Gene Silencing of Sarco/Endoplasmic Reticulum Ca²⁺-ATPase and NADPH–Cytochrome P450 Reductase as a Novel Approach to Leptinotarsa decemlineata Management

Abstract

The Colorado Potato Beetle (CPB, Leptinotarsa decemlineata Say, Coleoptera: Chrysomelidae) remains a destructive agricultural pest worldwide that continually overcomes conventional control methods. In recent years, RNA interference (RNAi) has emerged as an alternative for its management; however, although promising results have been reported, its effectiveness has been influenced by several factors, including the length of double-stranded RNA (dsRNA), the delivery method, stability, and especially the selection of the target gene. In this study, we designed and synthesized 290 bp dsRNAs targeting the SERCA and CPR genes from L. decemlineata, which encode the Sarco/Endoplasmic Reticulum Ca²⁺-ATPase and NADPH–Cytochrome P450 Reductase, respectively. Both dsRNAs successfully reduced transcript levels in larvae, with dsSERCA achieving ~60% knockdown by day 3 and dsCPR achieving ~50% knockdown by day 7. Furthermore, both treatments affected the larval growth and survival rate. However, while the dsCPR-treated larvae showed a 59% reduction in weight gain, the administration of dsSERCA had a strong phenotypic effect on the larvae, leading to decreased feeding, a 50.4% reduction in weight gain, and ultimately, 100% mortality. These results suggest that the SERCA and CPR genes could be promising targets for L. decemlineata control and emphasize the importance of appropriate target gene selection for RNAi silencing, as well as the need to explore and validate new genes for RNAi-mediated pest management.

1. Introduction

Potato plants (Solanum tuberosum L.) are considered the world’s most important non-cereal crop. In 2023 alone, more than 17 million hectares of potato plants were cultivated in over 150 countries, yielding approximately 383 million metric tons of potato with an estimated market value of USD 123 billion [1], highlighting its fundamental role in global food security.

Despite continuous advancements in productivity, evidenced by an increase of 9.6 million metric tons from 2022 to 2023, potato production remains highly vulnerable to pest infestations. Collectively, pests are responsible for annual yield losses of up to 40%, representing a major threat to food security [2,3,4]. Among these, L. decemlineata is one of the most destructive pests; each of its larvae can defoliate up to 40 cm² of foliage [5]; however, under severe infestation, total crop losses are frequent, resulting in substantial reductions in tuber yield [6,7].

To reduce the economic impact caused by L. decemlineata, some management strategies have been used, including cultural practices and biological control [8,9,10,11]. However, the long-term effectiveness of these approaches has been severely compromised; therefore, chemical control remains the main control strategy, but the repeated use of insecticides has led to reduced efficacy. Although the precise mechanism of the rapid adaptation of L. decemlineata to new toxins is not yet fully understood [12,13,14], factors such as poor pest management practices, over-reliance on chemical control, and the beetle’s exceptional genetic adaptability—facilitated by an extensive network of xenobiotic detoxification pathways—have contributed to the evolution of resistance [12,15,16]. To date, L. decemlineata has developed resistance against 57 active ingredients [17], earning it the designation of a “super pest”.

The growing resistance of agricultural pests to pesticides has driven a continuous increase in global insecticide application rates worldwide, rising from 1.23 kg ha⁻¹ in 1990 to 2.23 kg ha⁻¹ in 2022 [18]. However, this intensive use has not only caused the development of insect resistance but also led to environmental and public health problems [19,20], underscoring the need for alternative control methods with greater long-term efficacy.

In recent years, RNAi has emerged as a next-generation approach for pest control [21]. It is based on a conserved post-transcriptional gene silencing mechanism triggered by dsRNA. This dsRNA is processed by the RNase III enzyme Dicer (~200 kDa), generating small interfering RNAs (siRNAs) of a length of 21–24 nucleotides [22]. These siRNAs are subsequently incorporated into the RNA-induced silencing complex (RISC), which guides the degradation of complementary messenger RNA (mRNA), ultimately preventing protein translation [23].

Taking advantage of this mechanism, RNAi has been implemented to silence genes in a wide range of species, including Bemisia tabaci [24,25], Tetranychus urticae [26], Helicoverpa armigera [27,28], Spodoptera litura [29], Chilo partellus [29], Plutella xylostella [29,30], Maruca vitrata [29], Tuta absoluta [31], Myzus persicae [32,33], Diabrotica virgifera virgifera [34,35], Apolygus lucorum [36,37], Sitobion avenae [38,39], Chilo suppressalis [40,41], and Diaphorina citri [42,43].

