Molecular Marker-Assisted Breeding of High-Quality and Salt-Tolerant Hybrid Japonica Rice Combination Shenyanyou 1

Abstract

The development of a new salt–alkaline-tolerant hybrid japonica rice is crucial for enhancing japonica rice supply and ensuring national food security. Utilizing molecular marker-assisted selection (MAS) technology combining Kompetitive Allele-Specific PCR (KASP) markers and a gene breeding chip, the salt-tolerant gene SKC1 was introgressed into a rice genotype Fan 14. This led to the development of Shenyanhui 1, a new high-quality, strongly heterotic, and salt-tolerant japonica restorer line. Subsequently, the high-quality, salt-tolerant japonica three-line hybrid rice variety Shenyanyou 1 was developed by crossing the BT-type japonica cytoplasmic male sterile (CMS) line Shen 21A with the restorer line Shenyanhui 1. Shenyanyou 1 carries the major salt tolerance gene SKC1, exhibiting excellent salt tolerance with seedling stage salt tolerance reaching level 5. Under precise salt tolerance evaluation throughout its growth cycle, Shenyanyou 1 achieved a yield of 3640.5 kg/hm², representing an extremely significant increase of 20.7% over the control variety Yandao 21. Shenyanyou 1 exhibits superior grain quality, meeting the Grade 3 high-quality rice standards issued by the Ministry of Agriculture. Shenyanyou 1 has good comprehensive resistance, aggregating rice blast resistance genes such as Pi2, Pita, Pizt and LHCB5, bacterial blight resistance genes Xa26/Xa3, stripe blast resistance gene STV11, semi-dwarf gene Sdt97, nitrogen-efficient utilization gene NRT1.1B, the light repair activity enhancement gene qUVR-10, the cold resistance gene qLTG3-1, and the iron tolerance gene OsFRO1. It has good resistance to biotic and abiotic stresses. This paper details the breeding process, key agronomic traits, salt tolerance, yield performance, and grain quality characteristics of Shenyanyou 1.

1. Introduction

Rice is one of China’s most vital food crops, serving as a staple food for over 60% of its population. China ranks as the world’s third-largest country in terms of saline–alkali land distribution, with a total area nearing 100 million hectares [1]. Among this, approximately 6.67 million hectares of saline–alkali land hold potential for rice cultivation, indicating significant prospects for comprehensive utilization. Effectively developing and utilizing saline–alkali land resources is a crucial strategy for expanding arable land area and ensuring food security. As a moderately salt-sensitive crop, rice possesses root systems capable of absorbing salts and secreting organic acids. The aquatic environment in which rice grows can gradually sink the salt content in the soil surface, reducing salinity and soil bulk density in the topsoil layer. This makes rice the preferred grain crop for reclaiming saline–alkali lands [2,3]. Sri Lanka was the first to initiate the screening and identification of salt-tolerant rice germplasm resources, successfully breeding the world’s first salt-tolerant local rice variety, “Pokkali”, in the 1930s, achieving a yield of 4.5 t/ha [4]. In the 1970s, the International Rice Research Institute (IRRI) screened 9000 rice accessions and identified 10 varieties with good salt tolerance, including Getu and Nona Bokra. China initiated research on salt-tolerant rice in the 1950s [1], with coastal provinces in eastern China particularly active in breeding new salt-tolerant varieties. To date, a series of rice varieties with good salt tolerance has been discovered or developed, including Haidao 86, Guanghong 3, Yanfeng 47, Yanjing 228, and Yandao 12 [5,6]. With continuous population growth and diminishing arable land resources, particularly under the adverse impacts of climate change, seawater intrusion, and other factors in recent years, the breeding of new salt-tolerant rice varieties has garnered increasing attention.

Conventional breeding relies on phenotypic selection to develop stress-tolerant varieties. The breeding process is complex, time-consuming, and labor-intensive. Moreover, it is difficult to breed varieties with both superior stress tolerance and well-rounded agronomic traits. However, with the rapid advancements in rice functional genomics and modern biotechnology, rice breeding and improvement techniques have been continuously refined and enhanced. Simple Sequence Repeat (SSR) markers, representative of low-throughput molecular markers, suffer from limitations such as a limited number of markers, low genome-wide coverage density, and time-consuming, laborious detection. These drawbacks restrict their effectiveness in MAS breeding. In contrast, Kompetitive Allele-Specific PCR (KASP) offers technical advantages including high efficiency and high fidelity. As a mainstream SNP genotyping method, KASP has been widely adopted in rice molecular marker-assisted breeding programs [7,8,9]. Furthermore, with the increasing maturity of chip and sequencing technologies, the cost of high-density chip detection has steadily decreased. Recently developed rice gene breeding chips, characterized by high marker density and uniform genome-wide coverage, have played significant roles in functional gene identification, genetic background homozygosity analysis, and germplasm resource clustering [10,11,12].

