Human Renal Fibroblasts, but Not Renal Epithelial Cells, Induce IL-1β Release during a Uropathogenic Escherichia coli Infection In Vitro
Abstract
1. Introduction
2. Methods
2.1. Cell and Bacterial Culture
2.2. CRISPR/Cas9 Genome Editing
2.3. Stimulation of Renal Fibroblasts and Renal Epithelial Cells
2.4. RNA Isolation and Real Time RT-PCR
2.5. Measurement of IL-1β and LDH Release
2.6. Caspase-1 and Caspase-4 Activity Assay
2.7. Western Blot Analysis
2.8. Immunofluorescence
2.9. Conditioned Medium
2.10. Neutrophil Isolation
2.11. Measurement of Reactive Oxygen Species (ROS)
2.12. Phagocytosis Assay
2.13. Statistical Analysis
3. Results
3.1. IL-1β and LDH Release from Renal Fibroblasts and Renal Epithelial Cells
3.2. The UPEC-Strain CFT073 Induces Inflammasome Activation
3.3. Signaling Pathways Associated with CFT073 Mediated IL-1β and LDH Release
3.4. α-Hemolysin Mediates IL-1β Release from Renal Fibroblasts
3.5. Involvement of Caspase-1, Caspase-4, NLRP3 and Gasdermin D in the Release of IL-1β and LDH
3.6. Phagocytosis and ROS-Production
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Flores-Mireles, A.L.; Walker, J.N.; Caparon, M.G.; Hultgren, S.J. Urinary tract infections: Epidemiology, mechanisms of infection and treatment options. Nat. Rev. Microbiol. 2015, 13, 269–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foxman, B. Epidemiology of urinary tract infections: Incidence, morbidity, and economic costs. Am. J. Med. 2002, 113, 5–13. [Google Scholar] [CrossRef] [Scilit]
- Efstathiou, S.P.; Pefanis, A.V.; Tsioulos, D.I.; Zacharos, I.D.; Tsiakou, A.G.; Mitromaras, A.G.; Mastorantonakis, S.E.; Kanavaki, S.N.; Mountokalakis, T.D. Acute Pyelonephritis in Adults. Arch. Intern. Med. 2003, 163, 1206–1212. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.R. papG alleles among Escherichia coli strains causing urosepsis: Associations with other bacterial charac-teristics and host compromise. Infect. Immun. 1998, 66, 4568–4571. [Google Scholar] [CrossRef]
- Johnson, J.R.; Porter, S.B.; Johnston, B.; Kuskowski, M.A.; Spurbeck, R.R.; Mobley, H.L.; Williamson, D.A. Host Characteristics and Bacterial Traits Predict Experimental Virulence for Escherichia coli Bloodstream Isolates From Patients With Urosepsis. Open Forum Infect. Dis. 2015, 2, ofv083. [Google Scholar] [CrossRef] [Scilit]
- Fleischmann, M.C.; Scherag, A.; Adhikari, N.K.J.; Hartog, C.S.; Tsaganos, T.; Schlattmann, P.; Angus, D.C.; Reinhart, K. Assessment of Global Incidence and Mortality of Hospital-treated Sepsis. Current Estimates and Limitations. Am. J. Respir. Crit. Care Med. 2016, 193, 259–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagenlehner, F.M.; Lichtenstern, C.; Rolfes, C.; Mayer, K.; Uhle, F.; Weidner, W.; A Weigand, M. Diagnosis and management for urosepsis. Int. J. Urol. 2013, 20, 963–970. [Google Scholar] [CrossRef] [Scilit]
- Van Linthout, S.; Miteva, K.; Tschöpe, C. Crosstalk between fibroblasts and inflammatory cells. Cardiovasc. Res. 2014, 102, 258–269. [Google Scholar] [CrossRef] [Scilit]
- Parsonage, G.; Filer, A.D.; Haworth, O.; Nash, G.; Rainger, G.E.; Salmon, M.; Buckley, C.D. A stromal address code defined by fibroblasts. Trends Immunol. 2005, 26, 150–156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palm, E.; Demirel, I.; Bengtsson, T.; Khalaf, H. The role of toll-like and protease-activated receptors and associated intracellular signaling inPorphyromonas gingivalis-infected gingival fibroblasts. APMIS 2017, 125, 157–169. [Google Scholar] [CrossRef] [Scilit]