L. decemlineata has also been targeted by RNAi. To date, more than 26 genes have been silenced, including β-Actin, Sec23, ATPase, COPβ, Mesh, Ran, Tai, EcR, HR3, HR4, CncC, Prohibitin-1, FTZ-F1, Shd, SAHase, NAT1, alt, UAP, TPS, TRE, JHAMT, ILP, JHEH, CHS, p5cdh, E75, and ACE [14,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64]. These studies have demonstrated significant phenotypic effects, such as developmental defects, reduced feeding, and increased mortality; however, the magnitude and timing of these effects have varied depending on the gene targeted.

Despite the advances in RNAi technology for pest management, its large-scale implementation remains limited. Currently, only two RNAi-based products—SmartStax PRO^® [65,66,67] and Calantha^TM (Ledprona) [68,69]—are commercially available. The limited number of available RNAi-based products may be due to their high production costs and strict regulatory requirements [70,71,72]. However, one of the greatest challenges lies in the technical limitations of RNAi. While gene silencing has been successfully achieved in several organisms, factors such as species-specific responses, dsRNA delivery methods, dsRNA processing efficiency, and the identification of optimal target genes are still under investigation [44,73,74,75,76].

In this context, two key genes in L. decemlineata, CPR and SERCA, stand out due to their essential roles in several biochemical pathways critical for insect survival. The CPR gene encodes NADPH–Cytochrome P450 Reductase (CPR), an enzyme responsible for transferring electrons from Nicotinamide Adenine Dinucleotide Phosphate (NADPH) to Cytochrome P450s [77,78], enabling vital functions such as detoxification, hormone metabolism, pheromone processing, and cuticular hydrocarbon synthesis [78,79,80,81,82,83]. Therefore, silencing CPR disrupts these metabolic processes, increasing the insect’s sensitivity to xenobiotics and reducing its survival in adverse environments [80,84,85].

Similarly, the SERCA gene plays a fundamental role in cellular homeostasis by regulating intracellular calcium levels. It encodes the Sarco/Endoplasmic Reticulum Ca²⁺-ATPase (SERCA), a P-type ATPase responsible for transporting Ca²⁺ from the cytosol into the Sarcoplasmic and Endoplasmic Reticulum (SR/ER) [86]. By maintaining low cytosolic calcium concentrations and higher levels within organelles [87,88,89,90], SERCA supports essential biological processes such as muscle contraction, neuronal signaling, hormonal secretion, and stress responses [91,92,93,94]. Disruptions in SERCA function result in cytotoxic calcium accumulation, triggering developmental defects, impaired mobility, and increased mortality [95,96,97]. Due to its critical role in insect physiology, SERCA has been proposed as a potential target for RNAi-based pest control; however, it has not yet been silenced in L. decemlineata.

In this study, we investigated the RNAi-mediated silencing of the SERCA and CPR genes in L. decemlineata to identify which gene silencing induces the most significant effects, including transcript reduction, developmental impairments, and mortality, and analyze how these effects evolve over time. Identifying the gene with the greatest impact will provide valuable insights into RNAi-based pest control strategies, paving the way for more effective and targeted approaches.

2. Materials and Methods

2.1. Selection of Target Genes

The SERCA and CPR genes were selected for silencing because their products are involved in key metabolic processes of L. decemlineata: SERCA encodes the Sarcoplasmic/Endoplasmic Reticulum-type calcium-transporting ATPase, whereas CPR encodes the NADPH–Cytochrome P450 Reductase. Their gene sequences were retrieved from the National Center for Biotechnology Information (NCBI) database (accession numbers MW194237 and MN275229, respectively).

2.2. In Silico Analysis of RNAi Effectiveness and Off-Target Effects

Fragments of the SERCA and CPR genes were analyzed for their theoretical RNA interference effectiveness and potential off-target effects using the QUT Nicotiana benthamiana RNA Target Tester (https://benthgenome.qut.edu.au/tools/TKsoft3x.php (accessed on 23 June 2024)). The analysis was performed against gene sequences from Homo sapiens, Bos taurus, Mus musculus, Oryctolagus cuniculus, Drosophila melanogaster, T. urticae, Tribolium castaneum, Apis mellifera, Copidosoma floridanum, Coccinella septempunctata, H. armigera, B. tabaci, Trichogramma pretiosum, M. persicae, D. virgifera virgifera, Chrysoperla carnea, Solenopsis invicta, and Frankliniella occidentalis. The accession numbers for these sequences can be found in Supplementary Material Table S1.