With the improvement of people’s living standards, the demand for high-quality japonica rice continues to increase. However, globally, japonica rice cultivation accounts for only 8.8% of total rice planting area, and its production constitutes merely 14.2% of the total rice output [13]. Furthermore, the major global producers and exporters of japonica rice are limited to only a few countries, such as China, Japan, South Korea, and the United States. Therefore, the security of the japonica rice supply must be based on domestic production, as the scope for international adjustment is extremely limited [13]. Breeding and promoting salt-tolerant rice varieties is one of the crucial approaches to addressing the issue of japonica rice supply. However, most salt-tolerant rice varieties currently bred and promoted are conventional varieties, and the breeding process still predominantly relies on conventional breeding methods, resulting in low breeding efficiency. Heterosis is a widespread phenomenon in the biological world. The application and promotion of hybrid indica rice have made significant contributions to solving food shortages in developing countries. Therefore, leveraging the heterosis of salt-tolerant rice represents a breakthrough approach. Employing KASP markers and gene breeding chip technology to conduct molecular breeding for the rapid development of new salt–alkali-tolerant hybrid japonica rice varieties is an important approach to increasing japonica rice supply and ensuring food security. Shenyanyou 1 is a new high-quality, salt-tolerant hybrid japonica rice combination developed by the Shanghai Academy of Agricultural Sciences (Plant Variety Protection application number: 20241004804). It was bred using a combination of KASP markers and genomic breeding chip technology. It has shown good salt tolerance and yield performance when planted in saline–alkali land.

2. Materials and Methods

2.1. Test Materials and Field Cultivation Management

The test materials consisted of the BT-type japonica CMS line, Shen 21A, and the salt-tolerant japonica restorer line, Shenyanhui 1. Shen 21A is a medium-maturing late japonica CMS line, which was developed using CMS line Hua A as the cytoplasm donor and the high-quality conventional japonica rice Shen 21 as the recurrent parent, through hybridization followed by successive backcrossing over multiple generations [14]. Shen 21 was developed through pedigree selection from a single plant derived from an induced mutation of Bing 11–21. Shenyanhui 1 is a high-quality, strongly heterotic, salt-tolerant japonica restorer line. It was developed through a cross between the late-maturing late japonica restorer line Fan 14 and the salt-tolerant japonica rice YB47 (which carries the SKC1 salt-tolerant allele). Progeny from this cross were backcrossed twice using Fan 14 as the recurrent parent. Subsequently, the line was rapidly developed utilizing MAS and anther culture techniques (Plant Variety Protection application number: 20231006168).

The experimental materials were cultivated at the Zhuanghang Comprehensive Experimental Station of Shanghai Academy of Agricultural Sciences (121°18′4″ E, 30°48′4″ N) and the Southern Propagation Experimental Station of the Shanghai Academy of Agricultural Sciences in Lingshui County, Hainan Province (110°2′47″ E, 18°32′57″ N). Standard field water and fertilizer management practices were applied at both locations.

2.2. KASP Molecular Marker Detection

During the breeding process of Shenyanhui1, the KASP marker (SKC1^NB-KASP) used contained two forward primers and one reverse primer. The primer sequences were as follows: SKC1^NB-KASP-HEX: 5′-TGCTTGTTCCGACGTCCTAACC-3′; SKC1^NB-KASP-FAM: 5′-CGCTTGTTCCGACGTCCTAAC-3′; SKC1^NB-KASP-common (reverse primer): 5′-TACTACTCACACGTCGTCGTCATCA-3′. The tag sequence for SKC1^NB-KASP-HEX was GAAGGTCGGAGTCAACGGATT, and the tag sequence for SKC1^NB-KASP-FAM was GAAGGTGACCAAGTTCATGCT [15]. The design and synthesis of the primers were completed by Nanjing Genscript Biotechnology Co., Ltd., Nanjing, China. The newly synthesized primers were diluted to 10 μM using TE buffer (pH 8.0). Subsequently, the primers were mixed according to the ratio forward primer 1/forward primer 2/common reverse primer = 1:1:3 and loaded onto the machine. For each 5 μL reaction system, 1.25 μL of the primer mixture was added. All sample DNA concentrations were diluted to match the concentration of the sample with the lowest concentration. The total PCR reaction volume was 5 μL, containing 1.25 μL of the diluted DNA template. The 96-well PCR plate was sealed with film, vortexed, and centrifuged to ensure thorough mixing of the reaction components before proceeding to PCR amplification. The PCR reaction mixture comprised 2.5 μL 2 × KASP master mix, 1.25 μL of primer mix, and 1.25 μL of DNA samples. The PCR amplification conditions are detailed in

Table 1. PCR amplification conditions for SKC1^NB-KASP molecular marker genotyping assay.