- Engström, K.K.; Zhang, B.; Demirel, I. Human renal fibroblasts are strong immunomobilizers during a urinary tract infection mediated by uropathogenic Escherichia coli. Sci. Rep. 2019, 9, 2296. [Google Scholar] [CrossRef] [Scilit]
- Xue, Y.; Tuipulotu, D.E.; Tan, W.H.; Kay, C.; Man, S.M. Emerging Activators and Regulators of Inflammasomes and Pyroptosis. Trends Immunol. 2019, 40, 1035–1052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viganò, E.; Diamond, C.; Spreafico, R.; Balachander, A.; Sobota, R.; Mortellaro, A. Human caspase-4 and caspase-5 regulate the one-step non-canonical inflammasome activation in monocytes. Nat. Commun. 2015, 6, 8761. [Google Scholar] [CrossRef] [Scilit]
- An, J.; Kim, S.H.; Hwang, D.; Lee, K.E.; Kim, M.J.; Yang, E.G.; Kim, S.Y.; Chung, H.S. Caspase-4 disaggregates lipopolysaccharide micelles via LPS-CARD interaction. Sci. Rep. 2019, 9, 826. [Google Scholar] [CrossRef] [Scilit]
- Anderson, G.G.; Dodson, K.W.; Hooton, T.M.; Hultgren, S.J. Intracellular bacterial communities of uropathogenic Escherichia coli in urinary tract pathogenesis. Trends Microbiol. 2004, 12, 424–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hannan, T.; Totsika, M.; Mansfield, K.; Moore, K.H.; Schembri, M.; Hultgren, S.J. Host–pathogen checkpoints and population bottlenecks in persistent and intracellular uropathogenicEscherichia colibladder infection. FEMS Microbiol. Rev. 2012, 36, 616–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Demirel, I.; Persson, A.; Brauner, A.; Särndahl, E.; Kruse, R.; Persson, K. Activation of the NLRP3 Inflammasome Pathway by Uropathogenic Escherichia coli Is Virulence Factor-Dependent and Influences Colonization of Bladder Epithelial Cells. Front. Cell. Infect. Microbiol. 2018, 8, 81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagamatsu, K.; Hannan, T.; Guest, R.L.; Kostakioti, M.; Hadjifrangiskou, M.; Binkley, J.; Dodson, K.; Raivio, T.; Hultgren, S.J. Dysregulation ofEscherichia coliα-hemolysin expression alters the course of acute and persistent urinary tract infection. Proc. Natl. Acad. Sci. USA 2015, 112, E871–E880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Demirel, I.; Persson, A.; Brauner, A.; Särndahl, E.; Kruse, R.; Persson, K. Activation of NLRP3 by uropathogenic Escherichia coli is associated with IL-1β release and regulation of antimicrobial properties in human neutrophils. Sci. Rep. 2020, 10, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Verma, V.; Gupta, S.; Kumar, P.; Yadav, S.; Dhanda, R.S.; Gaind, R.; Arora, R.; Frimodt-Møller, N.; Yadav, M. Involvement of NLRP3 and NLRC4 Inflammasome in Uropathogenic E. coli Mediated Urinary Tract Infections. Front. Microbiol. 2019, 10, 2020. [Google Scholar] [CrossRef] [Scilit]
- Waldhuber, A.; Puthia, M.; Wieser, A.; Cirl, C.; Dürr, S.; Neumann-Pfeifer, S.; Albrecht, S.; Römmler, F.; Müller, T.; Zheng, Y.; et al. Uropathogenic Escherichia coli strain CFT073 disrupts NLRP3 inflammasome activation. J. Clin. Investig. 2016, 126, 2425–2436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hertting, O.; Khalil, A.; Jaremko, G.; Chromek, M.; Li, Y.-H.; Bakhiet, M.; Bartfai, T.; Tullus, K.; Brauner, A. Enhanced chemokine response in experimental acute Escherichia coli pyelonephritis in IL-1β -deficient mice. Clin. Exp. Immunol. 2003, 131, 225–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ambite, I.; Puthia, M.; Nagy, K.; Cafaro, C.; Nadeem, A.; Butler, D.; Rydström, G.; Filenko, N.A.; Wullt, B.; Miethke, T.; et al. Molecular Basis of Acute Cystitis Reveals Susceptibility Genes and Immunotherapeutic Targets. PLoS Pathog. 2016, 12, e1005848. [Google Scholar] [CrossRef] [Scilit]