2.3. Synthesis and Cloning of SERCA and CPR Fragments

SERCA and CPR gene fragments were processed using the software SnapGene 5.4.3 (www.snapgene.com (accessed on 2 February 2018)), adding KpnI and XbaI restriction sites to the 5′ and 3′ ends of the SERCA sequence, and SwaI and AvrII restriction sites to the 5′ and 3′ ends of the CPR sequence for cloning. To ensure that the observed effects of dsRNA were due to the target gene, both sequences had the same length, with a 40% GC content. The final sequences were synthesized by GeneScript Inc. (Piscataway, NJ, USA) and cloned into the pBJC9 vector (GenBank: PV425440). Recombinant vectors were introduced into the Escherichia coli strain DH5α (Invitrogen^®, Carlsbad, CA, USA) for plasmid maintenance and propagation.

2.4. In Vitro dsRNA Synthesis

The in vitro synthesis of dsRNA was conducted using the T7 RiboMAX™ Express RNAi System Kit (Promega, cat. P1700, Madison, WI, USA), in accordance with the manufacturer’s protocol. Plasmid DNAs containing both sequences were extracted from E. coli DH5α using the QIAGEN Plasmid Midiprep Kit (QIAGEN^®, Valencia, CA, USA). The plasmid DNA was subsequently used to generate templates for in vitro transcription. For each dsRNA, both sense and antisense strands were amplified using custom primers designed using Primer3 (https://primer3.ut.ee (accessed on 18 July 2024)) and synthesized by Integrated DNA Technologies (IDT, Coralville, IA, USA). The minimal T7 promoter sequence (5′TAATACGACTCACTATAGG3′) was added to the 5′ end of both primers (

Table 1. Primers used for in vitro dsRNA synthesis.

Gene	Sequence (5′-3′)
	First amplicon
SERCA	Fw—5′TAATACGACTCACTATAGGATGGAGGACGGTCACATTAAAA3′
	Rv—5′ATTAAAAGAATTACGAAGGGTT3′
CPR	Fw—5′TAATACGACTCACTATAGGATGTCCGAGAGTGAAGCAAAAG3′
	Rv—5′TCTTCTCCTGTTCCAGTTTGAC3′
	Second amplicon
SERCA	Fw—5′ATGGAGGACGGTCACATTAAAA3′
	Rv—5′TAATACGACTCACTATAGGATTAAAAGAATTACGAAGGGTT3′
CPR	Fw—5′ATGTCCGAGAGTGAAGCAAAAG3′
	Rv—5′TAATACGACTCACTATAGGTCTTCTCCTGTTCCAGTTTGAC3′

). The amplifications were performed under the following conditions: 3 min of denaturation at 94 °C, followed by 40 cycles of amplification (45 s at 94 °C, 45 s at 61 °C, 1 min at 72 °C), and a final extension step of 5 min at 72 °C.

The transcription reaction was prepared using 10 µL of RiboMAX™ Express T7 buffer, 2 µL of T7 Express Enzyme Mix, and 200 ng of both sense and antisense DNA that were previously amplified, to reach a final volume of 20 µL. The reaction mixture was incubated at 37 °C for 1 h, followed by a heat treatment at 70 °C for 10 min. After incubation, the mixture was cooled gradually to room temperature over 20 min to promote proper RNA strand alignment. To remove any single-stranded RNA (ssRNA) and template DNA, the reaction was treated with RNase A (Thermo Fisher Scientific, Waltham, MA, USA) and DNase I (Thermo Fisher Scientific) at 37 °C for 30 min. Subsequently, dsRNA was precipitated using 3 M sodium acetate (pH 5.2) and isopropanol. The obtained pellet was washed with cold 70% ethanol and resuspended in nuclease-free water. The integrity of the dsRNA was resolved using electrophoresis on a 1.8% agarose gel, and its concentration was determined by measuring the absorbance at 260 nm using a UV/VIS NanoDrop One Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The dsRNA was stored at −70 °C until use.

2.5. Insect Growth Conditions

Adult beetles of L. decemlineata were collected from the field on silverleaf nightshade (Solanum elaeagnifolium Cav.) and buffalobur (Solanum rostratum Dunal) plants in Chihuahua, Chihuahua, Mexico (28°43′47″ N, 105°58′11″ W), during the period of August and September 2024. The beetles were maintained in a controlled environment within a terrarium, set to a temperature of 26 ± 2 °C, with relative humidity between 50% and 60%, and a 14 h light–10 h dark photoperiod (1200 lux). Silverleaf nightshade plants were provided as a food source.

