.; Hämäläinen, M.; Vuolteenaho, K.; Moilanen, T.; Nieminen, R.; Moilanen, E. IL-6 in Osteoarthritis: Effects of Pine Stilbenoids. Molecules 2018, 24, 109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blumenfeld, O.; Williams, F.M.; Valdes, A.; Hart, D.J.; Malkin, I.; Spector, T.D.; Livshits, G. Association of interleukin-6 gene polymorphisms with hand osteoarthritis and hand osteoporosis. Cytokine 2014, 69, 94–101. [Google Scholar] [CrossRef]
- Akeson, G.; Malemud, C.J. A Role for Soluble IL-6 Receptor in Osteoarthritis. J. Funct. Morphol. Kinesiol. 2017, 2, 27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huebner, J.L.; Seifer, D.R.; Kraus, V.B. A longitudinal analysis of serum cytokines in the Hartley guinea pig model of osteoarthritis. Osteoarthr. Cartil. 2007, 15, 354–356. [Google Scholar] [CrossRef] [Green Version]
- Nasi, S.; So, A.; Combes, C.; Daudon, M.; Busso, N. Interleukin-6 and chondrocyte mineralisation act in tandem to promote experimental osteoarthritis. Ann. Rheum. Dis. 2016, 75, 1372–1379. [Google Scholar] [CrossRef] [Green Version]
- Okada, Y.; Shinmei, M.; Tanaka, O.; Naka, K.; Kimura, A.; Nakanishi, I.; Bayliss, M.T.; Iwata, K.; Nagase, H. Localization of matrix metalloproteinase 3 (stromelysin) in osteoarthritic cartilage and synovium. Lab. Investig. 1992, 66, 680–690. [Google Scholar] [PubMed]
- He, Y.; Moqbel, S.A.A.; Xu, L.; Ran, J.; Ma, C.; Xu, K.; Bao, J.; Jiang, L.; Chen, W.; Xiong, Y.; et al. Costunolide inhibits matrix metalloproteinases expression and osteoarthritis via the NF-κB and Wnt/β-catenin signaling pathways. Mol. Med. Rep. 2019, 20, 312–322. [Google Scholar] [CrossRef] [Green Version]
- Mahmoud, R.K.; El-Ansary, A.K.; El-Eishi, H.H.; Kamal, H.M.; El-Saeed, N.H. Matrix metalloproteinases MMP-3 and MMP-1 levels in sera and synovial fluids in patients with rheumatoid arthritis and osteoarthritis. Ital. J. Biochem. 2005, 54, 248–257. [Google Scholar]
- Stone, A.V.; Loeser, R.F.; Vanderman, K.S.; Long, D.L.; Clark, S.C.; Ferguson, C.M. Pro-inflammatory stimulation of meniscus cells increases production of matrix metalloproteinases and additional catabolic factors involved in osteoarthritis pathogenesis. Osteoarthr. Cartil. 2014, 22, 264–274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Samuvel, D.J.; Sundararaj, K.P.; Lopes-Virella, M.F.; Huang, Y. IL-6 and high glucose synergistically upregulate MMP-1 expression by U937 mononuclear phagocytes via ERK1/2 and JNK pathways and c-Jun. J. Cell. Biochem. 2010, 110, 248–259. [Google Scholar] [CrossRef] [Green Version]
- Bai, B.; Li, Y. Combined detection of serum CTX-II and COMP concentrations in osteoarthritis model rabbits: An effective technique for early diagnosis and estimation of disease severity. J. Orthop. Surg. Res. 2016, 11, 149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, Y.M.; Kim, S.J.; Lee, K.J.; Yang, S.S.; Min, B.-H.; Yoon, H.C. Detection of CTX-II in serum and urine to diagnose osteoarthritis by using a fluoro-microbeads guiding chip. Biosens. Bioelectron. 2015, 67, 192–199. [Google Scholar] [CrossRef]