Step	Description	Temperature	Time	No. of Cycle
1	Activation	95 °C	10 min	1
2	Denaturation	95 °C	20 s	10
	Annealing/Elongation	61–55 °C	60 s
3	Denaturation	95 °C	20 s	27
	Annealing/Elongation	55 °C	60 s
4	Read	25 °C	30 s	1

. Fluorescence detection of the PCR products was performed using a PHERAstar PLUS microplate reader, BMG LABTECH, Germany. Genotypes were determined based on the fluorescence detection results.

2.3. Rice Anther Culture

To accelerate the stabilization of the japonica rice restorer line Shenyanhui 1 and shorten the breeding process, an anther culture experiment was conducted. Stock solutions were prepared using deionized water and stored at 4 °C for later use. A three-step cultivation method—induction culture, differentiation culture, and rooting culture—was adopted. For induction culture, the M8 medium was used as the basic medium, supplemented with various hormones. The differentiation medium was based on the MS medium with a pH value of 5.8, while the rooting medium used 1/2MS as the basic medium with a pH value of 6.0. Anthers at the uninucleate stage were selected for sampling. Using forceps, the anthers were extracted and directly placed into culture bottles. After approximately 30 days of anther culture, callus tissue can be transferred for differentiation culture. Following about 30 days of differentiation culture, the differentiated green shoots were carefully transferred to rooting medium using forceps to stabilize the seedlings. During the transfer process, seedlings and operating equipment should avoid touching the inner and outer walls and mouth of the culture bottle to prevent contamination. After each transfer, the bottles were promptly sealed with parafilm, secured with heat-resistant rubber bands, and tightened to the point where they could not be twisted by hand. During the seedling acclimatization stage, once the green shoots reached 10 cm in height, they were removed from the medium, and any residual agar on the roots was washed off. The seedlings were then transplanted into sterile soil containing nutrients and cultivated in a greenhouse for one week. After inoculation or transfer, all cultures were uniformly placed in the cultivation room for further growth.

2.4. Gene Chip Detection

Rapid detection of agronomically important genes in the parents of Shenyanyou 1 (Shen21A and Shenyanhui 1) was performed using the GSR40K gene breeding chip. Based on the excellent functional genes contained in the parents, key traits of the hybrid japonica rice combination Shenyanyou 1, such as yield, quality, and resistance, were analyzed and evaluated to provide a theoretical basis for its further promotion and application. The GSR40K array contains 32,607 high-quality SNP markers uniformly distributed across all 12 rice chromosomes. It currently enables the detection of more than 200 functional genes controlling critical traits such as quality, yield, resistance to biotic and abiotic stresses, growth period, fertility, and plant type, including SKC1, LAX1, Pi2, Pita, GW5, GW7, NRT1.1B, STV11, Xa26/Xa3, Sdt97, etc. The chip-based assay was performed by Wuhan Greenfafa Institute of Novel Genechip Research and Development Co. Ltd., Wuhan, China. Two analytical approaches, SNP/INDEL genotyping and haplotype analysis, were implemented.

Sample Processing Workflow:

Whole-Genome Amplification: Genomic DNA templates were denatured into single strands using NaOH, neutralized, and amplified with whole-genome amplification reagents at 37 °C for 20–24 h.

A.

DNA Fragmentation: Amplified DNA was enzymatically fragmented into small segments at 37 °C for 1 h.

B.

DNA Purification: Fragmented DNA was mixed with isopropanol and incubated at 4 °C for 30 min. Samples were centrifuged at 3000× g for 20 min. Supernatants were discarded, and pellets were air-dried at room temperature for 1 h.

C.

DNA Resuspension: Pellets were resuspended in RA1 buffer (containing 10–30% formamide) and incubated at 48 °C for 1 h.

D.

DNA Denaturation: Resuspended DNA was heat-denatured at 95 °C for 20 min using a dry bath.

E.

Chip Hybridization: Denatured DNA was loaded onto designated positions of the SNP array and hybridized at 48 °C for 16–24 h in a hybridization oven.

F.

Single-Base Extension (SBE) and Staining: Hybridized chips underwent single-base extension with fluorescence-labeled dNTPs. Post-extension staining amplified fluorescence signals for enhanced detection.

G.

Array Scanning: Processed chips were scanned using an Illumina iScan^® system, with a scanning time of approximately 0.5 min for each sample.

H.