To ensure a uniform larval size for growth and survival assays, adult beetles were allowed to lay eggs, which were subsequently collected and placed on fresh silverleaf nightshade leaves to hatch. The newly hatched first-instar larvae were given young leaves from one-month-old silverleaf nightshade plants to feed on.

For RNAi feeding assays, synchronized second-instar larvae were selected, individually weighed, and grouped into three biological replicates, each containing 30 larvae. Prior to the experiment, the larvae were starved for 6 h. Each group was then placed into Petri dishes and fed with 23 cm² leaf discs of silverleaf nightshade, which were treated with dsRNA diluted in nuclease-free water to a final concentration of 8 ng cm⁻² [98]. Silverleaf nightshade leaves painted with nuclease-free water were used as controls [98]. The leaves were replaced with fresh dsRNA-painted leaves every 24 h for 7 d. The larvae were weighed on days 3, 5, and 7 of the feeding assays, and mortality was recorded daily. At the end of the experiment, the larvae were stored at −70 °C until processing.

2.6. RNA Extraction

Frozen larvae were homogenized in liquid nitrogen, and 50–100 mg of powder was used to extract RNAi using the Total RNA Purification Kit (Jena Bioscience, Jena, Germany) following the manufacturer’s instructions. The RNA was treated with DNase I (Thermo Fisher Scientific) to eliminate residual DNA contamination. To verify RNA integrity, electrophoresis was performed with a 1% agarose gel. The RNA concentration was determined by measuring the absorbance at 260 nm using a UV/VIS NanoDrop One Spectrophotometer (Thermo Fisher Scientific).

2.7. Quantitative Real-Time PCR (qPCR)

qPCR was used to determine the expression levels of the SERCA and CPR genes in larval tissues. The primers for qPCR were designed using Primer3 (https://primer3.ut.ee (accessed on 18 July 2024)) and the RealTime qPCR tool from IDT (https://www.idtdna.com/scitools/ (accessed on 18 July 2024)), followed by further analysis using the OligoAnalyzer™ Tool (https://www.idtdna.com/calc/analyzer (accessed on 18 July 2024)). The specific primers used to amplify the SERCA gene were Fw—5′TTCCAGCGGAAGAAGGAAAG3′ and Rv—5′TTCTACGAAGGCCGTGAATG3′, whereas the primers used to amplify the CPR gene were Fw—5′CGCAGTCGTCAGCTTCTATT3′ and Rv—5′CGAGGTATCCGATGTACTTTGT3′. Additionally, the primers Fw—5′GCGGGAGAATGTACAGAGGA3′ and Rv—5′AAGTCTTCACGGAGCTTGGA3′ were used to amplify the Rps18 gene [99]. All primers were synthesized by IDT.

For cDNA synthesis, SuperScript^® IV Reverse Transcriptase (Thermo Fisher Scientific) was used according to the manufacturer’s guidelines. The reverse primers were aligned with the template RNA, and the reaction mixture contained the following: 2 µM of gene-specific reverse primer, 10 mM dNTP mix (Promega), and 500 ng of RNA template in a final volume of 13 µL. The reaction mixture was incubated at 65 °C for 5 min, followed by cooling on ice for 1 min. The RT reaction was prepared by mixing 5X SSIV Buffer, 100 mM DTT, and 200 units of SuperScript IV^® Reverse Transcriptase in a final volume of 7 µL. RT mixture was then added to the aligned RNA and incubated at 55 °C for 10 min, followed by 80 °C for 10 min to inactivate the reaction.

qPCR was performed using 5 µL of iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA), 5 µM of forward primer, 5 µM of reverse primer, and 2 µL of cDNA, resulting in a final reaction volume of 10 µL. The mixture was placed in the CFX96 Real-Time System (Bio-Rad) and subjected to the following thermal cycling conditions: an initial denaturation step at 95 °C for 1 min, followed by 39 amplification cycles (denaturation at 95 °C for 10 s, annealing at 52 °C for 30 s, and extension at 65 °C for 5 s). The data were normalized to the mRNA levels of the Rps18 gene, which encodes ribosomal protein S18 in L. decemlineata [99]. The relative expression levels of the SERCA and CPR genes were calculated using the ΔΔCt method [100]. Each reaction was repeated three times to minimize the intra-experimental variation [99], and the results were analyzed with the software Bio-Rad CFX Manager 3.1.