- A Müller, G.; Frank, J.; Rodemann, H.P.; Engler-Blum, G. Human renal fibroblast cell lines (tFKIF and tNKF) are new tools to investigate pathophysiologic mechanisms of renal interstitial fibrosis. Exp Nephrol 1995, 3, 127–133. [Google Scholar]
- Mobley, H.; Green, D.M.; Trifillis, A.L.; E Johnson, D.; Chippendale, G.R.; Lockatell, C.V.; Jones, B.D.; Warren, J.W. Pyelonephritogenic Escherichia coli and killing of cultured human renal proximal tubular epithelial cells: Role of hemolysin in some strains. Infect. Immun. 1990, 58, 1281–1289. [Google Scholar] [CrossRef] [Scilit]
- Yadav, M.; Zhang, J.; Fischer, H.; Huang, W.; Lutay, N.; Cirl, C.; Lum, J.; Miethke, T.; Svanborg, C. Inhibition of TIR Domain Signaling by TcpC: MyD88-Dependent and Independent Effects on Escherichia coli Virulence. PLoS Pathog. 2010, 6, e1001120. [Google Scholar] [CrossRef] [Scilit]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lindblad, A.; Persson, K.; Demirel, I. IL-1RA is part of the inflammasome-regulated immune response in bladder epithelial cells and influences colonization of uropathogenic E. coli. Cytokine 2019, 123, 154772. [Google Scholar] [CrossRef] [Scilit]
- Khalil, A.; Tullus, K.; Bartfai, T.; Bakhiet, M.; Jaremko, G.; Brauner, A. Renal cytokine responses in acute Escherichia coli pyelonephritis in IL-6-deficient mice. Clin. Exp. Immunol. 2000, 122, 200–206. [Google Scholar] [CrossRef] [Scilit]
- Poljakovic, M.; Karpman, D.; Svanborg, C.; Persson, K. Human renal epithelial cells express iNOS in response to cy-tokines but not bacteria. Kidney Int. 2002, 61, 444–455. [Google Scholar] [CrossRef] [Scilit]
- Godaly, G.; Hang, L.; Frendéus, B.; Svanborg, C. Transepithelial Neutrophil Migration Is CXCR1 Dependent In Vitro and Is Defective in IL-8 Receptor Knockout Mice. J. Immunol. 2000, 165, 5287–5294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Symington, J.W.; Wang, C.; Twentyman, J.; Owusu-Boaitey, N.; A Schwendener, R.; Núñez, G.; Schilling, J.D.; Mysorekar, I.U. ATG16L1 deficiency in macrophages drives clearance of uropathogenic E. coli in an IL-1β-dependent manner. Mucosal Immunol. 2015, 8, 1388–1399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chun, J.; Chung, H.; Wang, X.; Barry, R.; Taheri, Z.M.; Platnich, J.; Ahmed, S.B.; Trpkov, K.; Hemmelgarn, B.; Benediktsson, H.; et al. NLRP3 Localizes to the Tubular Epithelium in Human Kidney and Correlates With Outcome in IgA Nephropathy. Sci. Rep. 2016, 6, 24667. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.-M.; Kim, Y.G.; Kim, D.-J.; Park, S.H.; Jeong, K.-H.; Lee, Y.H.; Lim, S.J.; Lee, S.-H.; Moon, J.-Y. Inflammasome-Independent Role of NLRP3 Mediates Mitochondrial Regulation in Renal Injury. Front. Immunol. 2018, 9, 2563. [Google Scholar] [CrossRef] [Scilit]
- Kelly, P.; Meade, K.G.; O’Farrelly, C. Non-canonical Inflammasome-Mediated IL-1β Production by Primary Endometrial Epithelial and Stromal Fibroblast Cells Is NLRP3 and Caspase-4 Dependent. Front. Immunol. 2019, 10, 102. [Google Scholar] [CrossRef] [Scilit]
- Tourneur, L.; Witko-Sarsat, V. Inflammasome activation: Neutrophils go their own way. J. Leukoc. Biol. 2019, 105, 433–436. [Google Scholar] [CrossRef] [Scilit]