Data Genotyping: Raw fluorescence data were analyzed and genotyped using Illumina GenomeStudio^® software (v2.0 or higher).

2.5. Salt Tolerance Evaluation of Shenyanyou 1

The analysis was performed in compliance with Chinese Agricultural Industry Standard NY/T 3692-2020 [16]. For the identification method for salt tolerance during the bud stage of Shenyanyou 1, two treatments were set up: saltwater (1.5% (w/v) NaCl solution) and water. Fifty plump and mold-free seeds were selected. On the 10th day after treatment, the germination standard was based on the length of the bud being half the length of the seed and the length of the root being half the length of the seed. The number of seed germination was investigated and recorded, and the germination rate and relative salt damage rate were calculated. Germination rate = number of germinated seeds/total number of tested seeds × 100%. Relative salt damage rate = (germination rate under control treatment − germination rate under salt stress treatment)/germination rate under control treatment × 100%. The salt tolerance assessment of Shenyanyou 1 throughout the entire growth period was carried out based on the annual and full-time multi-salinity accurate assessment platform of the National Salt tolerant Rice Technology Innovation Center in Yazhou Bay, Sanya. The field salinity concentration remained stable at 0.5% throughout the entire growth period, and Yandao 21 was used as a salt-tolerant control variety.

3. Results

3.1. Breeding Process of Shenyanhui 1

Shenyanhui 1 is a new japonica restorer line characterized by high quality, strong heterosis, and salt tolerance. It was rapidly developed through hybridization between the late-maturing japonica restorer Fan 14 and the salt-tolerant japonica material YB47 (carrying the SKC1 salt-tolerant allele). The breeding process employed MAS and anther culture technology. In the spring of 2018, a hybrid combination was constructed using Fan 14 and YB47 in Hainan. In the summer of 2018, all F₁ plants were planted in Shanghai and backcrossed using Fan 14. In the spring of 2019, the BC₁F₁ population was planted in Hainan, and the salt tolerance gene SKC1 was detected using the KASP marker SKC1^NB-KASP (Figure 1). The strains containing the salt tolerance allele SKC1^NB were selected as the preferred ones and further backcrossed using the Fan 14. In the summer of 2019, the BC₂F₁ population was planted in Shanghai, and SKC1^NB-KASP markers were continued to be used for salt tolerance genotype testing. SKC1-positive plants with favorable agronomic traits were selected for anther culture. In the spring of 2020, Doubled Haploid (DH) strains were planted in Hainan and molecular testing was continued using KASP markers to select doubled individual plants containing the SKC1 salt tolerance allele. In the summer of 2020, doubling individual plants were subjected to field phenotype identification, and the single plant with excellent agronomic traits such as plant type and panicle type was selected and designated as Shenyanhui 1 (Figure 2). Using the 48 pairs of SSR primers in the agricultural industry standard of the People’s Republic of China, “Technical Regulations for Rice Variety Identification—SSR Marker Method (NY/T1433-2014)”, genetic similarity analysis was conducted between Shenyanhui 1 and Fan 14. The results showed that the 48 pairs of primers did not exhibit polymorphism between the two lines, indicating that Shenyanhui 1 and Fan 14 have high genetic similarity. Shenyanhui 1 has a plant height of 98.6 cm, with a total of about 180 grains per spike, a seed-setting rate of 91%, and a thousand grain weight of 27 g. The plant has a compact shape, strong tillering ability, large spikes with many grains, moderate grain setting, green leaves, and good color change during maturity. Shenyanhui 1 has strong resistance to fertilizer and lodging, with strong resistance to rice blast disease, white leaf blight, and stripe leaf blight.

3.2. Breeding Process of Shenyanyou 1

In the spring of 2022, the hybrid combination Shenyanyou 1 was developed in Hainan by crossing the male sterile line Shen 21A with the restorer line Shenyanhui 1 (Figure 3). The hybrid Shenyanyou 1 was planted during the normal season in Shanghai for evaluating its agronomic traits. Small-scale seed production of Shenyanyou 1 began in the spring of 2023. After repeated observations over two growing seasons in 2023 and 2024, Shenyanyou 1 demonstrated relative genetic stability in traits such as stalk length, panicle type, grain shape, and 1000-grain weight. Based on observations of 400 individual plants, the number of atypical plants for key traits, such as growth period, 1000-grain weight, seed-setting rate, and grain shape, did not exceed three plants in any instance, which remained well below the permissible variation threshold of 2%. In multi-location trials conducted in Nanqiao (Fengxian, Shanghai), Kunshan (Jiangsu), among other sites, Shenyanyou 1 exhibited moderate plant height, large panicles and high grain count, favorable economic traits, and excellent grain quality, demonstrating strong potential for production application.