2.8. Statistical Analysis

The data analysis was performed using the statistical software Minitab^® 20.3. A one-way ANOVA was conducted with a significance level set at p ≤ 0.05. Post hoc comparisons were made using Tukey’s mean separation test.

3. Results

Sarco/Endoplasmic Reticulum Ca²⁺-ATPase and NADPH–Cytochrome P450 Reductase are two crucial enzymes involved in distinct metabolic pathways of L. decemlineata and are therefore considered potential targets for pest control. To investigate the effects of gene silencing on SERCA and CPR, the coding sequences of both genes were retrieved from the NCBI (SERCA: 3060 bp, MW194237, and CPR: 2040 bp, MN275229). From each sequence, a 290 bp fragment was extracted, from nucleotide +1 to nucleotide 290 (Figure 1). These sequences were deposited in GenBank under the accession numbers PV233719 and PV233720, respectively. A bioinformatics analysis was conducted to evaluate the silencing potential of the fragments using the RNA Target Tester, which generated all possible 21 bp oligomers. The results indicated a strong RNA interference potential for both fragments: the 290 bp fragments from the SERCA and CPR genes produced 270 unique siRNAs, each with a potency score of 100% (Figure 2). We performed an analysis with RNAcofold to determine the thermodynamic stability of the sequences; the results showed that the dsRNA targeting the SERCA gene (dsSERCA) had a ΔG (minimum free energy, MFE) of −546.20 kcal/mol, with a frequency of 13.73% in the thermodynamic ensemble, suggesting a higher tendency to adopt a single, stable conformation. In contrast, the dsRNA targeting the CPR gene (dsCPR) showed a ΔG of −555.80 kcal/mol with a frequency of 17.95%, indicating greater stability compared to dsSERCA, along with a lower propensity to form multiple conformations.

Concurrently, an off-target analysis was performed to assess the potential interference of the designed fragments with the SERCA and CPR genes from a range of organisms, including B. taurus, M. musculus, O. cuniculus, D. melanogaster, T. urticae, T. castaneum, A. mellifera, C. floridanum, C. septempunctata, H. armigera, B. tabaci, T. pretiosum, M. persicae, D. virgifera virgifera, C. carnea, S. invicta, F. occidentalis, and H. sapiens. The analysis confirmed that both designed sequences exhibited more than three mismatches per 21-mer, suggesting minimal off-target effects. This indicates a high level of specificity and a reduced risk of unintended silencing (Figure 2B,C). Consequently, both sequences were designed with appropriate restriction sites at the 5′ and 3′ ends, respectively. The final sequences were synthesized by GenScript Inc. and cloned into the pBJC9 vector, resulting in the constructs pMAM1 (SERCA—290 bp) and pMAM2 (CPR—290 bp). The vector sequences were deposited in GenBank under the accession numbers PV261951 and PV261952, respectively.

3.1. In Vitro Synthesis of dsRNA Targeting SERCA and CPR Sequences

Larval feeding assays were performed using the dsRNA targeting the SERCA and CPR genes. The pMAM1 and pMAM2 vectors, which harbor the SERCA and CPR gene fragments from L. decemlineata, respectively, were used as templates for the in vitro synthesis of dsRNA, yielding fragments of approximately 290 bp, corresponding to the expected sizes of the designed sequences (Figure 3A).

3.2. Effects of Larval Feeding with dsRNA Targeting SERCA and CPR Genes

Second-instar larvae of L. decemlineata were selected for the insecticidal bioassays, given their higher susceptibility to dsRNA compared to third-instar larvae [101]. In the bioassays, larvae that consumed dsSERCA (8 ng cm⁻²) with a length of 290 bp exhibited high mortality levels throughout the experiment compared to the control. On day 1, mortality was 8%, increasing to 14% on day 2. By day 3, cumulative mortality reached 27%, and by day 4, it rose dramatically to 77%. Remarkably, 100% mortality was observed by day 5. In comparison, larvae fed with dsRNA targeting the CPR gene (dsCPR) exhibited a more gradual mortality progression. On day 1, mortality was 4%, increasing to 8% on day 2, and reaching 28% on day 7 (Figure 3B,

Table A1. Survivorship percentage of L. decemlineata larvae treated with dsRNA targeting the SERCA and CPR genes.