- Broz, P.; Dixit, V.M. Inflammasomes: Mechanism of assembly, regulation and signalling. Nat. Rev. Immunol. 2016, 16, 407–420. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.-S.; Shin, D.-M.; Jo, E.-K. The Role of NLR-related Protein 3 Inflammasome in Host Defense and Inflammatory Diseases. Int. Neurourol. J. 2012, 16, 2–12. [Google Scholar] [CrossRef] [Scilit]
- Ghonime, M.G.; Shamaa, O.R.; Das, S.; Eldomany, R.A.; Fernandes-Alnemri, T.; Alnemri, E.S.; Gavrilin, M.A.; Wewers, M.D. Inflammasome Priming by Lipopolysaccharide Is Dependent upon ERK Signaling and Proteasome Function. J. Immunol. 2014, 192, 3881–3888. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moon, J.-S.; Lee, S.; Park, M.-A.; Siempos, I.I.; Haslip, M.; Lee, P.J.; Yun, M.; Kim, C.K.; Howrylak, J.; Ryter, S.W.; et al. UCP2-induced fatty acid synthase promotes NLRP3 inflammasome activation during sepsis. J. Clin. Investig. 2015, 125, 665–680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shio, M.; Christian, J.G.; Jung, J.Y.; Chang, K.-P.; Olivier, M. PKC/ROS-Mediated NLRP3 Inflammasome Activation Is Attenuated by Leishmania Zinc-Metalloprotease during Infection. PLoS Negl. Trop. Dis. 2015, 9, e0003868. [Google Scholar] [CrossRef] [Scilit]
- Schreiber, A.; Pham, C.T.; Hu, Y.; Schneider, W.; Luft, F.; Kettritz, R. Neutrophil Serine Proteases Promote IL-1βGeneration and Injury in Necrotizing Crescentic Glomerulonephritis. J. Am. Soc. Nephrol. 2012, 23, 470–482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karmakar, M.; Sun, Y.; Hise, A.G.; Rietsch, A.; Pearlman, E. Cutting Edge: IL-1β Processing during Pseudomonas aeruginosa Infection Is Mediated by Neutrophil Serine Proteases and Is Independent of NLRC4 and Caspase-1. J. Immunol. 2012, 189, 4231–4235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dhakal, B.K.; Mulvey, M.A. The UPEC pore-forming toxin alpha-hemolysin triggers proteolysis of host proteins to disrupt cell adhesion, inflammatory, and survival pathways. Cell Host Microbe 2012, 11, 58–69. [Google Scholar] [CrossRef] [Scilit]
- Bień-Kalinowska, J.; Sokolova, O.; Bozko, P. Role of UropathogenicEscherichia coliVirulence Factors in Development of Urinary Tract Infection and Kidney Damage. Int. J. Nephrol. 2012, 2012, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Lüthje, P.; Brauner, A. Virulence Factors of Uropathogenic E. coli and Their Interaction with the Host. Adv. Microb. Physiol. 2014, 65, 337–372. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.R. Microbial virulence determinants and the pathogenesis of urinary tract infection. Infect. Dis. Clin. N. Am. 2003, 17, 261–278. [Google Scholar] [CrossRef] [Scilit]
- Ristow, L.; Welch, R.A. Hemolysin of uropathogenic Escherichia coli: A cloak or a dagger? Biochim. Biophys. Acta Biomembr. 2016, 1858, 538–545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Svanborg, C.; Bergsten, G.; Fischer, H.; Godaly, G.; Gustafsson, M.; Karpman, D.; Lundstedt, A.-C.; Ragnarsdottir, B.; Svensson, M.; Wullt, B. Uropathogenic Escherichia coli as a model of host–parasite interaction. Curr. Opin. Microbiol. 2006, 9, 33–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haraoka, M.; Hang, L.; Frendéus, B.; Godaly, G.; Burdick, M.; Strieter, R.; Svanborg, C. Neutrophil Recruitment and Resistance to Urinary Tract Infection. J. Infect. Dis. 1999, 180, 1220–1229. [Google Scholar] [CrossRef] [Scilit]
- Fang, F.C. Antimicrobial reactive oxygen and nitrogen species: Concepts and controversies. Nat. Rev. Genet. 2004, 2, 820–832. [Google Scholar] [CrossRef] [Scilit]