3.3. Characteristics of Shenyanyou 1

3.3.1. Main Agronomic Traits of Shenyanyou 1

Shenyanyou 1, cultivated as a single-season late rice in Shanghai, has a total growth period of 159.6 days, maturing 1 day later than the control variety Huayou 14. This hybrid combination exhibits a compact plant shape, strong tillering ability, high productive panicle rate, green leaf color, and erect flag leaves. It maintains green stalks until maturity. The plant height is approximately 102.0 cm, with a panicle length of 21.0 cm. Each panicle bears about 195.0 grains, characterized by large panicles and high grain numbers. The grain filling rate is rapid, resulting in a high seed-setting rate of 92.8%. The grains are elliptical in shape, with a 1000-grain weight of 28.0 g. The stems are thick and sturdy, providing strong lodging resistance (Figure 4).

3.3.2. The Salt Tolerance Evaluation of Shenyanyou 1

Shenyanyou 1 exhibits good salt tolerance. According to the Agricultural Industry Standard of the People’s Republic of China (NY/T 3692-2020), when screening for salt tolerance at the germination stage, Shenyanyou 1 had a relative salt damage rate of 55.23%, achieving a Moderate Resistance level (Level 5) (

Table 2. Salt tolerance evaluation results of Shenyanyou 1 at germination stage.

Treatments	Germination Rate/%					Average Germination Rate/%	Relative Salt Damage Rate/%
	I	II	III	IV	V
H2O	89.0	86.0	92.0	94.0	88.0	89.8
1.5% NaCl	44.0	41.0	36.0	42.0	38.0	40.2	55.23

). In 2024, utilizing the National Center of Technology Innovation for Saline-Alkali Tolerant Rice’s Sanya Yazhou Bay Platform for year-round, full life-cycle, multi-salinity precision evaluation of salt tolerance, a precision evaluation of Shenyanyou 1’s salt–alkali tolerance throughout its entire growth cycle was conducted. Shenyanyou 1 yielded 3640.5 kg/hm², representing an extremely significant increase of 20.7% compared to the control variety Yandao 21 (

Table 3. Salt tolerance performance of Shenyanyou 1 during full life-cycle evaluation.

Variety	Harvested Area (m2)	Fresh Grain Yield (kg)	Moisture Content (%)	Impurity Content (%)	Actual Yield (kg/hm2)	Yield Increase Rate (%)
W087	6.5	2.95	15.7	2.0	4387.5	45.4
Shenyanyou 1	6.5	2.43	15.1	2.0	3640.5	20.7
W103	6.5	2.2	13.6	2.0	3354.0	11.2
Yuanzhong 62	6.5	2.07	15.5	2.0	3085.5	2.3
Xingeng 2	6.5	2.02	13.7	2.0	3075.0	2.0
Zhongbao 8	6.5	2	13.8	2.0	3042.0	0.8
Yandao 21 (CK)	6.5	1.99	14.1	2.0	3016.5	/

).

3.3.3. Quality of Shenyanyou 1

According to the test results from Rice Products Quality Supervision and Inspection Center, Ministry of Agriculture and Rural Affairs, the brown rice rate of Shenyanyou 1 is 82.3%, the polished rice rate is 74.7%, the whole polished rice rate is 71.2%, the chalkiness degree is 4.2%, the amylose content is 15.8%, the gel consistency is 81 mm, the transparency is level 2, and the alkali spreading value is level 6.3 (

Table 4. The inspection report of the Quality Supervision, Inspection and Testing Center for Rice and Products of the Ministry of Agriculture and Rural Affairs.

Inspection Items	Unit	Standard Formulation	Test Result	Single Item Judgment	Testing Basis
Whole-head rice rate	%	≥69.0	71.2	Level 1	NY/T 2334-2013
Chalkiness	%	≤5.0	4.2	Level 3	NY/T 2334-2013
Transparency	Grade	≤2	2	Level 2	NY/T 2334-2013
Alkali spreading value	Grade	≥6.0	6.3	Level 3	NY/T 83-2017
Gel consistency	mm	≥70	81	Level 1	GB/T 22294-2008
Amylose content	%	13.0–18.0	15.8	Level 1	NY/T 2639-2014
Grain length	mm	/	5.6	/	NY/T 2334-2013
Aspect ratio	/	/	2.1	/	NY/T 2334-2013
Brown rice percentage	%	/	82.3	/	NY/T 83-2017
Polished rice rate	%	/	74.7	/	NY/T 83-2017
Chalky grain rate	%	/	24	/	NY/T 2334-2013
Protein	Score	/	6.65	/	NY/T 596-2002

). Shenyanyou 1 exhibits premium grain quality. In accordance with the standard, NY/T 593-2021 “Edible Rice Variety Quality”, Shenyanyou 1 comprehensively meets the quality requirements for Premium Grade 3 edible Japonica rice varieties.