Treatment	d0	d1	d2	d3	d4	d5	d6	d7
Control	100	100	100	100	100	100	100	100
dsSERCA	100	92	86	73	23	—	—	—
dsCPR	100	96	92	85	84	81	80	72

).

Regarding weight gain, both treatments resulted in a significant weight reduction. Larvae fed with dsSERCA showed a 46.3% decrease in weight gain on day 3; these larvae stopped feeding, leading to a halt in their growth. As a result, weight gain decreased by 50.4% by day 5. In contrast, larvae fed with dsCPR exhibited a 42% reduction in weight gain on day 3, followed by a slight recovery on day 5 (9.8%). However, by day 7, weight gain had significantly decreased, with a 59% reduction compared to the control (Figure 3C,

Table A2. Mean weight gain of L. decemlineata larvae treated with dsRNA targeting the SERCA and CPR genes.

Treatment	d3	d5	d7
Control	13.57	17.09	27.39
dsCPR	7.87	11.58	11.28
dsSERCA	7.29	8.47	—
Treatment	Standard error
	d3	d5	d7
Control	0.89	0.55	1.38
dsCPR	0.08	0.46	0.24
dsSERCA	0.26	0.22	—
Treatment	Post-hoc Tukey
	d3	d5	d7
Control	A	A	A
dsCPR	B	B	B
dsSERCA	B	C	—

). Thus, both dsSERCA- and dsCPR-treated larvae exhibited smaller sizes; however, only the dsCPR-treated larvae showed mottling on the dorsum (Figure 4).

In the bioassays, larvae fed leaves treated with dsSERCA showed a significant decrease in transcript levels. On day 3, transcript levels in dsSERCA-treated larvae were markedly reduced compared to those in the control (~60%). In contrast, larvae treated with dsCPR did not show a significant difference from the control at this time point. By day 5, transcript levels in dsSERCA-treated larvae continued to decline significantly (~24%). While larvae fed with dsCPR also showed a decrease in transcript levels, no significant difference was observed compared to day 3. However, by day 7, a substantial reduction in transcript levels was evident in the dsCPR-treated larvae (~50%) (Figure 3D,

Table A3. Mean relative expression of the SERCA and CPR genes in L. decemlineata larvae treated with dsRNA.

Treatment	d3	d5	d7
Control	1.00	1.00	1.00
dsCPR	0.95	0.83	0.52
dsSERCA	0.44	0.72	—
Treatment	Standard error
	d3	d5	d7
Control	0.00	0.00	0.00
dsCPR	0.03	0.09	0.13
dsSERCA	0.07	0.10	—
Treatment	Post-hoc Tukey
	d3	d5	d7
Control	A	A	A
dsCPR	A	AB	B
dsSERCA	B	B	—

).

4. Discussion

Ensuring food security has always been a challenge, but with the global population projected to surpass 9.8 billion people in the next three decades [102], the certainty of food availability is becoming an urgent global issue. Given that approximately 80% of the food consumed originates from plants [103,104], enhancing agricultural production is critical to meet the growing global demand [105]. A decade ago, it was estimated that food production would need to increase by 70% to guarantee long-term food security [106,107]. However, later studies estimated an even more daunting level of 110% [108,109]. Achieving such levels of sustained production is complicated by the limited availability of arable land, the changing environmental conditions, market restrictions, and, most critically, the escalating threat of increasingly destructive pests [108,110,111,112].

Pests have long been a persistent challenge in agriculture, although only 10% of the 70,000 known pest species worldwide are considered serious threats [113]; they are responsible for approximately 40% of annual crop production losses [114]. Among these, L. decemlineata stands out due to its ability to rapidly defoliate infested crops, resulting in substantial losses and complicating control efforts [6]. While strategies such as biological control using Beauveria bassiana, C. carnea, and Pterostichus melanarius [8,9,11], as well as cultural control methods like crop rotation [10], have been implemented, the beetle remains a persistent problem. Chemical insecticides, although widely used, have also been losing effectiveness over time [17,69,115,116].

In the search for alternative pest control strategies that avoid the problems commonly associated with pesticides, RNAi has emerged as a revolutionary third-generation pest control strategy, offering high target specificity and significantly reduced environmental impact. Nevertheless, insects have shown they can also develop resistance to this technology, as observed in D. virgifera virgifera [117].