- Xin, L.; Wu, Z.; Qu, Q.; Wang, R.; Tang, J.; Chen, L. Comparative study of CTX-II, Zn2+, and Ca2+ from the urine for knee osteoarthritis patients and healthy individuals. Medicine 2017, 96, e7593. [Google Scholar] [CrossRef]
- Zhang, S.; Zhong, Y.; Li, R.; Wang, W.; Zeng, L.; Wang, Z.; Jia, P.; Wu, R. Experimental chondrocyte hypertrophy is promoted by the activation of discoidin domain receptor 2. Mol. Med. Rep. 2014, 10, 1543–1548. [Google Scholar] [CrossRef] [PubMed]
Description | Target Name | REFSEQ_ID | Direction | Primer Sequence (5′–3′) | Size |
---|---|---|---|---|---|
Pluripotency marker | OCT4 | NM_203289.5 | Forward | GGGAAATGGGAGGGGTGCAAAAGAGG | 151 |
Reverse | TTGCGTGAGTGTGGATGGGATTGGTG | ||||
KLF4 | NM_004235.4 | Forward | TTCCCATCTCAAGGCACAC | 158 | |
Reverse | GGTCGCATTTTTGGCACT | ||||
NANOG | NM_024865.2 | Forward | AAAGGCAAACAACCCACT | 270 | |
Reverse | GCTATTCTTCGGCCAGTT | ||||
LIN28 | NM_024674.4 | Forward | GTTCGGCTTCCTGTCCAT | 122 | |
Reverse | CTGCCTCACCCTCCTTCA | ||||
Chondrogenic marker | SOX9 | NM_000346 | Forward | GACTTCCGCGACGTGGAC | 99 |
Reverse | GTTGGGCGGCAGGTACTG | ||||
COL2A1 | NM_001844 | Forward | GGCAATAGCAGGTTCACGTACA | 79 | |
Reverse | CGATAACAGTCTTGCCCCACTTA | ||||
COL1A1 | NM_000088.3 | Forward | TCTGCGACAACGGCAAGGTG | 146 | |
Reverse | GACGCCGGTGGTTTCTTGGT | ||||
Hypertrophy marker | COL10A1 | NM_000493.3 | Forward | CAGGCATAAAAGGCCCAC | 108 |
Reverse | GTGGACCAGGAGTACCTTGC | ||||
RUNX2 | NM_001024630 | Forward | CCAGATGGGACTGTGGTTACTG | 65 | |
Reverse | TTCCGGAGCTCAGCAGAATAA | ||||
VEGFA | NM_003376.6 | Forward | CTACCTCCACCATGCCAAGT | 109 | |
Reverse | GCAGTAGCTGCGCTGATAGA | ||||
MMP13 | NM_002427.4 | Forward | TCCCAGGAATTGGTGATAAAGTAGA | 123 | |
Reverse | CTGGCATGACGCGAACAATA | ||||
Inflammatory cytokines | IL1B | NM_000576.2 | Forward | ACAGATGAAGTGCTCCTTCCA | 73 |
Reverse | GTCGGAGATTCGTAGCTGGAT | ||||
IL6 | NM_000600.5 | Forward | GGTACATCCTCGACGGCATCT | 81 | |
Reverse | GTGCCTCTTTGCTGCTTTCAC | ||||
TNFA | NM_000594.4 | Forward | CTTCTCCTTCCTGATCGTGG | 266 | |
Reverse | GCTGGTTATCTCTCAGCTCCA | ||||
MMPs | MMP1 | NM_002421.4 | Forward | CTGGCCACAACTGCCAAATG | 103 |
Reverse | CTGTCCCTGAACAGCCCAGTACTTA | ||||
MMP10 | NM_002425.3 | Forward | CATTCCTTGTGCTGTTGTGTC | 225 | |
Reverse | TGTCTAGCTTCCCTGTCACC | ||||
House-keeping gene | GAPDH | NM_002046.5 | Forward | ACCCACTCCTCCACCTTTGA | 101 |
Reverse | CTGTTGCTGTAGCCAAATTCGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rim, Y.A.; Nam, Y.; Park, N.; Lee, K.; Jung, H.; Jung, S.M.; Lee, J.; Ju, J.H. Characterization of Early-Onset Finger Osteoarthritis-Like Condition Using Patient-Derived Induced Pluripotent Stem Cells. Cells 2021, 10, 317. https://doi.org/10.3390/cells10020317
Rim YA, Nam Y, Park N, Lee K, Jung H, Jung SM, Lee J, Ju JH. Characterization of Early-Onset Finger Osteoarthritis-Like Condition Using Patient-Derived Induced Pluripotent Stem Cells. Cells. 2021; 10(2):317. https://doi.org/10.3390/cells10020317
Chicago/Turabian StyleRim, Yeri Alice, Yoojun Nam, Narae Park, Kijun Lee, Hyerin Jung, Seung Min Jung, Jennifer Lee, and Ji Hyeon Ju. 2021. "Characterization of Early-Onset Finger Osteoarthritis-Like Condition Using Patient-Derived Induced Pluripotent Stem Cells" Cells 10, no. 2: 317. https://doi.org/10.3390/cells10020317