3.4. Production of Shenyanyou 1

Shenyanyou 1 demonstrates high yield performance. During 2024, multi-location trials and demonstration plantings were conducted in Kangfeng (Jinshan, Shanghai), Nanqiao (Fengxian, Shanghai), Kunshan (Jiangsu), and Hefei (Anhui). Under non-saline–alkali soil conditions with freshwater irrigation, the average yield of Shenyanyou 1 across multiple trial sites reached 9055.9 kg/hm², representing a 0.24% increase compared to the control variety Huayou 14 (

Table 5. Yield performance of new japonica hybrid rice combination Shenyanyou 1 in multi-location tests in 2024.

Location	Fresh Grain Yield (kg/hm2)		Yield Increase Rate (%)
	Shenyanyou 1	Huayou 14
Kangfeng, Jinshan, Shanghai	9214.5	9637.5	−4.39
Nanqiao, Fengxian, Shanghai	10,150.2	9643.4	5.26
Kunshan, Jiangsu	9099.0	9009.0	1.00
Hefei, Anhui	7760.0	7847.5	−1.12
Average	9055.9	9034.3	0.24

).

3.5. Genotypic Analysis of Shenyanyou 1

Based on the detection results using high-density gene chip GSR40K, Shenyanyou 1 harbors multiple superior alleles associated with yield, quality, resistance, plant architecture, fertility, etc. (

Table 6. The major superior alleles carried by Shenyanyou 1.

Gene	Chr.	Traits Regulated	Function of Superior Alleles	Parental Lines Carrying Superior Alleles
LAX1	1	Yield components	Increases grain number per panicle	Paternal Line
GW5	5	Yield components	Increases grain width	Both Parental Lines
GW7	7	Yield components	Increases grain length	Paternal Line
GW8/OsSPL16	8	Yield components	Increases grain weight	Paternal Line
Wxb	6	Taste quality	Reduces amylose content	Both Parental Lines
SKC1	1	Abiotic Stress	Enhances salt tolerance	Paternal Line
NRT1.1B	10	Abiotic Stress	Improves nitrogen use efficiency	Paternal Line
Pi2	6	Biotic Stress	Enhances blast resistance	Both Parental Lines
Pita	12	Biotic Stress	Enhances blast resistance	Maternal Line
Pizt	6	Biotic Stress	Enhances blast resistance	Paternal Line
LHCB5	11	Biotic Stress	Enhances blast resistance	Paternal Line
STV11	11	Biotic Stress	Confers durable resistance to rice stripe virus	Maternal Line
Xa26/Xa3	11	Biotic Stress	Enhances bacterial blight resistance	Paternal Line
qLTG3-1	3	Abiotic Stress	Enhances cold tolerance and low-temperature germination vigor	Maternal Line
OsFRO1	4	Abiotic Stress	Improves iron tolerance	Maternal Line
qUVR-10	10	Abiotic Stress	Enhances light repair activity	Maternal Line
BET1	4	Abiotic Stress	Increases boron toxicity tolerance	Paternal Line
SaF	1	Fertility	Confers wide-compatibility (japonica compatibility)	Both Parental Lines
Sdt97	6	Plant type	Confers semi-dwarfism	Maternal Line
Rf2	2	Yield components	Restores fertility	Paternal Line
Hd17/Hd3b	6	Heading date	Delaying heading date	Paternal Line
sh4	4	Others	Prevents grain shattering	Both Parental Lines

), including the grain number per panicle increase gene LAX1 [17], the grain width increase gene GW5, the grain length increase gene GW7, and the grain weight increase gene GW8/OsSPL16 [18,19], as well as the wide-compatibility gene SaF. Both parents of Shenyanyou 1 carry the Wx^b allele, which controls eating and cooking quality, resulting in moderately reduced amylose content and excellent cooking and eating quality. Shenyanyou 1 exhibits comprehensive resistance, carrying the major salt tolerance gene SKC1, the semi-dwarf gene Sdt97 [20], major blast resistance genes Pi2, Pita, Pizt and LHCB5, bacterial blight resistance gene Xa26/Xa3, and rice stripe virus resistance gene STV11 [21]. Consequently, it demonstrates good saline–alkali tolerance, strong lodging resistance, and favorable resistance to rice blast, bacterial blight, and rice stripe virus. Furthermore, Shenyanyou 1 possesses strong resistance to abiotic stresses. It contains multiple superior stress resistance alleles, including the nitrogen-efficient utilization gene NRT1.1B, the light repair activity enhancement gene qUVR-10, the cold tolerance gene qLTG3-1, and the iron tolerance gene OsFRO1.