L. decemlineata has also been shown to be capable of developing resistance to RNAi [118], and due to its high genetic variability [7], different geographic populations may respond differently to RNAi-based treatments. This variability has already been observed with the commercial dsRNA product Calantha™, which targets the gene PSMB5 (proteasome subunit beta 5), showing inconsistent efficacy across L. decemlineata populations [119]. Therefore, the identification and validation of novel target genes whose silencing can effectively control pests of agricultural importance remain an important task. In this context, this study represents the first attempt to explore the silencing of SERCA and CPR genes, both involved in the essential biological processes of L. decemlineata.

The SERCA gene encodes the Sarco/Endoplasmic Reticulum Ca²⁺-ATPase, a crucial enzyme for muscle function. It is particularly important in the flight muscles, where rapid calcium cycling is required for sustained contractions. Additionally, SERCA is involved in neuronal activity, hormonal secretion, development, and stress responses [91,92,93,94]. Similarly, the CPR gene encodes NADPH–Cytochrome P450 Reductase, responsible for transferring electrons from NADPH to the heme center of Cytochrome P450s, thereby regulating their enzymatic activity [77,78]. As a result, CPR enables Cytochrome P450s to perform critical functions such as detoxification, hormone synthesis, and metabolism [78,79,80,81,82,83].

In this study, silencing the SERCA gene resulted in a rapid decline in larval survival, culminating in 100% mortality by day 5 of the experiment. This highlights the critical role of SERCA in larval physiology and suggests that the interference of genes implicated in calcium regulation exerts profound physiological effects on L. decemlineata. This result is consistent with reports indicating that impaired SERCA function leads to muscle dysfunction and cardiac disorders, in addition to compromising critical processes such as the Notch signaling pathway, intestinal actin cytoskeleton assembly, and chitin synthesis [97,120,121].

Other genes, when silenced, have also resulted in high mortality. For example, silencing β-Actin produced 100% mortality by day 5 using transgenic plants expressing dsRNA [99]. Similarly, silencing the Ran gene caused the complete inhibition of larval growth, leading to 100% mortality in just three days [47], while silencing the EcR gene resulted in up to 80% mortality by day 3 [50].

On the other hand, silencing CPR resulted in a more gradual mortality pattern, indicating a less immediate but still significant impact on larval viability. The 28% mortality observed on day 7 after CPR silencing is comparable to the 14.5–32.2% mortality reported for JHAMT silencing in L. decemlineata by day 6 [60], and slightly comparable to the 47% mortality observed on day 9 after silencing the ACE1 gene [44].

Although the mortality induced by CPR silencing in this study was lower than that observed with SERCA silencing, previous research has shown that CPR knockdown disrupts electron transfer, affecting the metabolic activity of Cytochrome P450 enzymes and compromising xenobiotic detoxification [122,123,124]. Consequently, several studies have highlighted an increased susceptibility of insects to various insecticides following CPR disruption. For instance, CPR gene silencing has been shown to enhance the sensitivity of Sitophilus zeamais, Aphis gossypii, T. urticae, Tetranychus cinnabarinus, Laodelphax striatellus, Locusta migratoria, Nilaparvata lugens, and Bactrocera dorsalis to malathion, cypermethrin, imidacloprid, fenpropathrin, sulfoxaflor, buprofezin, carbaryl, terpinen-4-ol, abamectin, bifenthrin, and fenpyroximate [85,123,125,126,127,128,129,130].

While CPR silencing alone did not cause high mortality, its potential role in increasing L. decemlineata susceptibility to insecticides remains an unexplored avenue. Furthermore, given that most insects possess a single CPR gene [80], novel research evaluating the synergistic effects of CPR knockdown combined with insecticide exposure could provide valuable insights into novel CPB management strategies.

The effects of RNAi in L. decemlineata have shown considerable variability, with different genes eliciting distinct levels of mortality and growth inhibition. For instance, Tai silencing led to approximately 20% larval mortality and an 80% pupation failure rate [48], and Mesh gene silencing caused 77% mortality by day 7 [46], whereas targeting Sec23, vATPase E, vATPase B, COPβ, β-Actin, and Shd led to mortality rates of up to 80% by day 12 [45,53], underscoring that mortality outcomes depend on the specific gene being targeted.

Despite the advances in RNAi-based control strategies for L. decemlineata, further optimization is required, particularly in identifying genes whose silencing induces high mortality during the early larval instars, which represent the stages of development where the greatest defoliation damage occurs [5].

In this study, both dsSERCA and dsCPR treatments significantly reduced larval weight gain compared to the control group. While no significant differences were observed between treatments on day 3, SERCA silencing had a more severe impact in the following days, leading to a complete stagnation in weight gain until larval death on day 5. In contrast, CPR silencing also reduced weight gain but to a lesser extent, allowing larvae to survive longer.