- Junger, W.G. Purinergic regulation of neutrophil chemotaxis. Cell. Mol. Life Sci. 2008, 65, 2528–2540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, W.L.; Harrison, R.E.; Grinstein, S. Phagocytosis by neutrophils. Microbes Infect. 2003, 5, 1299–1306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Segal, A.W. How neutrophils kill microbes. Annu. Rev. Immunol. 2005, 23, 197–223. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.G.; Kim, S.-M.; Kim, K.-P.; Lee, S.-H.; Moon, J.-Y. The Role of Inflammasome-Dependent and Inflammasome-Independent NLRP3 in the Kidney. Cells 2019, 8, 1389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chenery, A.L.; Alhallaf, R.; Agha, Z.; Ajendra, J.; Parkinson, J.E.; Cooper, M.M.; Chan, B.H.K.; Eichenberger, R.M.; Dent, L.A.; Robertson, A.A.B.; et al. Inflammasome-Independent Role for NLRP3 in Controlling Innate Antihelminth Immunity and Tissue Repair in the Lung. J. Immunol. 2019, 203, 2724–2734. [Google Scholar] [CrossRef] [Scilit]
- Murthy, A.M.V.; Sullivan, M.J.; Nhu, N.T.K.; Lo, A.W.; Phan, M.-D.; Peters, K.M.; Boucher, D.; Schroder, K.; Beatson, S.A.; Ulett, G.C.; et al. Variation in hemolysin A expression between uropathogenic Escherichia coli isolates determines NLRP3-dependent vs. -independent macrophage cell death and host colonization. FASEB J. 2019, 33, 7437–7450. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.-F.; Nanayakkara, G.; Sun, Y.; Li, X.; Wang, L.; Cueto, R.; Shao, Y.; Fu, H.; Johnson, C.; Cheng, J.; et al. Analyses of caspase-1-regulated transcriptomes in various tissues lead to identification of novel IL-1β-, IL-18- and sirtuin-1-independent pathways. J. Hematol. Oncol. 2017, 10, 40. [Google Scholar] [CrossRef] [Scilit]
- Lakshmanan, U.; Porter, A.G. Caspase-4 Interacts with TNF Receptor-Associated Factor 6 and Mediates Lipopolysaccharide-Induced NF-κB-Dependent Production of IL-8 and CC Chemokine Ligand 4 (Macrophage-Inflammatory Protein-1β). J. Immunol. 2007, 179, 8480–8490. [Google Scholar] [CrossRef] [Scilit]







| Gene Symbol | Oligonucleotide Sequences (5′-3′) |
|---|---|
| pro-IL-1β | F: CCACAGACCTTCCAGGAGAATG R: GTGCAGTTCAGTGATCGTACAGG |
| Pro-Caspase-1 | F: GCTGAGGTTGACATCACAGGCA R: TGCTGTCAGAGGTCTTGTGCTC |
| NLRP3 | F: GGACTGAAGCACCTGTTGTGCA R: TCCTGAGTCTCCCAAGGCATTC |
| GAPDH | F: GTCTCCTCTGACTTCAACAGCG R: ACCACCCTGTTGCTGTAGCCAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kumawat, A.K.; Paramel, G.V.; Demirel, K.J.; Demirel, I. Human Renal Fibroblasts, but Not Renal Epithelial Cells, Induce IL-1β Release during a Uropathogenic Escherichia coli Infection In Vitro. Cells 2021, 10, 3522. https://doi.org/10.3390/cells10123522
Kumawat AK, Paramel GV, Demirel KJ, Demirel I. Human Renal Fibroblasts, but Not Renal Epithelial Cells, Induce IL-1β Release during a Uropathogenic Escherichia coli Infection In Vitro. Cells. 2021; 10(12):3522. https://doi.org/10.3390/cells10123522
Chicago/Turabian StyleKumawat, Ashok Kumar, Geena Varghese Paramel, Kartheyaene Jayaprakash Demirel, and Isak Demirel. 2021. "Human Renal Fibroblasts, but Not Renal Epithelial Cells, Induce IL-1β Release during a Uropathogenic Escherichia coli Infection In Vitro" Cells 10, no. 12: 3522. https://doi.org/10.3390/cells10123522
APA StyleKumawat, A. K., Paramel, G. V., Demirel, K. J., & Demirel, I. (2021). Human Renal Fibroblasts, but Not Renal Epithelial Cells, Induce IL-1β Release during a Uropathogenic Escherichia coli Infection In Vitro. Cells, 10(12), 3522. https://doi.org/10.3390/cells10123522