4. Discussion

4.1. Shenyanyou 1 Provides an Excellent Option for Salt Tolerance Improvement in Saline–Alkali Land

Rice is moderately salt-sensitive, exhibiting relative tolerance during seed germination but heightened sensitivity at seedling and reproductive growth stages [3,22]. Seed germination is impaired when soluble salt content in soil exceeds 0.3%. Research indicates that under alkaline soil conditions (pH 9.8), yields of salt-tolerant, moderately salt-tolerant, and salt-sensitive rice varieties decline by 25%, 37%, and 68%, respectively [23]. Breeding salt–alkali-tolerant rice is crucial for utilizing saline–alkali land resources and ensuring food security. This study improved Fan 14—the paternal line of Huayou 14, a dominant japonica hybrid rice cultivar in Shanghai—by integrating KASP markers with anther culture. This approach developed a novel salt-tolerant restorer line, Shenyanhui 1. Through hybridization between Shenyanhui 1 and elite BT-type japonica CMS lines possessing strong heterosis and disease resistance, a new premium salt-tolerant japonica hybrid combination, Shenyanyou 1, was bred. Multi-location trials demonstrated that Shenyanyou 1 yields 0.24% higher than Huayou 14—a high-yielding premium hybrid japonica rice and one of China’s most extensively cultivated varieties, with accumulated planting area exceeding 26.67 × 10⁴ hectares. This confirms Shenyanyou 1’s superior productivity. Additionally, it exhibits exceptional salt tolerance, robust disease and stress resistance, and premium grain quality, indicating strong potential for widespread adoption.

4.2. Modern Biotechnological Breeding Techniques Have Accelerated the Development of New Salt-Tolerant Rice Varieties

Conventional breeding techniques exhibit low efficiency in developing japonica hybrid rice varieties with multiple desirable traits. However, with the rapid advancement in rice functional genomics and modern biotechnology research, rice breeding improvement techniques have been continuously refined and enhanced. Compared to traditional PCR electrophoresis techniques, KASP marker technology offers advantages such as greater stability, higher accuracy, and lower costs. It has been widely adopted for genotyping SNP loci, demonstrating particularly significant advantages in high-throughput sample genotyping [24,25]. Meanwhile, as the cost of high-density SNP array detection continues to decrease and rice genotyping array technology matures, it has shown considerable application potential in rice molecular breeding.

This study utilized gene breeding chips for identification and discovered that Shenyanyou 1 carries not only yield-related functional genes such as LAX1, GW5, GW7, and GW8/OsSPL16, but also disease resistance genes like Pi2, Pita, Pizt, and LHCB5. Moreover, stress resistance genes such as SKC1, Pita, Pi2, Pizt, and LHCB5 are all broad-spectrum blast resistance genes in rice. The Pita gene is located near the centromere on chromosome 12 of rice. The only difference between the resistant and susceptible alleles at the Pita locus is a single amino acid substitution—alanine (resistant) at position 918 is replaced by serine (susceptible). The resistance mechanism involves the interaction between the Pita protein and the product of the avirulence gene AVR-Pita from the rice blast fungus, triggering a defense response [26]. Pi2 and Pizt are allelic genes located on chromosome 6, with their encoded proteins differing by only eight amino acids in three LRR regions [27]. Both Pi2 and Pizt belong to the NBS-LRR class of genes and exhibit broad-spectrum resistance. Pi2, for instance, confers resistance to the vast majority (92.45%) of the 792 rice blast strains collected in China, with only 7.55% able to infect the Pi2-carrying parental line C101A51 [28]. LHCB5, located on chromosome 11, plays a role in blast resistance by undergoing phosphorylation at the 24th threonine residue upon pathogen invasion. This phosphorylation disrupts normal electron transport in chloroplasts, leading to electron accumulation and subsequent reactive oxygen species (ROS) burst, which activates defense-related genes and enhances resistance [29]. The pyramiding of Pita, Pi2, Pizt, and LHCB5 in the japonica hybrid rice combination Shenyanyou 1 significantly enhances its blast resistance. SKC1 is the earliest cloned salt tolerance gene responsible for sodium ion transport, with its favorable allele originating from the landrace Nona Bokra. SKC1 enhances rice salt tolerance by reducing Na⁺ toxicity. It achieves this by reloading excessive Na⁺ from the shoots back to the roots via xylem unloading [30,31]. Sun Pingyong et al. [32] compared the SKC1 gene sequences in three accessions with weak saline–alkali tolerance and four accessions with strong saline–alkali tolerance. They found significant sequence variations in this gene between the two types, demonstrating SKC1’s functional role in improving the salt tolerance of rice germplasm. In this study, we employed an integrated molecular breeding strategy combining “KASP markers + genotyping array” technology. This approach enabled the rapid introduction of the salt tolerance gene SKC1 into elite cultivars used in production, coupled with genetic background screening. Consequently, it has significantly accelerated the breeding process for developing new rice varieties that are high-quality and salt-tolerant. Shenyanyou 1 carries multiple yield- and resistance-related functional genes, resulting in not only high yield but also robust comprehensive resistance.