Interestingly, despite the similarity in phenotypic outcomes between dsSERCA and dsCPR, transcript analysis showed distinct expression patterns. CPR transcripts showed a more gradual decline throughout the experiment, corresponding to a less pronounced impact on weight gain and a progressive reduction in survival. However, SERCA transcript levels showed a marked decrease on day 3, followed by an unexpected increase in surviving larvae on day 5.

Since RNAi is a knockdown, not a knockout, method, complete gene silencing does not occur, and the effect is typically transient. Thus, the continuous and large-scale delivery of dsRNA targeting the gene is necessary to sustain insect mortality [45]. Based on this, we hypothesize that the increase in transcript levels observed on day 5 in larvae treated with dsSERCA could be due to the cessation of larval feeding, which would likely reduce dsRNA uptake and consequently diminish the effectiveness of gene silencing. Additionally, an alternative explanation involves regulatory feedback mechanisms, where gene expression is modulated beyond the direct effect of RNAi. Compensatory mechanisms, such as the upregulation of paralogous genes or the re-expression of the target gene itself, have been reported following RNAi treatment [131]. Notably, compensatory upregulation at the nuclear level can lead to increased RNA detection with qPCR, even if post-transcriptional repression in the cytoplasm remains sufficient to elicit a strong phenotype. Moreover, certain genes may remain functional even with residual transcript levels above 30–40%, which can still induce significant phenotypic effects, further complicating the interpretation of RNAi efficacy [132].

This phenomenon has been observed in other studies where the silencing of genes such as vacuolar-ATPase, acetylcholinesterase, arginine kinase, and chymotrypsin in species like C. partellus, Liriomyza trifolii, and Euschistus heros showed similar outcomes [133,134,135]. Similarly, the silencing of the JHAMT1, SAHase, ACE1, and Shd genes in L. decemlineata has demonstrated that transcript levels do not always correlate directly with phenotypic outcomes such as weight gain or mortality rates [44,53,54,60].

Given these complexities, qPCR results should be interpreted with caution, as they may not fully capture the functional consequences of gene silencing. In contrast, phenotypic quantification remains the most reliable method for assessing the efficacy of gene-targeted RNAi in a biological process [132].

A critical aspect influencing RNAi efficacy is dsRNA stability. In this study, both dsSERCA and dsCPR exhibited the same length (290 bp) and GC content (40%), yet their predicted stability differed significantly. dsSERCA exhibited lower thermodynamic stability compared to dsCPR. Interestingly, studies using hairpin RNAs have shown this trend, where lower thermodynamic stability is correlated with enhanced gene silencing, likely due to improved accessibility for Dicer processing [136]. Therefore, although structural stability is desirable to prevent premature degradation in the environment until ingestion by insects [137], overly stable structures may hinder Dicer recognition or cleavage efficiency, ultimately reducing RNAi efficiency.

In addition to dsRNA stability, the choice of the mRNA target region is another crucial factor. There have been contradictory results reported regarding which mRNA region (5′ or 3′) results in more effective silencing [138,139,140]. However, beyond the position within the transcript, the structural properties of the target sites—such as GC content, secondary structure, accessibility, and the number of hydrogen bonds that stabilize the mRNA—may play a more decisive role in determining RNAi efficiency [141,142,143,144]. While more research is needed to elucidate the factors that govern RNAi efficacy, evidence suggests that optimizing the length and stability of dsRNA, delivery methods, and the target genes are the most crucial factors for improving gene silencing efficiency. Given its specificity and potential for sustainable pest control, RNAi remains a valuable tool in modern agriculture.

5. Conclusions

Our study demonstrates that silencing the SERCA gene is a promising target for controlling L. decemlineata, and additional research should further explore the suitability of this gene in pest control. However, while silencing the CPR gene was less effective, it remains a gene of interest because it plays a crucial role in the function of Cytochrome P450s, which are involved in detoxification processes. Therefore, the silencing of the CPR gene could be combined with insecticides to enhance the control of CPB.

As pests continue to develop resistance to conventional insecticides, RNAi is an alternative pest management technology with high specificity and minimal environmental risks. However, for its successful integration into pest management strategies, further research is needed to refine delivery methods, optimize dsRNA design, and explore genetic targets that maximize RNAi efficacy. A holistic approach combining RNAi with other pest control measures will ensure its effectiveness and long-term sustainability in agriculture.