4.3. Enhanced Comprehensive Evaluation of Salinity and Alkalinity Tolerance in Shenyanyou 1

Salinization and alkalization generally occur simultaneously in saline–alkali soils under natural conditions. Based on the different anions present in the soil, saline–alkali stress is categorized into salt stress (dominated by neutral salts like NaCl) and alkali stress (dominated by Na₂CO₃ and NaHCO₃). Both types of stress can cause osmotic stress and ion toxicity in rice, thereby affecting its normal growth and development. However, alkali stress, characterized by its higher pH, subjects rice to dual damage from both high salinity and high pH. Consequently, the detrimental effects of alkali stress are more severe than those of salt stress [33]. Currently, research both domestically and internationally primarily focuses on salt stress [34]. This study also mainly employed salt stress to evaluate the saline–alkali tolerance of the rice variety Shenyanyou 1. Therefore, it is necessary to conduct further comprehensive evaluations of Shenyanyou 1’s tolerance to both salt stress and alkali stress. This will enable a more scientific assessment of this variety’s saline–alkali tolerance performance.

4.4. Pyramiding Major and Minor Effect Salt Tolerance Genes/QTLs to Enhance Saline–Alkali Tolerance of Bred Varieties

Extensive research has been conducted on saline–alkali-tolerant rice by previous researchers. To date, nearly 1000 salt tolerance-related QTLs have been detected. However, the majority of these QTLs exhibit low phenotypic contribution rates, making them difficult to finely map and clone, and consequently, challenging to utilize directly in breeding programs. Currently, the most frequently utilized salt tolerance QTLs in breeding are SKC1 and Saltol, both located on chromosome 1 of rice [1]. Therefore, continued efforts are needed to strengthen the discovery and utilization of novel salt tolerance genes/QTLs. Overall, rice salt tolerance is a complex physiological trait controlled by multiple quantitative trait genes. Employing molecular breeding techniques to introduce major-effect salt tolerance alleles, such as SKC1, into japonica varieties with a saline–alkali tolerance background, and subsequently pyramiding these major- and minor-effect genes/QTLs, represents a key strategy for enhancing the saline–alkali tolerance of japonica rice varieties. This approach holds significant importance for ensuring national food security.

5. Conclusions

Breeding and promoting saline–alkali-tolerant rice varieties constitute a crucial approach to addressing japonica rice supply challenges. Utilizing a MAS breeding strategy that combines KASP markers and genotyping array technology, a three-line hybrid japonica rice variety Shenyanyou 1 with high quality and salt tolerance was developed. Shenyanyou 1 demonstrates superior salt tolerance, carrying the major salt tolerance gene SKC1. Its relative salt damage rate at the seedling stage is 55.23%, indicating moderately resistant tolerance. Through precise salt tolerance evaluation across the entire growth cycle, Shenyanyou 1 achieved a yield of 3640.5 kg/hm², representing a highly significant increase of 20.7% compared to the control variety Yandao 21. The variety possesses excellent grain quality, meeting the Grade 3 standards for edible japonica rice varieties. It carries multiple yield-enhancing genes, including the panicle branch number gene LAX1, the grain width increase gene GW5, the grain length increase gene GW7, the grain weight increase gene GW8/OsSPL16, and the wide-compatibility gene SaF, resulting in large panicles with high grain numbers and high 1000-grain weight. Shenyanyou 1 exhibits comprehensive disease resistance. It carries the semi-dwarf gene Sdt97, the blast resistance genes Pi2, Pita, Pizt and LHCB5, the bacterial blight resistance gene Xa26/Xa3, and the rice stripe virus resistance gene STV11. This genetic endowment confers strong lodging resistance and provides effective resistance against rice blast, bacterial blight, and rice stripe virus. Furthermore, the variety demonstrates robust abiotic stress tolerance, harboring multiple superior alleles including the nitrogen-efficient utilization gene NRT1.1B, the light repair activity enhancement gene qUVR-10, the cold tolerance gene qLTG3-1, and the iron tolerance gene OsFRO1. Given these outstanding characteristics, Shenyanyou 1 exhibits significant potential for popularization and application in the middle and lower reaches of the Yangtze River region.